Polymerase chain reaction or PCR is a technique used to amplify a specific DNA sequence. PCR requires the use of primers, which are short, synthetic DNA sequences.
The primers are complementary to the target DNA sequence at the 5' and 3' ends of the DNA segment being amplified. The DNA segment given is:5' GGTTTCTTCCTACCTCAAGAAGGTAGGATACAACCCTGACAAGATCCCCTTTGTCCC CATCTCTGGTTT 3' AA pair of primers can be designed to amplify this DNA segment.
The following are the forward and reverse primers: Forward primer: 5' GGTTTCTTCCTACCTCAAGAAGGTAGGATACAACCCTGACAAGATCCCCTTTGTCCC 3'Reverse primer: 5' AAACCAGAGATGGGACAAAGGGGATCTTGTTCAGGGTTGTATCCTACCTTCTTGAGGTAGGAAGAAACC 3'The forward primer has 22 bases, while the reverse primer has 30 bases.
The reverse primer is longer because it includes the entire 3' end of the target DNA sequence. It is important to include the entire 3' end of the target DNA sequence in the reverse primer to ensure that the PCR product is amplified correctly.
To know more about DNA visit:
https://brainly.com/question/30006059
#SPJ11
A bacterial culture is growing exponentially. At 7:00 AM, the number of cells was estimated to be 5. 5 X 104 cells. At 11:00 AM, the number of cells increased to 8. 7 X 107 cells. What is the generation time in minutes of the bacteria? Please assume we are in the log phase of growth for this bacterial population. Please show your work
There is exponential bacterial growth. It was calculated that there were 5. 5 X 10^4 cells present at 7:00 AM. As a result, the bacteria's generation period is roughly 29.3 minutes.
Here: N = \(N_{0}\) x 2^(t/g)
Here:
\(N_{0}\) = initial number of cells
N = final no's of cells
t = time elapsed
g = generation time
We can use the information given to solve for g.
At 7:00 AM, \(N_{0}\) = 5.5 x 10^4 cells
At 11:00 AM, N = 8.7 x 10^7 cells
The time elapsed is 4 hours, or 240 minutes.
Substituting these values into the formula, we get:
8.7 x 10^7 = 5.5 x 10^4 x 2^(240/g)
Dividing both sides by 5.5 x 10^4, we get:
1582.7 = 2^(240/g)
Taking the logarithm of both sides (base 2), we get:
log (base 2) (1582.7) = 240/g
Solving for g, we get:
g = 240 / log2(1582.7)
Calculating g, we discover that it is roughly 29.3 minutes. As a result, the bacteria's generation period is roughly 29.3 minutes.
Learn more about bacterial culture Visit: brainly.com/question/29567229
#SPJ4
Which statement correctly identifies the cell type and explains why?
A. This is a plant cell; the evidence is the cell wall.
B. This is a plant cell; the evidence is the nucleus.
C. This is an animal cell; the evidence is the mitochondria.
D. This is an animal cell; the evidence is the cell membrane.
You type the keywords "formation of coal" into a
search engine. Which of the following search
results would you expect to provide the most
accurate information about how coal forms?
How does glucose enter a cell?
a. through a peripheral protein
b. through integral proteins
c. through cholesterol
d. between the phospholipids
Answer:
b
Explanation:
you are welcome......
green olives may be preserved in brine, which is a 20-30% salt solution. how does this method prevent contamination by microorganisms?
Since the question is incomplete the complete question is as follows:
Green olives may be preserved in brine, which is a 20-30% salt solution. How does this method prevent contamination by microorganisms?
1.High salt concentrations lower the pH, thus inhibiting the process of glycolysis.
2.Bacterial cell walls are shriveled up by salt, causing the cell to burst.
3.Bacteria can't survive in a hypertonic solution because they lose water.
4.High salt concentrations raise the pH, thus inhibiting the process of glycolysis.
3.Bacteria can't survive in a hypertonic solution because they lose water is the correct option because brine act as a hypertonic solution added with green olives to preserve them from action of bacteria and other microbes.
Hypertonic solution is the one which has greater solute concentration than the solvent concentration so the water will come from a bacterial cell maintaining the osmolarity of the solution. Water will move from higher concentration inside the bacterial cell to lower concentration outside the bacterial cell that is the hypertonic brine solution. The bacterial population will reduce or eliminate from the hypertonic solution and will keep the green olive preserve for long and will prevent the contamination of brine and green olive solution for long.Learn more about hypertonic solution:
https://brainly.com/question/8984839
the wet bulb temperature is 10 C the Dry bulb temperature is 14 C what is the relative humidity?
The relative humidity is approximately 22.9% based on the given wet bulb temperature of 10°C and dry bulb temperature of 14°C.
Relative humidityWet bulb temperature: 10°C = 50°F
Dry bulb temperature: 14°C = 57.2°F
SVP at wet bulb temperature: 0.284 * \(e^(17.27 * 10 / (10 + 237.3))\)= 0.284 * \(e^(-7.09)\) = 0.284 * 0.000828 = 0.0002356 psi
SVP at dry bulb temperature: 0.284 *\(e^(17.27 * 14 / (14 + 237.3))\) = 0.284 * e^(-5.97) = 0.284 * 0.002562 = 0.0007296 psi
AVP = 0.0002356 - (0.00066 * (57.2 - 50) * 14.7) = 0.0002356 - (0.00066 * 7.2 * 14.7) = 0.0002356 - 0.0686 = 0.000167 psi
RH = (AVP / SVP at dry bulb temperature) * 100
RH = (0.000167 / 0.0007296) * 100 = 0.229 * 100 = 22.9%
Learn more about relative humidity:https://brainly.com/question/30415486
#SPJ1
Analyzing Weather Maps
Page 1Page 2
A 3 column table with 6 rows, titled Atmospheric Conditions Associated with Cold Fronts. Column 1 is titled Factor and contains these entries: Dew point, Humidity, Precipitation, Pressure, Temperature. Column 2 is titled Before Front Passes and contains these entries: High, More, Showers, Decreases, Warm. Column 3 is titled After Front Passes and contains these entries: Low, Less, Showers, then no showers, Increases, Becomes cooler.
Which conditions are likely to follow the current conditions in the area? Select three responses.
high dew point
less humidity
no precipitation
lower pressure
cooler temperatures
Answer:
Less humidity, No precipatation, and cooler temperatures
Explanation:
sorry for spelling
Answer:
less humidity
no precipitation
cooler temperatures
Explanation:
got it right on edge
1. Convert the following: a. Hair is approximately 50 micrometers in diameter. Express this in kilometers. b. A hydrogen atom has a diameter of about 10 nanometers. Express this in meters. c. A hydrog
The diameter of hair is 50 micrometers.To convert micrometers to kilometers we have to divide the value in micrometers by 10^9 (1 kilometer = 10^9 nanometers).50 micrometers = 50/10^9 kilometers= 0.00000005 kilometersb.
The diameter of a hydrogen atom is 10 nanometers.To convert nanometers to meters we have to divide the value in nanometers by 10^9 (1 meter = 10^9 nanometers).10 nanometers = 10/10^9 meters = 0.00000001 metersc. The density of ice is 920 kilograms per cubic meter.
To calculate the mass of a 0.20 cubic meter block of ice we can use the formula;mass = volume × density = 0.20 cubic meters × 920 kilograms/cubic meter = 184 kilograms Therefore, the mass of the 0.20 cubic meter block of ice is 184 kilograms.
Read more about micrometers here;https://brainly.com/question/27139408
#SPJ11
Where did the elements for water come from in the first place or in the
very beginning?*
1) Fusion in stars
2) Solar winds
3) Volcanic eruptions
4) Photosynthesis
Answer:
Volcanic eruptions
Explanation:
Describe how natural selection explains the changes in species over time .
English naturalist Charles Darwin discovered the idea of natural selection.
Over time, natural selection process leads to the evolution of species. This is one way to explain how millions of species have existed on Earth. For example, the long necks of giraffes give them a competitive advantage to feed on leaves over other organisms that have shorter necks.
The beneficial characteristics spread throughout the population over time. Favorable traits are transmitted through generations which results in natural selection. Natural selection can result in speciation, the process by which one species gives rise to another that is utterly distinct from it.
To know more about natural selection refer to:
brainly.com/question/1144962
The contest between living organisms seeking similar resources.
Answer:
competition occurs when living organisms, including animals, plants, bacteria and fungi, need the same limited resources to thrive in their shared environment.
Explanation:
hope this helps (brainliest plz)*
what is the role of the centrioles in cell division?
Answer: Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them
Explanation:
The role of centrioles in cell division is to organize the microtubules that form the spindle apparatus and aid in the separation of chromosomes during mitosis and meiosis.
Centrioles are small cylindrical structures found in animal cells, typically located in the centrosome near the nucleus. They consist of microtubules arranged in a specific pattern.
During cell division, the centrioles play a crucial role in organizing the microtubules that make up the spindle apparatus. The spindle apparatus is responsible for separating the chromosomes and ensuring that each daughter cell receives a complete set of chromosomes.
In mitosis, the centrioles replicate, and the two pairs of centrioles move to opposite poles of the cell. They then direct the formation of spindle fibers, which attach to the chromosomes and pull them apart during anaphase, ensuring the equal distribution of genetic material to the daughter cells.
In meiosis, the centrioles play a similar role during the formation of the meiotic spindle. They aid in the separation of homologous chromosomes during the first division and sister chromatids during the second division, resulting in the production of haploid gametes.
Overall, the centrioles play a crucial role in cell division by organizing the microtubules that form the spindle apparatus. This ensures the proper separation and distribution of chromosomes, which is essential for maintaining the genetic integrity of the cells and the production of daughter cells with the correct chromosome number.
To learn more about centrioles, here
https://brainly.com/question/909799
#SPJ6
Which three structures are found in both prokaryotic and eukaryotic cells?
1.cytoplasm, endoplasmic reticulum, DNA
2.ribosomes, DNA, cytoplasm
3.nucleus, cell wall, cell membrane
4.cell membrane, endoplasmic reticulum, ribosomes
Answer:
It would be >>2.ribosomes, DNA, cytoplasm
To make a copy of the genetic material in the ____________ , replication of dna cannot begin until hydrogen bonds between complementary bases are broken.
To make a copy of the genetic material in the cytoplasm, replication of DNA cannot begin until the hydrogen bonds between complementary nitrogenous bases are broken.
What is DNA replication?DNA replication is the process through which the genome's DNA or genetic material is copied in the cells. Before a cell undergoes division, it must first copy or replicate its entire genome so that each of the resulting daughter cell ends up having its own set of complete genome.
Cells must replicate their DNA before they undergo divide. This ensures that each of the daughter cell gets a complete set of the genome, and therefore, show successful inheritance of genetic traits. DNA replication is an essential process and it is the basic mechanism which is conserved in all types of living organisms.
To make a copy of the genetic material such as DNA in the cytoplasm of the cell, replication of DNA cannot begin until the hydrogen bonds between complementary bases in the DNA are broken.
Learn more about DNA Replication here:
https://brainly.com/question/16464230
#SPJ4
there are techniques available that allow forensic anthropologists to estimate an individual's weight.
One technique used by forensic anthropologists to estimate an individual's weight is the regression equations based on skeletal measurements.
Regression models based on bone measurements can be used by forensic anthropologists to determine an individual's weight. These formulas were created by looking at how bone dimensions and body weight related in a sample group.
The forensic anthropologist can use these regression equations to calculate an individual's weight based on their skeletal remains by assessing particular bones or bone characteristics, such as long bone lengths or strength. It's crucial to remember that these estimates don't always match up exactly and might contain some mistake.
To know more about anthropology, visit,
https://brainly.com/question/13728734
#SPJ4
mains parts of a sheep lung and its functions ????
Six distinct lobes on both the left and right sides of the sheep lung are divided from one another by tissue septa, and each lobe can be treated or drug-delivered separately.
How do sheep lungs differ from human lungs?The lungs of sheep, like those of cattle and pigs, are highly segmented, with the right lung having four lobes and the left lung has two lobes, with the bronchus of the right cranial lobe emerging directly from the trachea before bifurcating.
While human lungs have three lobes, sheep lungs only have one. The majority of the spongy tissue in human lungs, called alveoli, is in charge of the body's gas exchange. Sheep rely on parenchyma cells, which are formations without this sort of tissue, to produce gas exchange in their bodies.
To learn more about alveoli, visit:
https://brainly.com/question/22525373
#SPJ1
If Rochester were a cell, what would be the nucleus?
A.Town hall
B.the vc!
C.Rochester High school
D.Rochester Adams High school
E.Stoney Creek High School
Answer:
correct answer is A
Explanation:
nucleus is most important part of a cell as a town hall would be to a city
12. an inbred strain of plants has a mean height of 24 cm. a second strain of the same species also has a mean height of 24 cm. when these plants are crossed, the f1 are also 24 cm. however, when the f1 plants are crossed, the f2 plants show a wide range of heights; the majority of f2 are like p1 and f1, but approximately 4 of 1000 are only 12 cm tall and 4 of 1000 are 36 cm tall. what fraction of the f2 plants will be 27 cm in height? [assume that for the genes involved in determining plant height, each allele contributes the same amount.]
In the given scenario, when an inbred strain of plants with a mean height of 24 cm is crossed with another strain of the same species, the F1 generation also exhibits a mean height of 24 cm. However, when the F1 plants are crossed, the F2 plants display a wide range of heights.
Majority of the F2 plants resemble the P1 and F1 generation, but approximately 4 out of 1000 are only 12 cm tall and 4 out of 1000 are 36 cm tall.
To determine the fraction of F2 plants that will have a height of 27 cm, we can analyze the given data. From the information provided, we can conclude that the alleles for plant height exhibit incomplete dominance, where each allele contributes the same amount. In this case, the intermediate phenotype is observed in the F1 generation with a mean height of 24 cm.
Since there is a wide range of heights observed in the F2 generation, we can infer that there is a variation in the combination of alleles that contribute to plant height. Therefore, it is not possible to determine the exact fraction of F2 plants that will have a height of 27 cm without further information about the genetic makeup of the F1 generation.
Learn more about the genetic makeup: https://brainly.com/question/15211084
#SPJ11
Why KOH solution is kept in the test tube inside the air tight conical flask while doing the experiment of respiration of seeds?
Answer:
It is kept inside to absorb the CO2 released by the germinating seeds.
Explanation:
It means it will create a cycle for the flask. So, an equal volume of water rises up in the tube.
Hope it helps.
pls help ASAP i will mark brainliest
Answer:
ok
i can help you ..............
Explanation:
drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.
in what ways was religion a part of the everyday lives of the ancient greeks?
Answer:
Religion played a significant role in the everyday lives of the ancient Greeks, permeating various aspects of their society. Here are some ways in which religion was integrated into their daily lives:
1. Worship and rituals: The ancient Greeks had a polytheistic belief system, with a pantheon of gods and goddesses. They worshiped these deities through various rituals and ceremonies. Individuals and communities would make offerings, sacrifices, and prayers to the gods as part of their religious practice. Temples and sanctuaries were important places of worship and pilgrimage.
2. Festivals and celebrations: The ancient Greeks celebrated numerous religious festivals throughout the year. These events were marked by public gatherings, processions, games, and performances. Festivals like the Olympic Games, held in honor of Zeus, were not only athletic competitions but also had a strong religious and cultural significance.
3. Oracle consultation: The Greeks believed in oracles, individuals who were believed to possess divine knowledge and the ability to communicate with the gods. People would seek guidance and advice from oracles, such as the famous Oracle of Delphi, before making important decisions or embarking on significant endeavors.
4. Civic and political life: Religion was closely intertwined with civic and political life in ancient Greece. The city-states had patron deities, and the worship of these gods and goddesses was an essential aspect of maintaining the city's well-being and prosperity. Political decisions, laws, and public affairs were often influenced by religious beliefs and practices.
5. Personal beliefs and spirituality: Religion provided a framework for individual beliefs and spirituality. The ancient Greeks sought personal connections with the gods and believed in divine intervention in their lives. They would pray for protection, success, and guidance in various endeavors, such as childbirth, marriage, or embarking on a journey.
6. Art and literature: Greek art, architecture, and literature often depicted mythological stories and religious themes. Sculptures, paintings, and epic poems celebrated the gods and depicted their interactions with humans. These artistic expressions served as a medium to convey religious beliefs, educate the masses, and honor the gods.
7. Burial practices and afterlife beliefs: The ancient Greeks held beliefs about the afterlife and the importance of proper burial practices. They believed in an underworld, where the souls of the deceased would reside. Burial rituals and customs were performed to ensure the deceased had a peaceful transition to the afterlife.
Religion was deeply ingrained in the ancient Greeks' everyday lives, influencing their values, rituals, social structures, and worldview. It provided a sense of meaning, community, and guidance, shaping various aspects of their society and individual experiences.
Explanation:
1.
are molecules made of amino acids which
are used for building materials and other processes
in the cell.
Answer:
proteins
Explanation:
Proteins are bio-molecules made up of amino acids, they are called workers of the cell because they perform many functions within them. Some functions are: correcting DNA, providing structure for hormones, enzymes,etc.
I passed all my exams because of brainly!
Answer: sheesh
Explanation:
what is the most common way that a bacterium can acquire a plasmid with genes for antibiotic resistance from another bacterium?
Answer: During sexual reproduction or Viruses can pick DNA (including plasmids) from one bacterium
Explanation:
The the most common way that a bacterium can acquire a plasmid with genes for antibiotic resistance from another bacterium is horizontal gene transfer.
What is antibiotic resistance?Antibiotic resistance is a form of acquired resistance to antibiotics displayed by bacteria cells.
Antibiotic resistance is commonly acquired by the transfer of resistance plasmids from one bacteria to another by the process of horizontal gene transfer.
Learn more about antibiotic resistance at: https://brainly.com/question/2114546
#SPJ6
When a hair cell stereocilia bend away from the kinocilium,
A) it releases neurotransmitters.
B) it does not release neurotransmitters.
C) it generates an action potential to communicate with the auditory nerve.
D) voltage-gated calcium channels open when the membrane potential of the hair cell increases.
When a hair cell stereocilia bend away from the kinocilium, then it releases neurotransmitters. Thus, the correct option is A.
What is a neurotransmitter?A neurotransmitter is a signaling molecule which is secreted by a neuron or nerve cell in the body to affect another cell across a synapse. The cell which is receiving the signal, any main body part or the target cell, may be another neuron, but it could also be a gland or any type of muscle cell.
The seven small molecules which act as neurotransmitters are acetylcholine, dopamine, gamma-aminobutyric acid (GABA), glutamate, histamine, norepinephrine, and the serotonin, do the majority of the work.
Therefore, the correct option is A.
Learn more about Neurotransmitter here:
https://brainly.com/question/9725469
#SPJ1
f a plant has a mutation, and does not produce any photosynthetic pigments, what do you predict will happen to that plant
Answer: Can not get carbohydrates and will die from the lack of energy!
Explanation: The plant will be unable to produce carbohydrates and will die quickly from the lack of energy and because green light is not absorbed by the photosynthetic pigments.
For a trait that is X-linked, recessive, and controlled by complete dominance, an individual with the genotype XnXn (little n, little n) would be represented in a pedigree as a (an)
For a trait that is X-linked, recessive, and controlled by complete dominance, an individual with the genotype XnXn (little n, little n) would be represented in a pedigree as an open square.
What is an X-linked trait?An X-linked trait is any phenotypic feature controlled by one or more genes located on the X chromosomes (it is a sex chromosome).
Moreover, a character that exhibits complete dominance is associated with an allele that completely masks the expression of the recessive allele in heterozygous organisms.
In conclusion, for a trait that is X-linked, recessive, and controlled by complete dominance, an individual with the genotype XnXn (little n, little n) would be represented in a pedigree as an open square.
Learn more about X-linked traits here:
https://brainly.com/question/8799684
#SPJ1
I don't get this. This is apart of my assignment and I don't get it.
Answer:
Producer means an organism that can produce it's own food. Plants are prime examples of producers
Primary Consumer means organisms that primarily eat plants and have low energy levels. Squirrels fit into that category. They're almost always herbivores.
Secondary Consumers eat both plants and animals in the Primary Consumer. Crows are technically secondary consumers but I've never seen one eat a squirrel before.
Tertiary Consumers are predators that have the highest energy levels and are at the top of the food chain. Coyotes eat both squirrels and crows.
Suggest how conditions at a hydrothermal vent make it impossible for plants to grow?
Answer: the conditions at a hydrothermal vent makes it impossible to plants to to grow the need the sun.
Explanation:
What is a biome and why is it important to protect all kinds of biomes?
Answer:
a biome is a community with distinct climates for organisms both plant and animals.
Explanation:
When a biome is destroyed, food sources for many organisms are lost, as well as their habitat. many species will become endangered or extinct. as ome species become extinct it causes a chain reactiom affect many other species to become endangered and the nature will fail to balance. losing a biome causes loss of many plantatioms which many lead to more CO2 in the atmosphere and hence global warming. global warming casue draught, famine and again, loss of many species and even spread of diseases.