I don’t have much time left so please help
How did the Louisiana legislature respond to the Brown v Board of Education ruling? Check all that apply.





A: by establishing civil rights legislation to integrate public schools


B: by adopting laws that prohibited segregation in Louisiana’s public schools



C: by legalizing Ku Klux Klan activity and decriminalizing segregation


D: by passing laws and a constitutional amendment to strengthen segregation


E: by forming a joint committee to uphold segregation across the state


F: by creating a congressional committee to oversee desegregation

Answers

Answer 1

Answer:

A: by establishing civil rights legislation to integrate public schools

B: by adopting laws that prohibited segregation in Louisiana’s public schools

F: by creating a congressional committee to oversee desegregation

Answer 2

Answer:

A: by establishing civil rights legislation to integrate public schools

B: by adopting laws that prohibited segregation in Louisiana’s public schools

F: by creating a congressional committee to oversee desegregation


Related Questions

1: How did the Magna Carta influence the colonists
2: How did the May Flower Compact influence the colonists

Answers

1>Magna Carta exercised a strong influence both on the United States Constitution and on the constitutions of the various states.

2> The Mayflower Compact was important because it was the first document to establish self-government in the New World.

1). The 13th-century pact inspired the U.S. Founding Fathers as they wrote the documents that would shape the nation. ... For 18th-century political thinkers like Benjamin Franklin and Thomas Jefferson, Magna Carta was a potent symbol of liberty and the natural rights of man against an oppressive or unjust government.

2). The Mayflower Compact was important because it was the first document to establish self-government in the New World. It remained active until 1691 when Plymouth Colony became part of Massachusetts Bay Colony.

On September 15, 1935, the Nuremberg Laws were passed. These laws severely limited that Jews could do in Germany. Using "The Nuremberg Race Laws", answer he following questions: 1. What are Aryans?

Answers

Answer:

A Caucasian person from non Jewish descent.

100 POINTS+BRAINLIEST: Which made the government more profits, slavery or industrialization and factories?

Answers

Industrialization and factories
industrialization and factories. hope this helps <3

How does the theme of the short story “The Lottery” relate to the central idea of the nonfiction article , “Herd Behavior?” Cite textual evidence from BOTH texts to support your answer.

Answers

“The Lottery” relates to real life because it shows us how people can easily be repressed by the communities they inhabit. Most of us derive great strength and comfort from the communities in which we live. But too many people are repressed by the communities in which they live.

#SPJ1

“The Lottery”relates to the non fictional article “Herd Behavior” as they both depict herd mentality in a community.

Why is it possible to find fossilized shark teeth near the city of Macon, which is so far away from the Atlantic Ocean? A) Native Americans used the teeth to trade, dispersing them throughout Georgia. B) Sharks can swim as far north as Macon in Georgia’s rivers. C) Macon is located on the shoreline of a prehistoric ocean. D) Early settlers in Macon wore the shark teeth as jewelry.

Answers

Answer:

C) Macon is located on the shoreline of a prehistoric ocean.

Explanation:

It is possible to find fossilized shark teeth near the city of Macon, which is so far away from the Atlantic Ocean because:

C) Macon is located on the shoreline of a prehistoric ocean

According to the given question, we can see that the city of Macron can contain old fossils of shark teeth because of how unique its location is.

As a result of this, we can see that although the city of Macon is far away from the Atlantic Ocean, it is still possible to find fossilized shark teeth near the city because it is located in the shoreline of a prehistoric ocean.

Therefore, the correct answer is option C

Read more here:

https://brainly.com/question/13583886

EASY 5TH GRADER WORK!
Describe the sediment of the Iroquois Nation towards the British.

EASY 5TH GRADER WORK!Describe the sediment of the Iroquois Nation towards the British.

Answers

Answer:

here i hope this helps

Explanation:

The Iroquois Nation wants the British to leave because they are disrupting hunting and using up recourses that belong to the Native American. They think the British don't have the right to be there.

Considering the excerpt, the sentiment of the Iroquois Nation towards the British is that:

"the British are encroachers and should no longer stay on their land."

This is evident when Canassatego the Chief of Onondaga Nation of the Iroquois Confederacy claimed that they now understood the value of their land, and as such, they no longer want the cheap things the British gave them, but rather want to keep their land.

He further claimed that the British are encroaching and spoiling their land activities, thus must leave their land since they have no rights.

Hence, in this case, it is concluded that the sentiment of the Iroquois Nation towards the British is that the British are encroachers, and should no longer stay on their land.

Learn more here: https://brainly.com/question/579837

Use the maps below to answer the following question.




Based on the maps, which state listed below was located in the Southwest Native American cultural region?


New Mexico

Florida

Ohio

North Dakota

Use the maps below to answer the following question.Based on the maps, which state listed below was located

Answers

Answer:

The answer is New Mexico.

Explanation:

The first map shows the main Native American cultural regions in the United States, including the Southwest region. The second map specifically highlights the states that were part of the Southwest region, which includes Arizona, New Mexico, part of Utah, and part of Colorado.

The options are:

New Mexico - Correct. The map shows New Mexico as part of the Southwest region.

Florida - Incorrect. Florida is not shown as part of the Southwest region.

Ohio - Incorrect. Ohio is not shown as part of the Southwest region.

North Dakota - Incorrect. North Dakota is not shown as part of the Southwest region.

Therefore, based on the maps provided, New Mexico was located in the Southwest Native American cultural region.

the answer is new mexico

What event causes European nations to gain respect for the United States?

Answers

The War of l812 caused European nations to gain respect for the United States.

The event that caused the European national to gain respect for the US is the war in 1812
Hope this helps

What does Malala say is our shared hope despite having different ways to worship?

Answers

Answer: there is hope

Explanation:

When women are educated, there are more jobs for everyone. When mothers can keep their children alive and send them to school, there is hope.

Hi, the answer above may be right! But this is my answer I uncovered! (Pretty much the Same)
“I know that we have different ways to worship, but we share the same hope for peace, the same love for our sisters and brothers.” - Malala Yousafzai

where is the grand canal

Answers

Answer:

The Grand Canal is a vast waterway system in the north-eastern and central-eastern plains of China, running from Beijing in the north to Zhejiang province in the south.

The Grand Canal, known to the Chinese as the Jing–Hang Grand Canal, a UNESCO World Heritage Site, is the longest canal or artificial river in the world.

PLZZ HELP WITH GEOGRAPHY

PLZZ HELP WITH GEOGRAPHY

Answers

Answer:

the leeward side of an island

Explanation:

Wordsearch! Pls, help me!!

Wordsearch! Pls, help me!!
Wordsearch! Pls, help me!!

Answers

Right above the word Sultan, Sunni is spelt backwards

Which statement correctly describes a difference between the Roman and Gregorian calendars?

The early Roman calendar begins after the Gregorian calendar begins.
The early Roman calendar has more months in each year than the Gregorian calendar.
The early Roman calendar is based on the moon, while the Gregorian calendar is based on the sun.
The early Roman calendar starts with the birth of Jesus, while the Gregorian calendar is tied to the city of Medina.

Answers

Answer:

The early Roman calendar is based on the moon, while the Gregorian calendar is based on the sun

The early Roman calendar is based on the moon, while the Gregorian calendar is based on the Sun.
-Hope this helps!

Figure out the combination. Will choose brainliest.

Figure out the combination. Will choose brainliest.

Answers

Answer:

up,right,left,up,down i think sorry if im wrong

Explanation:

because the cats are looking that way

Governments are instituted among Men, deriving their just powers from the consent of the governed, —That whenever any Form of Government becomes destructive of these ends, it is the Right of the People to alter or to abolish it, and to institute new Government, laying its foundation on such principles and organizing its powers in such form . . .

Which Enlightenment idea is reflected in the excerpt?

A.
the theory of the divine right of kings
B.
the theory of hierarchical organization
C.
the theory of social contract of government
D.
the theory of natural rights of humans

Answers

C. The theory of social contract of government
C would be the answer.

Snake Story
Becky moved off of the porch slowly, backing through the door and into the house. She slammed the sliding glass door shut and stood for a moment, relieved to have something solid between her and the snake on the porch.
The glass was cool under her hands despite her pounding heart. She tried to slow her breathing. She was safe, at last, inside. Or was she? How had that snake gotten into the screened-in and walled-up back porch. If it could get in there, it's possible it could get inside where she was as well.
Becky wasn't someone who was normally skittish about wild things. She'd handled snakes before, picked up lizards many times, caught frogs in the garage and let them go. But snakes seemed to always catch her off guard. They would turn up when least expected. She would see them out of the corner of her eye and just the surprise of it would make her jump; her adrenalin would pump, her heart would thump, and her panic would take over.
What was she going to do? She couldn't just stand there waiting for the snake to decide to leave. What if it were venomous? It didn't look like a viper, but it could be. She would need to get out there soon to water the plants.
"What this requires is some advanced planning," she said out loud to her cat, Louie. "And, I will probably have to go 'once more into the fray' kitty," she said, looking in the cat's direction for emphasis.
"First things first, though," she said. The cat meowed back. It often did that, having become used to being talked to. "Let's look that fellow up," Becky said walking to her bookshelf.
"Let's see, snakes," she said, thumbing through her reptile and amphibian identification book. "It's brown and gray, with some black. With a pattern that looks ... there it is," she said thumping the page so hard that Louie jumped. "Not venomous," she said, triumphantly.
"It's an oak snake, Louie," she returned the book and strode over to her closet. "Not venomous, but I am still not taking chances," she said.
She reached into the closet and pulled out her heaviest jacket. It was lined and stuffed thick with lots of padding. Then she found her mittens and a pair of rubber boots. She knew even non-venomous snakes would sometimes threaten to strike when scared. "And that threat would work on me," Becky said aloud again, though Louie had no idea what she was talking about.
"It's 90 degrees outside, Louie," she said, "so get the iced lemonade ready for when I return."
It wasn't much of a plan, but it was the best she could come up with. With her armor on, she was already sweating when she slowly pushed open the sliding glass door and stepped back on to the porch.
She was pretty sure the snake would slither away from her presence. She propped open the outside door, and hoped she could shoo the snake in that direction.
Sweat dampened her arms and collected on her face. She spread her arms out, and took a few steps toward the snake. There was so much for it to hide beneath. Becky regretted the rocking chairs and all the plant stands between where the snake was in the corner and the door to the outside.
At first it seemed like the snake was just going to remain where it was, flicking its tongue every now and then. Becky waved her arms, lunged in its direction, and stomped her feet. It sat there, coiled in the corner, as if perfectly happy to remain there. In a fit of desperation, she picked up one side of the rocking chair the snake was under and let it drop. The snake jumped, raised its head like it was going to strike, and then stayed right where it was.
"Snake," Becky said, "This is not how it works. You have got to go." The snake moved its head back and forth, swaying a bit, and that gave Becky an idea.
She had read somewhere that snakes can "hear" thanks to the ability to process vibrations through the bone in their jaw. This awareness of vibrations in the ground was one reason it was very hard to sneak up on snakes. She quickly realized that getting the snake out was going to be a lot easier than she had thought.
Becky turned on the radio she kept on the porch and lowered it to the ground, pointing in the snake's direction. She adjusted the controls so that the bass was as high as it could go. Then she cranked up the volume. She envisioned the snake swaying to the sounds of "Dancing Queen by Abba, and then leaving the porch and going far far away.
Coming back into the house she began peeling off the now damp armaments she had put on earlier. "Louie, there is more than one way to skin a snake," she said laughing. She watched as the snake uncoiled and moved cautiously in the direction of the door. Bending down to pick up Louie Becky sighed and stroked his head. "'Cause no one ever wants to skin a cat sweetie
The glass was cool under her hands despite her pounding heart. She tried to slow her breathing. She was safe at last inside.
What is the main purpose of this sentence in the story?
a
Create tension
b
Describe the setting
c
Resolve conflict
d
Lessen tension

Answers

Answer:

a

Explanation:

The main purpose of this sentence in the story is to lessen tension.

HELP IM GIVING 100 POINTS

HELP IM GIVING 100 POINTS

Answers

Answer: I want to say A but im not entirely sure! So pls wait for some else to confirm or deny this

Explanation:

A- Rainforests


The rubber comes from specific trees in the rainforest.

This is an excerpt from the charter that established the colony of Jamestown.



How did the first settlers’ response to this directive impact the colony?


The first settlers followed it, and they established the House of Burgesses to make laws.
The first settlers followed it, and they established the House of Burgesses to make laws.

The first settlers followed it, and they established one plantation to grow tobacco for the entire colony.
The first settlers followed it, and they established one plantation to grow tobacco for the entire colony.

The first settlers ignored it, and they adopted the social structure of the Powhatan tribe.
The first settlers ignored it, and they adopted the social structure of the Powhatan tribe.

The first settlers ignored it, and many of them died during what is known as the “starving time.”

Answers

Answer:

A. The first settlers followed it, and they established the House of Burgesses to make laws.

Explanation:

I'm not sure if this is right, but I'm taking the test right now and it seems like the most reasonable answer because:

1. We know for sure that they didn't ignore it, so we can eliminate the last two.

2. If you look back at notes you took, you will find that they did make a House of Burgesses to make laws, I'm not sure about the second one, but at this very moment the first one seems more reasonable.

Therefore, we can make an educated guess that the answer is A.

I know this is late but I hope this helps to those who see this, also sorry if this is wrong, this is an educated guess based on my notes and what I know.

Answer:

A. The first settlers followed it, and they established the House of Burgesses to make laws.

Explanation:

Trust me I took the quiz

Which of these are a natural hazard? Select all that apply.

Question 2 options:

A. cyclones


B. earthquakes


C. volcanic eruptions


D. meteor showers

Answers

Cyclones, volcanic eruptions, and earthquakes.
Earthquakes and Volcanic Eruptions

ASAP PLSSSSSSSSSSSSSSSSSS!!!!!!!!!!!! 70!! POINTS!!!!!!!!
+ BRANLIST!!!!!!!!!!!!!!!!!!! PLEASE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

ASAP PLSSSSSSSSSSSSSSSSSS!!!!!!!!!!!! 70!! POINTS!!!!!!!!+ BRANLIST!!!!!!!!!!!!!!!!!!! PLEASE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

TELEVISION

1.) It transformed the way people received news and entertainment: Television became the primary source of news and entertainment for most Americans. People could watch live events, such as the coronation of Queen Elizabeth II or the Army-McCarthy hearings, from the comfort of their homes. Television also brought popular shows like "I Love Lucy" and "The Ed Sullivan Show" into living rooms across the country, providing a shared cultural experience for millions of viewers.

2.) It contributed to the growth of consumer culture: As more households acquired televisions, advertisers began to recognize the power of television as a medium for selling products. Companies invested heavily in television advertising, creating a new consumer culture that emphasized the importance of buying the latest products and keeping up with the latest trends. This contributed to the growth of the postwar economy and helped shape American culture in the decades to come.

 

Explanation:

AUTOMOBILE

1.) Increased mobility and suburbanization: The widespread use of automobiles made it easier for people to travel and commute to work, which led to an increase in suburbanization. People could now live farther from their workplaces and commute by car, which led to the growth of suburbs and a decline in urban centers.

2.)The rise of car culture: The automobile became a symbol of freedom and individualism in American culture, leading to the rise of car culture. People began to identify with their cars and express their personalities through their choice of vehicle. This led to the development of car-related activities such as drag racing, cruising, and car shows.

3.) Economic growth and job creation: The automobile industry became a major source of economic growth and job creation in the 1950s. The industry employed millions of people and helped to stimulate the economy by creating demand for steel, rubber, and other raw materials.

1. one way television changed american life was they they where able to receive and watch news faster than ever. for example this way very helpful during the vietnam war because citizens could receive news of war in real time rather than having to wait for a news paper. Another way it changed american life is because people now had easier at home access to entertainment. Americans would no longer have to go out to watch a movie or see a program they could watch it from their living room.

2. One way the automobile changed america was that it gave people easier acces to jobs, people woud never longer have to rely on public transport. It also changed daily lives because people could go out whenever they wouldnt have to wait to catch the bus or walk. The third way automobiles changed american lives is that they made suburbia possible. Without the invention of automobiles we would not have been able to live or survive in the suburbs because nothing is in walking distance and public transport is not readily available. This is why automobiles were and still are so popular in suburbia.

Based on your reading of these sections of the constitution does any part of the government have the legal authority to purchase new lands? Explain.

Based on your reading of these sections of the constitution does any part of the government have the

Answers

The constitution confers absolutely on the government of the Union, the powers of making war, and of making treaties (Treaties means "A formally concluded and ratified agreement between two countries.) Consequently, that government possesses the power or will of acquiring territory, either by conquest or treaty Marshall said.  Hope this helps! if not please let me know

What event solidified Adolf Hitler’s hold on power in Germany?

1920: Hitler elected leader of the Nazi Party
1925: Hitler’s Mein Kampf is published
1928: Nazi Party dominates national elections
1933: Hitler appointed chancellor

Answers

Answer:

1928 I think so let me know if it's wrong

Answer:

I think it is 1920 but I just want to say a failed the first attempt when taking this test so if you are really set on getting a good grade do more research about it. But i think this answer was correct. Sorry for the confusion. >_<

Explanation:

Ya that...^^

which statement best completes the diagram?

which statement best completes the diagram?

Answers

Answer:

I'mma go with C. grease city states are not able to trade with others

Need help with history [Don't troll please]

Need help with history [Don't troll please]
Need help with history [Don't troll please]

Answers

2. Augustus was the first roman emperor.
3. Pax Romana was the golden age of the romans (lasts about 200 years)
4 Augustus was a smart emperor, he formulated law and order for Rome...
5 Rome was a very advanced civilization, they built massive buildings and statues, they knew concrete, (i think they had a toilet for the emperor but im not sure).
:) hope this helps

Which of these was an argument for the New Jersey Plan?

a) It allowed enslaved persons to have representation in Congress.

b) It provided too much power to the states in wartime.

c) It gave the advantage to states that had higher numbers of people.

d) It would provide equal representation for each state.

PLEASE HELP ME OUT!! <333

Answers

The answer is D good luckkkkk
It’s is d your welcome

What effect did the XYZ Affair have on early American foreign policy?

Answers

The XYZ Affair was a diplomatic incident between French and United States diplomats that resulted in a limited, undeclared war known as the Quasi-War. U.S. and French negotiators restored peace with the Convention of 1800, also known as the Treaty of Mortefontaine.
It messed it up pretty bad bro

HELP ME PLEASE ITS DUE TODAY AT 9:00 EASTERN

HELP ME PLEASE ITS DUE TODAY AT 9:00 EASTERN

Answers

The Ethiopian Kingdom existed from around 1270 CE to 1974 CE, the Bantu Migration began around 1000 BCE and Great Zimbabwe was built between the 11th and 15th centuries CE.

What are some interesting facts of the Ethiopian Kingdom and the Bantu Migration ?

The Ethiopian Kingdom had a significant impact on African history, as it was one of the few African states to successfully resist European colonization and maintain its independence.

Interesting fact: The Ethiopian Kingdom is known for its unique cultural and religious traditions, including the Ethiopian Orthodox Church, which has its own distinct form of Christianity.

The Bantu Migration had a profound impact on African history, as it led to the spread of Bantu languages, cultures, and traditions across a vast area of the continent.

Interesting fact: The Bantu Migration is one of the largest human migrations in history, involving the movement of millions of people over a period of several millennia.

Great Zimbabwe was one of the largest and most powerful cities in medieval Africa, with a sophisticated system of agriculture, trade, and governance.

Interesting fact: Great Zimbabwe is renowned for its impressive stone architecture, including massive stone walls, towers, and enclosures, which were built without the use of mortar.

Find out more on Great Zimbabwe at https://brainly.com/question/17925359

#SPJ1

A line graph titled Daily Market for Perfect Pepperoni Pizza shows quantity on the x-axis from 0 to 30 and price in dollars on the y-axis from 0 to 20. A line labeled S starts at (0,3.5) and increases to points (5,5), (10,7.5), (15,10), (20,12.5), (25,15). Two lines labeled D and D subscript 1 start at (0,16.5) and decrease to points (5,15), (10,12.5), (15,10), (20,7.5), (25,5). All 3 lines intersect at point E at (15,10). A vertical dashed line labeled Q extends from point E to bottom of graph and a horizontal dashed line labeled P extends from point E to left edge of graph. A vertical dashed line labeled Q subscript 1 intersects with a horizontal dashed line labeled P subscript 1 at point (20,12.5).

In the example above, the increase in demand led to an increase in __________.
A.
price
B.
production cost
C.
quality
D.
cost efficiency



Please select the best answer from the choices provided


A
B
C
D

Answers

Answer:

if it shifts to the left the demand decreases & decreased prices follow

Explanation:

do you have insta???

Answer is D thank me later

Justifiable for the United State to drop the atomic bombs on Japan?

Answers

Answer:

While some argue that the use of atomic bombs was necessary to end the war quickly and save lives, others believe that it was a disproportionate and unnecessary act of violence that caused immense human suffering. The debate over the justification of the bombings continues to this day.

Explanation:

Answer:

The United States dropping the atomic bombs on Japan was not justifiable, since history has proven many times over that solving long term issues through violence will only most likely result in one of two solutions. The anger against each side lasts for at least as long as the issue was around. Or the other, it will be 'solved' for a short time, and even then will it only come back to more disagreements among the people, causing more violence, or better, just verbal debates and disagreements, although that rarely happens in large issues among nations.

When the US dropped the bombs, they were expecting a quick surrender of Japan, although it would have been better with less violence, talking it out, or even a smaller-range bomb, that wouldn't kill so much of the population and destroy so much land. The United States dropped the bomb for a personal benefit of a lower amount of American lives lost, contradicting the idea amongst most people to preserve all human life, and prevent death from occurring as much as possible. The action was personally considered an 'allegation', not legally, among many people; many others believe that it was necessary and justifiable. It would be difficult to gainsay others opinions on this matter, although you can certainly attempt to proselytize.

Partial Rebuttal for a more beneficial answer:

After dropping the first bomb, Japan had still not surrendered, enticing the United States to repeat the action. To have two bombs dropped on your own country after being warned would most likely make you want to surrender or obey the warring nation. In the end, it turned out to be a gain for the United States, and a great loss for Japan, basically the overall idea of the people of the United States.

How did religious beliefs influence the story of Rome’s founding?
Rome was founded as a religious center.
Rome was considered the home of the god Jupiter.
Romans built the Colosseum to honor their gods.
Romans believed that the demigod Aeneas founded Rome.

Answers

Answer:

The best answer would be A

Explanation:

Rome became the center of the Catholic Church and the capital city of the Papal States; consequently, a great number of churches, convents, and other religious buildings were erected in the city, sometimes above the ruins of older pre-Christian sites of worship.

The religious beliefs influenced the story of Rome's founding because "Rome was founded as a religious center".

The correct answer is A - "Rome was founded as a religious center".

In 380 CE, the emperor Theodosius issued the Edict of Thessalonica, which made Christianity, specifically Nicene Christianity, the official religion of the Roman Empire. Later Rome became the center of the Catholic Church and the capital city of the Papal States.

What is Roman Empire?

The Roman Empire was the largest empire of the ancient world. Its capital was Rome, and its empire was based in the Mediterranean. The Roman Empire was founded when Augustus Caesar proclaimed himself the first emperor of Rome in 31BC and came to an end with the fall of Constantinople in 1453CE.

What is Christianity?

The religion derived from Jesus Christ, based on the Bible as sacred scripture, and professed by Eastern, Roman Catholic, and Protestant bodies.

Who was Theodosius?

The legacy of Theodosius is of enormous historical significance. He was the Emperor who ensured that the Roman Empire was truly Christian. He initiated a series of measures that resulted in paganism in many areas of the Empire.

What was the Edict of Thessalonica?

The Edict of Thessalonica, also known as Cunctos populos, was issued on 27 February 380 AD. It ordered all subjects of the Roman Empire to profess the faith of the bishops of Rome and Alexandria, making Nicene Christianity the state religion of the Roman Empire.

What is Nicene Christianity?

A Christian statement of faith that is the only ecumenical creed because it is accepted as authoritative by the Roman Catholic, Eastern Orthodox, Anglican, and major Protestant churches.

Supporting answer

Hence, option A is correct.

To learn more about Roman Empire, Theodosius, Edict of Thessalonica and Nicene Christianity here-

https://brainly.com/question/4001702

#SPJ2

Other Questions
the nurse cares for a client with an abnormal cortisol level. the nurse recalls which information about cortisol? cortisol metabolizes free fatty acids. what is 3 divided by 678 Please can someone that's really good with spanish help me. Look at picture and fill in the missing letters. the creation of a communications hotline between the united states and th ussr was a result of induction of sterile pericarditis in aachener minipigs as a model for atrial myopathy and atrial fibrillation Find the solution to the system of equations graphically. (Round your answers to one decimal place. If there is no SOLUTION.)5x + 4y = 4 6x-2y = 11 (x, y) = surface area of composite figures Charhofe ended 2019 with a balance in their interest payable account of $14 million. During 2019 it paid $9 million in interest to its creditors. What was the balance of the interest payable account at the end of 2018? Expresa en lenguaje algebraico la expresin: Dimensiones de un rectngulo en el que su largo tiene 6 metros ms que el ancho. Please help due tomorrow thx! experts estimate that for the us to reach 100% renewable energy in 2050, it will require $7.8 trillion. calculate the percent change this would represent from the 2018 investment level of $46.5 billion. Shannon test-drives a car in Germany and drives 95 kilometer per hour. What is her speed in miles per hour? (1 kilometer < 0.62 mile) step by step what does anna marias reaction in line 60 of the play suggest about how she feels concerning leopolds insistence? Identify the key features of a behaviorist, cognitive, or humanist approach to consultancy related to sports psychology. PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA*Remember to begin with the Start Codon "AUG" Write each ratio as a fraction in lowest terms. 8 to 9 1 You can also write an equation to solve the exampleproblem. Write the numbers to complete the equationshowing what part of the towel has the fish design.of meansXans >IFX4:3:8(I only need help with number one) If the BLS counted persons that are on active military service in the totals for employment, the labor force, or the working-age population, this would Or short answerWhich two crops were Indian farmers forced to grow duringIndia Company rute? Cotton or indigo 7.4DThe number of cupcakes in a case decreased from 140 to 120. What is the percentdecrease of the number of cupcakes in the case? Round to the nearest whole number.A. 12%B. 14%C. 13%D. 10%