Item 3
Use the Distributive Property to simplify the expression.

15 (4n-2)

Answers

Answer 1

Answer:

distributive property solve 3 into 4 - 2

Answer 2

Hello!

The Distributive Property states the following:

a(b+c)=ab+ac

where

a, b, and c can be either constants or variables.

Now, simplify:

15(4n-2)

15*4n - 15*2

60n-30

And we can't simplify it any further, because 60 n and 30 aren't like terms.

Hope everything is clear.

Let me know if you have any questions!

#KeepOnLearning

:-)


Related Questions

simplify x-2 divided by/over 7(x-2)^2
it looks like this;

x-2
------------
7(x-2)^2

Answers

Answer:

 1  / 7x−14

Step-by-step explanation:

x−2  / 7(x−2)2

= x−2  / 7x2−28x+28

=  x−2  / 7(x−2)(x−2)

=  1  / 7x−14

The value of the expression (x - 2) / 7 (x - 2)² will be 1 / 7 (x - 2).

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

Given that;

The expression is,

⇒ (x - 2) / 7 (x - 2)²

Now,

Simplify the expression as;

The expression is,

⇒ (x - 2) / 7 (x - 2)²

⇒ (x - 2) / 7 (x - 2) (x - 2)

⇒ 1 / 7 (x - 2)

Thus,

The value of the expression (x - 2) / 7 (x - 2)² will be 1 / 7 (x - 2).

Learn more about the expression visit:

https://brainly.com/question/4344214

#SPJ2

What is estimation? When is it helpful to use estimation?

Answers

Answer:

Estimation is the process of arriving at an approximate answer to a question. It is helpful to use estimation when you need to calculate something fast or the data/information your given is uncertain or unstable  

Step-by-step explanation:

Pls help 15 points
Which model best represents 33 1/3%

Pls help 15 pointsWhich model best represents 33 1/3%

Answers

Answer:

pretty sure its a

Step-by-step explanation:

just count

e : f = 2 : 3 and f : g = 7 : 8 Work out e : g Give your answer in its simplest form.​

Answers

Answer:

e : g = 7:9

Step-by-step explanation:

Given:

e : f = 2 : 3

f : g = 7 : 8

Find:

e : g

Computation:

(e/f) x (f/g) = (2/3)(7/8)

e/g = 7/9

e : g = 7:9

Hi does anybody know the answer to this?

Hi does anybody know the answer to this?

Answers

Answer:

(L)= 36 ft. 3/10

Step-by-step explanation:

Correct me if I'm wrong. Have a good day! :)

Answer:

28 ft

Step-by-step explanation:

50+50+33+33=166 <-- Perimeter of Mss Roberts

Mr Neils width is 1.1 * 50 = 55

166 = 55 + 55 +2l

56=2l

28 = l

the length is 28 ft.

Find the vertices and foci of the ellipse.49x^2 = 81 - 81y^2

Answers

Given the following equation of an ellipse:

\(49x^2=81-81y^2\)

The standard form equation of an ellipse is:

\(\text{ }\frac{(x-h)^2}{a^2}\text{ + }\frac{(y-k)^2}{b^2}\text{ = }1\)

Where (h, k) is the center, a and b are the lengths of the semi-major and the semi-minor axis.

Let's transform it into the standard form:

\(49x^2=81-81y^2\)\(49x^2+81y^2=81\)\(\frac{49x^2+81y^2=81}{81}\)\(\frac{49x^2}{81}+\frac{y^2}{1}=1\)\(\frac{x^2}{\frac{81}{49}}+\frac{y^2}{1}=1\)\(\frac{(x-0)^2^{}}{\frac{81}{49}}+\frac{(y-0)^2^{}}{1}=1\)\(\frac{(x-0)^2}{(\frac{9}{7})^2}+\frac{(y-0)^2}{1}=1\)

From this equation, we get:

\(\begin{gathered} \text{ h = 0} \\ \text{ k = 0} \\ \text{ a}^2\text{ = }\frac{81}{49}\text{ }\rightarrow\text{ a = }\sqrt[]{\frac{81}{49}}\text{ }\rightarrow\text{ a = }\frac{9}{7} \\ \text{ }b^2\text{ = 1 }\rightarrow\text{ b= }\sqrt[]{1}\text{ }\rightarrow\text{ b = 1} \end{gathered}\)

For c,

\(\text{ c = }\sqrt[]{a^2-b^2}\text{ = }\sqrt[]{(\frac{9}{7})^2\text{ - 1}}\text{ = }\sqrt[]{\frac{81}{49}\text{ - 1}}\text{ = }\sqrt[]{\frac{81}{49}-\frac{49}{49}}\text{ = }\sqrt[]{\frac{32}{49}}\text{ = }\frac{4\sqrt[]{2}}{7}\)

Let's now get the foci of the ellipse:

The first focus: (h - c, k)

\(\text{ (h - c, }k)\text{ = (0 - }\frac{4\sqrt[]{2}}{7},\text{ 0)}\)\(\text{ (h - c, }k)\text{ = (-}\frac{4\sqrt[]{2}}{7},\text{ 0)}\)

The second focus: (h + c, k)

\(\mleft(h+c,k\mright)\text{ = (0 + }\frac{4\sqrt[]{2}}{7},\text{ 0)}\)\((h+c,k)\text{ = (}\frac{4\sqrt[]{2}}{7},\text{ 0)}\)

Next, let's find the vertices:

The first vertex: (h − a, k)

\(\text{ (h - a, k) = }(0\text{ - }\frac{9}{7},\text{ 0)}\)\(\text{ (h - a, k) = }(\text{-}\frac{9}{7},\text{ 0)}\)

The second vertex: (h + a, k)

\(\text{ (h + a, k) = }(0+\frac{9}{7},\text{ 0)}\)\(\text{ (h + a, k) = }(\frac{9}{7},\text{ 0)}\)

In Summary:

Therefore, in an ellipse with the equation 49x^2 = 81 - 81y^2,

The foci of the ellipse are:

\(\text{(-}\frac{4\sqrt[]{2}}{7},\text{ 0), (}\frac{4\sqrt[]{2}}{7},\text{ 0)}\)

The vertices of the ellipse are:

\((\text{-}\frac{9}{7},\text{ 0), }(\frac{9}{7},\text{ 0)}\)

a) (10 pts) Re-express the given differential equation as a first order differential equation by utilizing matrix
and vector notation and in accordance with ()

= () form.
b) (10 pts) Is the system obtained in (a) stable, neutrally stable of unstable? Determine this using matrix.
c) (10 pts) Compute the eigenvalues and eigenvectors of matrix.
d) (10 pts) Using the results computed in (c) find and matrices and show that =

relationship
(i.e., the diagonalization relationship) is a valid relationship.

a) (10 pts) Re-express the given differential equation as a first order differential equation by utilizing

Answers

a) To re-express the given differential equation as a first-order differential equation using matrix and vector notation, we can rewrite it in the form:

\(x' = Ax\)

where x is a vector and A is a square matrix.

b) To determine the stability of the system obtained in part (a), we need to analyze the eigenvalues of matrix A.

If all eigenvalues have negative real parts, the system is stable.

If at least one eigenvalue has a zero real part, the system is neutrally stable.

If at least one eigenvalue has a positive real part, the system is unstable.

c) To compute the eigenvalues and eigenvectors of matrix A, we solve the characteristic equation

\(det(A - \lambda I) = 0\),

where λ is the eigenvalue and I is the identity matrix.

By solving this equation, we obtain the eigenvalues.

Substituting each eigenvalue into the equation

\((A - \lambda I)v = 0\),

where v is the eigenvector, we can solve for the eigenvectors.

d) Once we have computed the eigenvalues and eigenvectors of matrix A, we can construct the diagonalization relationship as follows:

\(A = PDP^{(-1)}\)

where P is a matrix whose columns are the eigenvectors of A, and D is a diagonal matrix whose diagonal elements are the eigenvalues of A.

To show that this relationship is valid, we can compute \(PDP^{(-1)}\) and verify that it equals A.

For such more questions on differential equation

https://brainly.com/question/18760518

#SPJ8

Help please do soon

Help please do soon

Answers

ANSWER:

A

It says I need 20 characters so I’m just writing this. But the answer is (a)










On a test that has a normal distribution, a score of 29 falls three standard deviations above the mean, and a score of 23 falls one standard deviation above the mean. Determine the mean of this test.

Answers

The mean of the test is 20.

To determine the mean of the test, we need to use the information provided about the scores falling above the mean in terms of standard deviations.

Let's denote the mean of the test as μ, and the standard deviation as σ.

We are given that a score of 29 falls three standard deviations above the mean, so we can write this as:

29 = μ + 3σ

Similarly, we are told that a score of 23 falls one standard deviation above the mean, which can be expressed as:

23 = μ + σ

Now we have a system of two equations with two variables (μ and σ). We can solve this system of equations to find the values of μ and σ.

From the second equation, we can isolate μ:

μ = 23 - σ

Substituting this value into the first equation, we have:

29 = (23 - σ) + 3σ

Simplifying the equation, we get:

29 = 23 + 2σ

2σ = 29 - 23

2σ = 6

σ = 3

Substituting the value of σ back into the second equation, we find:

μ = 23 - 3

μ = 20

For more such questions on mean

https://brainly.com/question/29368683

#SPJ8

What is the volume of the object?
Two rectangular prisms are side by side. The dimensions of the larger rectangular prism are 8 c-m, 6 c-m, and 13 c-m and the dimensions of the smaller rectangular prism are 3 c-m, 4 c-m, and 7 c-m.
A
41cm3
B
526cm3
C
708cm3
D
52,416cm3

Answers

The total volume is the one in option C, 708 cubic centimeters.

What is the volume of the object?

We know that this prism can be divided into two prisms, and remember that the volume of a prism is equal to the product between its dimensions.

Then the volume of the first prism is:

V = 8cm*6cm*13cm = 624 cm³

And the volume of the second prism is:

v' = 3cm*4cm*7cm = 84 cm³

Adding that we will get:

total volume =  624 cm³+  84 cm³ = 708 cm³

LEarn more about volume at:

https://brainly.com/question/1972490

#SPJ1

The ratio of the number of picture books encyclopedias, and fairy tale books Annette had is 3:4:5 She have half of her encyclopedias to her brother and he gave her 5 books of fairytales Now she has 14 more books of fairy tales than encyclopedias How many picture books does she have

Answers

The number of picture books does Annette have is 76 books.

Given the ratio of picture books , encyclopedias and fairy tales books is 3:4:5 and she have half of her encyclopedias to her brother and  he gave her 5 books of fairytales

We need to find the number of picture books does she have

According to the statement the total number of books does Annette have is

3k+4k+5k = 12k

Where k is total number of books

Now , Picture book she have = 3/12k = 1/4k

Encyclopedia she have = 4/12k = 1/3k

Fairy tale she have = 5/12k

Here,

Encyclopedia +14 = Fairy tale

Substituting the values of Encyclopedia and Fairy tale

(1/3 -1/2)k +14 = (5/12k -5 )

Therefore.

(1/6k+14) = (5k/12-5)

Therefore,

14+5 = 5k/12 - k/6

Therefore,

19 = 3k/12

19*4=k

76 = k

Here k = 76 books

Hence the total number of picture books does she have is 76

Learn more about ratio here

https://brainly.com/question/2328454

#SPJ10

Is 1 = 2 always a false statement?

Answers

Answer:

yes, 1 can never equal 2 unless it is manipulated (ex: 1(2) = 2)

because one is not being manipulated to equal 2 here, it is a false statement and will always be a false statement.

Answer:

yes

Step-by-step explanation:

Mathematicaly speaking yes

7) Shelby is making cookies. She uses cups of
sugar for every 2 cups of flour. How many cups of
sugar does she need when she uses 3 cups of flour?
Show your work.

Answers

1.5 cups
As for 2 cups of flour 1 cup of sugar
1 cup of flour = 1/2 =0.5 cups of sugar per cup
0.5* 3 cups = 1.5 cups of sugar

Plz help I need help

Plz help I need help

Answers

Answer:

D

Step-by-step explanation:

Im smart that how i know :)

Answer:

D. 6

Explanation: count up until you get to 2

a water snake in a well is 30 M below the ground level its lights 20 m upward and then slips down 10 M how far it is from the ground level
\( - 30 - + 20 - - 10\)

Answers

If the water snake is initially 30 meters below the ground level and then climbs 20 meters upward, it will be 30 - 20 = 10 meters below the ground level. However, if it then slips down 10 meters, it will be 10 + 10 = 20 meters below the ground level.

A basketball player had 2 free-throws at the basket missed out of 25 free-throws in all.

What percent of free-throws were missed?

Answers

Answer:

92%

Step-by-step explanation:

p/w=%/100

Since he only missed two you do 25-2 which equals 23

23/25=%/100

23×100=2,300

2,300÷25=92

Hope this helps! Plz mark as brainliest! :)

Answer:

92%

Step-by-step explanation:

p/w=%/100

Since he only missed two you do 25-2 which equals 23

23/25=%/100

23×100=2,300

2,300÷25=92

Hope this helps! Plz mark as brainliest! :)

Step-by-step explanation:

Accounting systems are important because they are a primary source of information for managers.

Answers

Thw given statement " Accounting systems are important because they are a primary source of information for managers" is true.

What kinds of accounting systems exist?

Two categories of accounting systems exist: In the first, a small business uses a single entry system to log each transaction as a line item in a ledger. The alternative is a double entry system, in which each transaction is entered in two different accounts as both a debit and a credit.

Accounting systems are crucial since they serve as managers' main informational resource. The accounting system is likely to provide the information that is needed for many, if not most, decisions. Whether the accounting system is giving managers access to the "best" information is our main concern.

Learn more about managers at:

https://brainly.com/question/24553900

#SPJ1

complete question:

TRUE OR FALSE Accounting systems are important because they are a primary source of information for managers.

Nemo can make a monthly payment of $565 for a car. If the annual interest rate he
qualifies for is 9% for 4 years, what price could he afford for the car?

Answers

Answer:$ 24,679.20 or 514.15 a month

Step-by-step explanation: 565(.09) is 50.85 which needs to be deducted from the payment of 565 because he needs to be able to pay for interest. 514.15 is then multiplied by 48 months which will bring you to 24,679.20

Aaron is buying some fruit at grocery store the score reads 4 3/4 pounds what is the decimal equivalent of this mixed number

Answers

To find the decimal equivalent we need to transform the mixed number into a fraction as:

\(a\frac{b}{c}=\frac{a\cdot c+b}{c}\)

So, 4 3/4 pounds is equivalent to:

\(4\frac{3}{4}=\frac{4\cdot4+3}{4}=\frac{16+3}{4}=\frac{19}{4}\)

Now, we just need to make the division of 19 by 4:

\(\frac{19}{4}=4.75\)

So, we get that the decimal equivalent to the mixed number is 4.75

Answer: 4.75

DEF and RST are complementary angles. If DEF is (3(-5 + 2x)) and RST is (x - 7), what is the measure of DEF?

Answers

From the given information, the measure of DEF is 81°

Calculating the measure of angles

From the question, we are to determine the measure of DEF

From the given information,

DEF and RST are complementary angles. This means they sum up to 90°

Thus,

(3(-5 + 2x)) + (x - 7) = 90

(3(-5 + 2x)) + (x - 7) = 90

(-15 + 6x) + (x - 7 ) = 90

-15 + 6x + x - 7 = 90

6x + x = 90 + 15 + 7

7x = 112

x = 112/7

x = 16

Then, substitute the value of x to determine the measure of DEF

(3(-5 + 2x))

= (3(-5 + 2(16)))

= (3(-5 + 32))

= (3(27))

= 81°

Hence, the measure of DEF is 81°

Learn more on Calculating the measure of angles here: https://brainly.com/question/12047360

#SPJ1

If the zeros of a quadratic functions are -2 and 4, which graph could represent the function? A. A parabola declines from (negative 3 point 1, 10) through (negative 3, 8), (negative 2, 0), (negative 1, negative 4), (1, negative) and rises through (2, negative 8), (3, negative 4), (4, 0), (5, negative 6), and (5 point 5, 10). B. A parabola declines from (negative 5 point 8, 10), (negative 5, 7), (negative 4, 0), (negative 8, negative 2), (negative 1, negative 8 point 4) and rises through (2, 0), (3, negative 6) and (3 point 9, 10). C. A downward open parabola rises from (negative 6 point 2, negative 10), (negative 5 point 2, negative 6), (negative 4, 0), (negative 3, 1) and declines through (negative 1 point 4, negative 2), (1, negative 4), (0, negative 8), and (0 point 5, 10). D. A downward open parabola rises from (negative 0 point 5, negative 10), (0, negative 8), (1, negative 4), (2, 0), (3, 1), and declines through (5, negative 4), (6, negative 8), and (6 point 5, negative 10) on the x y coordinate plane.

Answers

Option A. The only graph that could represent the function with the zeros of -2 and 4 is the graph is : A parabola declines from (negative 3 point 1, 10) through (negative 3, 8), (negative 2, 0), (negative 1, negative 4), (1, negative) and rises through (2, negative 8), (3, negative 4), (4, 0), (5, negative 6), and (5 point 5, 10).

How to determine the graph

The zeros of a quadratic function are the x-values where the function equals zero (where it crosses the x-axis). In this case, you mentioned that the zeros of the function are -2 and 4.

Looking at the provided options:

A. This graph crosses the x-axis at (-2, 0) and (4, 0), which are indeed the zeros of the function. Therefore, this could be a possible representation of the function.

B. This graph crosses the x-axis at (-4, 0) and (2, 0). These are not the zeros given for the function (-2 and 4), so this graph is not a possible representation of the function.

C. This graph crosses the x-axis at (-4, 0), but it never crosses at x=4. Instead, it crosses at x=2. Therefore, this is not a possible representation of the function.

D. This graph crosses the x-axis at (2, 0), but does not cross the x-axis at x=-2. Therefore, this is not a possible representation of the function.

So, the only graph that could represent the function with the zeros of -2 and 4 is the graph provided in Option A.

Read mroe on quadratic graph here:https://brainly.com/question/1523847

#SPJ1

A large bag contains 7/12 pounds of nails. How many 1/8 pound bags can be filled with this amount of nails?

Answers

Answer: 4 bags

Division is nessacery

7/12 divide by 1/8= 4.6666667

Full bags will be 4

Step-by-step explanation:

1. Use the elimination strategy to solve this linear system:
(1) 12c + 28d = 12 (2) -20c + 16d = 168

2. Determine the number of solutions of this linear system:
(1) 7x − 3y = 43 (2) 7x - 3y = 13 ​

Answers

The solution to the linear system is c = -6 and d = 3.

To solve the linear system using the elimination strategy, we can eliminate one variable by adding or subtracting the equations. Let's solve the first linear system:

(1) 12c + 28d = 12

(2) -20c + 16d = 168

To eliminate one variable, we can multiply equation (1) by 5 and equation (2) by 3, which will result in opposite coefficients for 'c'. This will allow us to eliminate 'c' when adding the equations together:

(1) 60c + 140d = 60

(2) -60c + 48d = 504

Now, we can add the equations:

(60c + 140d) + (-60c + 48d) = 60 + 504

188d = 564

d = 564/188

d = 3

Substituting the value of 'd' back into equation (1):

12c + 28(3) = 12

12c + 84 = 12

12c = 12 - 84

12c = -72

c = -72/12

c = -6

The solution to the linear system is c = -6 and d = 3.

Now let's analyze the second linear system:

(1) 7x - 3y = 43

(2) 7x - 3y = 13

By comparing the two equations, we can see that they have the same coefficients for both 'x' and 'y', and the constant terms on the right side are different. This means the lines represented by the equations are parallel and will never intersect.

The linear system has no solution.

For more questions on linear system

https://brainly.com/question/2030026

#SPJ8

Write an appropriate and interesting word sum for: 439 and 514. Solve it.​

Answers

It should be noted that this is addition of numbers and the value will be 953.

Addition of numbers

It should be noted that the question is about an appropriate and interesting word sum for 439 and 514.

This will be Joy has 439 pencils in a bag and Michael has 514 pencils in another bag. How many pencils for they have together?

This will be;

= 439 + 514

= 953.

Learn more about addition on:

https://brainly.com/question/2456601

is of 12 equal to 9?
no​

Answers

Answer:

12=9

Obviously

.................

What is the definition of perpendicular lines?

1.two lines that intersect in a way that forms right angles

2.two lines that intersect in a way that cuts both lines in half

3.two lines that intersect in a way that they share more than one common point

4.two lines that intersect in a way that forms two congruent angles

Answers

Answer:

Step-by-step explanation:

The correct definition of perpendicular lines is option 1: "Two lines that intersect in a way that forms right angles."

When two lines intersect to form four right angles (90-degree angles), they are said to be perpendicular to each other. The point at which the lines intersect is called the point of intersection.

Therefore, option 1 is the correct definitation of perpendicular lines.

Answer: 1. Two lines that intersect in a way that forms right angles.

Step-by-step explanation:

Hope this helped! :)

Jane, Shen, and Chris sent a total of 152 text messages during the weekend. Shen sent 4 times as many messages as Chris. Jane sent 8 more messages than
Chris. How many messages did they each send?

Answers

Answer:

Chris=24

Jane=32

Shen=96

Step-by-step explanation:

Chris= x

Jane = x + 8

Shen = 4x

6x+8= 152

152-8=144

6x=144

144/6=24

x=24

Please hurry, will mark brainliest if you answer correctly

Please hurry, will mark brainliest if you answer correctly

Answers

Answer:

0

Step-by-step explanation:

25/5=5, 5+7=12, 4*3=12, 12-12=0

Answer:

The answer is 0

Step-by-step explanation:

The order of the operations is:

ParenthesisExponentsMultiplication and divisionAddition and subtraction

So first multiply \(4 \cdot 3 = 12\) and after divide \(\frac{25}{5} = 5\) and sum this result to 7 for substract to -12.

Assume the average nightly payroll for a city’s downtown restaurants on the weekend is $2200 with a standard deviation of $300. The distribution has a bell-shaped curve. A manager wants to be 99% sure he has this cost covered for the next four weeks and puts away $10,000. Will he have enough? Use your z-score formula result to justify your answer. Please respond with the dollar amount and round to the nearest dollar.

Hint: Round your z-value to the hundredths place and direction of the graph will matter.

Answers

Given statement solution is :- The manager will have enough funds, and the amount set aside ($10,000) is sufficient to cover the payroll for the next four weeks.

To determine if the manager will have enough funds to cover the nightly payroll for the next four weeks, we need to calculate the total cost for four weeks and compare it to the amount set aside.

The nightly payroll has a mean of $2200 and a standard deviation of $300. Since there are seven nights in a week, the weekly payroll can be calculated as:

Weekly Payroll = Nightly Payroll * Number of Nights in a Week

= $2200 * 7

= $15,400

To calculate the total cost for four weeks, we multiply the weekly payroll by four:

Total Cost for Four Weeks = Weekly Payroll * Number of Weeks

= $15,400 * 4

= $61,600

Now, let's calculate the z-score using the formula:

z = (X - μ) / σ

Where:

X = Total Cost for Four Weeks

μ = Mean of the distribution

σ = Standard deviation of the distribution

z = ($61,600 - $2200) / $300

z = $59,400 / $300

z ≈ 198

To determine if the manager will have enough funds to cover the payroll, we need to find the proportion of the distribution that is less than or equal to the z-score. This can be done by consulting a standard normal distribution table or using statistical software.

For a z-score of 198, the proportion in the tail of the distribution is essentially 1 (or 100%). This means that the manager is virtually guaranteed to have enough funds to cover the payroll for the next four weeks.

Since the manager has set aside $10,000, which is less than the calculated total cost of $61,600, he will indeed have enough funds to cover the payroll.

Therefore, the manager will have enough funds, and the amount set aside ($10,000) is sufficient to cover the payroll for the next four weeks.

For such more questions on Funds Cover Payroll: Confirmed

https://brainly.com/question/32039603

#SPJ8

On a road trip, a family drives 350 miles per day. How many days, d, must they travel to reach a distance of at least 1400?
Solve the inequality. What does the solution represent in this situation?
Activate Window

Answers

Answer:

350d ≥ 1400

Hope it helps

Other Questions
Whoever gives me the correct answer to this will get a brainlest I need the answer ASAP! Using the given DNA segment, design 18-22 bases primers to amplify this whole DNA fragment. Be sure you give the primers sequence in 5'>3. DNA segment: 5' GGTTTCTTCCTACCTCAAGAAGGTAGGATACAACCCTGACAAGATCCCCTTTGTCCC CATCTCTGGTTT 3' A Determine the end behavior of each function.(a) p(x) = a(x + b)5(x c)3, where a, b, and c are constants and a < 0.p(x) as x p(x) as x (b) f(x) = 9x2 11x + 28x2 6f(x) as x f(x) as x (c) g(x) = 9 + e6xg(x) as x g(x) as x In the poem ""written at the close of spring"" what difference does Smith indicate exists between nature and humans If there were 45,000 pounds of raw materials on hand on April 1st, 70,000 pounds are desired for inventory at April 30th, and 350,000 pounds are required for April production, how many pounds of raw materials should be purchased MODELING REAL LIFE A post-and-beam frame for a shed is shown in the diagram. Does the brace form a right triangle with the post-and-beam? 15 in 25 In yes no Explain! Hey! can someone tell me what this says please A Championship SeasonThe Algenauts baseball team just finished a great year. During the season, theywon three out of every four of their home games and two out of every three oftheir away games. All together they won 40 more games than they lost. If theyplayed as many home games as away games, what was their final record ofwins and losses? Calculate the change in time for each quarter of the track. Record the change in time in Table C of your Student Guide.The change in time for the first quarter is _____ seconds.The change in time for the second quarter is _____ seconds.The change in time for the third quarter is _____ seconds.The change in time for the fourth quarter is _____ seconds. What happens to the value of the digits in a number when the number is divided by 10^1? A. Each digit has a value that is 1/1,000 of its value in the original number. B. Each digit has a value that is 10 times its value in the original number. C. Each digit has a value that is 1/10 of its value in the original number. D. Each digit has a value that is 1/100 of its value in the original number. Is 11:59 pm at night or in the morning? ten more than twice a number Graph the inequality on a plane.5y - 6x > 30 What is the area of the triangle in this coordinate plane?A. 9. 0 units2B. 14. 0 units2C. 16. 5 units2D. 24. 5 units2 Which graphical element is used in the excerpt?capitalized lettersinconsistent line lengthsenjambmentlyrical meter in the lines A shop charges $4.95 for a large 9-ounce frozenyogurt.What is the cost per ounce of the frozen yogurt? 8: Two supplementary angles have measurements of (3x)" and (10x - 15). What are the measures of thetwo angles?A 45 and 135B 25 and 65C 15 and 165D 30 and 60 Is 47 an answer choice Find f(x) if f'(x) = 6x+2 and f(2)=10 f(x)=18x^3-2x^2-126 f(x)=12x^2 + 2x-42 f(x)=2x^3-x^2-2f(x) = 2x^3-2x^2+2 none of these f(x)=12x^2 +x-40 f(x)=3x^2 +2x-6 f(x)=18x^3-x^2-130 f(x)=3x^2+x-4 which of the following is not considered a core criteria in privacy management theory for deciding how we choose to release information about ourselves and to whom? Two identical circular, wire loops 35.0 cm in diameter each carry a current of 2.80 A in the same direction. These loops are parallel to each other and are 24.0 cm apart. Line ab is normal to the plane of the loops and passes through their centers. A proton is fired at 2600 m/s perpendicular to line ab from a point midway between the centers of the loops.Find the magnitude of the magnetic force these loops exert on the proton just after it is fired.