PLZ HELP Translate this segment of RNA into the corresponding amino acids.
mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA
*Remember to begin with the Start Codon "AUG"

Answers

Answer 1

Answer:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

Explanation:

Translation is the second process of gene expression in which a mRNA sequence is used as template to synthesize an amino acid sequence. This process, which occurs in the ribosome, reads the nucleotides of the mRNA sequence in three's called CODON. Each codon represents an amino acid, which is then added to the growing peptide chain.

According to this question, the following mRNA sequence is given: AAA AUU CGG CAU GCC GUU AAU GCC CUC GGG GUG A. Using the genetic code, the following amino acid sequence is produced:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val


Related Questions

What is the surface of the Earth called?
Crust
Mantel
Inner core
Outer core

Answers

Answer:

crust

Explanation:

To create a knockout mouse, after introducing to ES cells a DNA construct in which a specific gene is mutagenized by the insertion of a drug resistance marker, the cells Multiple Choice that have incorporated the transgene by homologous recombination grow in the presence of the drug and these are injected into a host blastocyst. that lack the transgene grow in the presence of the drug and these are injected into a host blastocyst. that have deleted the transgene grow in the presence of the drug and the nuclei are injected into a host blastocyst. that lack the transgene grow in the presence of the drug and the nuclei are used for nuclear transfer.

Answers

I’m not sure but if u get the answer I’ll like it

To create a knockout mouse, after introducing to ES cells a DNA construct in which a specific gene is mutagenized by the insertion of a drug resistance marker, the cells, that have incorporated the transgene by homologous recombination grow in the presence of the drug and these are injected into a host blastocyst. The correct option is A.

What is biological marker?

A biomarker is an objective measure of what is going on in a cell or organism at any given time. Biomarkers can serve as health-related early warning systems.

To create knockout mice, researchers insert artificial DNA into the chromosomes contained in the nuclei of ES cells using one of two methods.

Both methods are performed in vitro, that is, on cultured cells grown in a laboratory setting.

After introducing a DNA construct into ES cells that mutagenizes a specific gene by inserting a drug resistance marker, the cells that have incorporated the transgene via homologous recombination grow in the presence of the drug and are injected into a host blastocyst.

Thus, the correct option is A.

For more details regarding biological marker, visit:

https://brainly.com/question/28502967

#SPJ6

4. The diagram below represents a laboratory setup used by a student during an investigation of diffusion.Distilled water is 100% water.Tube AGlass tubeTube BTubing10 mL ofdistilled water10 mL of watercontaining 5% starchDialysis membraneWhich statement best explains why the liquid in tube A will rise over a period of time?(1) The starch concentrations are equal on both sides of the membrane.(2) The water will pass from a region of lower starch concentration to one of higher starchconcentration.(3) Water and starch volumes are the same in both tubes A and B.(4) The fluids in both tubes A and B will change from a higher temperature to a lower temperature.In the diagram in #4, the starch will not move. Write a complete sentence explaining why.

4. The diagram below represents a laboratory setup used by a student during an investigation of diffusion.Distilled

Answers

A permeable membrane like the one used in the experiment allows only some types of molecules to pass through, the starch does not pass through the selectively permeable membrane bacause its molecules are to large and the form of the complex compound is too large to go through the pores. Complex molecules as carbohydrates can not pass a selectively membrane without using energy or/and other molecules carriers, the membrane in the experiment is for a dialysis process that only permit the osmmosis of ions and molecules with low mass as the water in the tube A and B.

Design a controlled experiment to test the effect of water temperature on goldfish. be sure to include your hypothesis, independent variable, dependent variable as well as experimental group and control group.

Answers

Answer:

In this experiment, indepedent variable will be temperature and dependent variable will be the respiratory rate of goldfish. Temperature affects the respiratory rate of goldfish, as it's respiratory rate decreases with decrease in temperature of water, the experiment is as follows:

Take two glass containers filled with water A and B and put one goldfish in each container.Measure the temperature of the water using a thermometer.Count mouth movement of both the fishes in certain time.Now put some ice in container B that will decrease the temperature of water and measure the temperature again.Now count the mouth movement of both the fishes for the same time it was counted earlier.

The result will be that respiratory rate of goldfish decreases with the decrease in temperature in container B in comparison to container A goldfish.

An experiment meant to determine the cause of an effect, the effect is the independent variable, while the cause is the dependent variable

A controlled experiment to test the effect of water temperature on goldfish is designed as follows:

The experimental group are: The gold fish in a glass Jar X filled with fresh water and with the lid left open (the treatment of temperature reduction is applied to the experimental group)

The control group are: A second gold fish (selected at random) of the same size, in another glass jar Y filled to the same level with fresh water collected from the same source of the first gold fish

Independent variable: The independent variable is the temperature of the water which will be varied by placing ice cube gradually into the glass jar B

Dependent variable: The number times the gold fish gulp air by rising to the surface, and or the number of time goldfish opens its mouth, which indicates that the goldfish is breathing

The hypothesis: The breath rate of goldfish decreases with decrease in temperature because the goldfish metabolic rate decreases and the water holds more dissolved air and therefore oxygen at a reduced temperature

The Experiment Design:

The experiment is conducted by measuring the initial temperature and breathing rate of both fishes

The temperature of the fresh water in jar X is decreased gradually by adding ice cubes and recording the temperature and breathing rate of the goldfish

A similar experiment from an online source (Maryland School improvement website) the following results where obtained

\(\begin{array}{|c|cc|} \underline {Breathing \ rate}&&\underline {Water \ Temperature } \\&&\\ (Dependent \ Variable)&&(Independent \ Variable)\ \\&&\\103&&78.8 ^{\circ}F\\78&&68^{\circ}F\\55&&57.2^{\circ}F\\28&&46.4^{\circ}F\\4&&35.6^{\circ}F\end{array}\right]\)

From the experiment, it can be seen that the in the experimental group dependent variable, which is the breathing rate of the goldfish reduces as the temperature which is the dependent variable is reduced

Learn more about experimental variables here:

https://brainly.com/question/18177357

Design a controlled experiment to test the effect of water temperature on goldfish. be sure to include

Genes that code for a specific protein can be inserted into bacterial plasmids, and then the plasmids are used to transform cells. Many useful
human proteins are now synthesized by these transgenic bacteria. Uses for the synthesized proteins include human insulin used to treat
diabetes and human growth hormone used to treat dwarfism.
Which tenet of cell theory BEST serves as a basis for this type of biotechnology?

Answers

Answer:

The tenet of cell theory that BEST serves as a basis for this type of biotechnology is that all living things are composed of cells.

Cell theory states that all living things are composed of one or more cells and that the cell is the basic unit of life. In biotechnology, genes that code for a specific protein can be inserted into bacterial plasmids, which are small circular pieces of DNA found in bacteria, and then the plasmids are used to transform cells. The transformed cells can then produce the desired protein. This process is based on the understanding that all living things are composed of cells and that the genetic information necessary to produce specific proteins is contained within the cell's DNA. Without this understanding of the basic unit of life being the cell, it would not be possible to create transgenic bacteria to synthesize human proteins for medical use.

If f(x) = 3x - 1 and g(x) = x + 2, find (f- g)(x).
Rrgggggg

Answers

Answer:

(f - g)(x) = 2x - 3

General Formulas and Concepts:

Pre-Algebra

Distributive Property

Algebra I

Combining Like Terms

Explanation:

Step 1: Define

f(x) = 3x - 1

g(x) = x + 2

(f - g)(x) is f(x) - g(x)

Step 2: Evaluate

Substitute:                    (f - g)(x) = 3x - 1 - (x + 2)Distribute -1:                 (f - g)(x) = 3x - 1 - x - 2Combine like terms:    (f - g)(x) = 2x - 3

Which reptiles live in and around swamps or bodies of
freshwater or salt water?.

Answers

Answer:

Crocodile, alligator, snakes.

Calculate the population density of 900 sheep in a plot of land that is 3.00 km by 2.00km

Answers

The population density of the 900 sheep in the given plot of land is 150 sheep per square kilometer.

The population density of 900 sheep in a plot of land that is 3.00 km by 2.00 km can be calculated by dividing the total number of sheep by the area of the land.

First, we need to calculate the area of the land. The area can be found by multiplying the length and width of the plot of land:

Area = length × width = 3.00 km × 2.00 km = 6.00 km²

Next, we divide the total number of sheep by the area to calculate the population density:

Population Density = Total number of sheep / Area = 900 sheep / 6.00 km²

Performing the calculation, we find:

Population Density = 150 sheep/km²

Therefore, the population density of the 900 sheep in the given plot of land is 150 sheep per square kilometer.

Population density is a measure of the number of individuals (in this case, sheep) per unit area. By dividing the total number of sheep by the area of the land, we obtain the population density in terms of sheep per square kilometer. In this case, the population density is 150 sheep/km², indicating that there are, on average, 150 sheep within each square kilometer of the land.

For more such answers on Population

https://brainly.com/question/29885712

#SPJ8

the change in weather is what causes the change in seasons?

Answers

Answer:

no Seasons are dependent on the Earth's orbit around the sun

Explanation:

No seasons depends on the sun

Explain why a person with Phenylketonuria (PKU) can't eat or drink "sugar free" foods

Answers

Answer:

People who have “sugary food/drinks” with Phenylalanine can cause intellectual disabilities, brain damage, seizures, etc.

Explanation:

A man is 1.7 m long. An amoeba is 17 um long. How does the length of the
man compare to the length of the amoeba?
A. The man is ten (10) times larger than the amoeba.
B. The man is one hundred thousand (1 x 105) times smaller than the
amoeba.
C. The man is ten (10) times smaller than the amoeba.
D. The man is one hundred thousand (1 x 105) times larger than the
amoeba.

Answers

Answer:

D. The man is one hundred thousand times larger than the amoeba.

Explanation:

one meter is equal to 1,000,000 micrometers.

(1.7m * 1,000,000)/17 = 100,000

What is global warming

Answers

Global warming is the unusually rapid increase in Earth's average surface temperature over the past century primarily due to the greenhouse gases released by people burning fossil fuels.

hope this helps ^^

A gradual increase in the overall temperature of the earth's atmosphere generally attributed to the greenhouse effect caused by increased levels of carbon dioxide, chlorofluorocarbons, and other pollutants.

____ % of the Earth is water

Answers

Answer:

71% of Earth is water.

Explanation:

Which of these arrangements explains the correct order of processing fibres into wool?

Rolling, Shearing, Dyeing, Scouring, Sorting, Cleaning of burrs
Scouring, Shearing, Cleaning of burrs, Rolling, Dyeing. Sorting
Shearing, Scouring ,Sorting, Cleaning of burrs, Dyeing, Rolling
Cleaning of burrs, Rolling, Dyeing, Shearing, Scouring, Sorting

Answers

Answer:

Shearing, Scouring ,Sorting, Cleaning of burrs, Dyeing, Rolling

Over a span of 20 years, scientists kept track of the
number of propeller boats that people purchased for use in
Florida's waterways. The first graph shows the change in
the number of propeller boats over those 20 years. The
second graph shows how a manatee population in the
same area changed over the same period.
Number of propeller boats
Number of Propeller
Boots over 20 Years
Time
Manatee population
Which hypothesis is supported by the data?
Manatee Population
over 20 Years
Time
A. Manatees, an abiotic factor, experienced a decline in their
population due to propeller boats, a biotic factor.
B. Manatees, a biotic factor, experienced a decline in their population
due to propeller boats, an abiotic factor.
C. Manatees, a biotic factor, experienced an increase in their
population due to propeller boats, an abiotic factor.
D. Manatees, an abiotic factor, experienced an increase in their
population due to propeller boats, a biotic factor.

Answers

The correct hypothesis supported by the data is hypothesis B: Manatees, a biotic factor, experienced a decline in their population due to propeller boats, an abiotic factor.

Based on the given information, neither hypothesis A nor hypothesis D is supported by the data. Hypothesis A suggests that manatees, an abiotic factor (which is incorrect, as manatees are living organisms), experienced a decline in their population due to propeller boats, a biotic factor.

Hypothesis D suggests the opposite, that manatees (an abiotic factor) experienced an increase in their population due to propeller boats (a biotic factor).

Hypothesis B, on the other hand, is supported by the data. It states that manatees, a biotic factor, experienced a decline in their population due to propeller boats, an abiotic factor.

This hypothesis aligns with the information provided, as the graph for manatee population shows a decrease over the same 20-year period in which the number of propeller boats increased.

Therefore, the correct hypothesis supported by the data is hypothesis B: Manatees, a biotic factor, experienced a decline in their population due to propeller boats, an abiotic factor.

for similar questions on hypothesis

https://brainly.com/question/606806

#SPJ11


A glacier, a slow-moving mass of ice, has gradually weathered and eroded rock away in a mountain valley. The landscape of rock has greatly changed. Which
sphere was affected in the transformation?

A glacier, a slow-moving mass of ice, has gradually weathered and eroded rock away in a mountain valley.

Answers

The transition had an effect on the geosphere.

What is the name of the ice mass moving slowly?

A glacier is a slow-moving mass of ice or an ice river. Based on where they occur, glaciers are divided into two categories: valley glaciers and continental glaciers. A glacier is a slow-moving mass of ice or "a river of ice." Based on where they occur, glaciers are roughly divided into two categories: valley glaciers and continental glaciers.

What are the names of moving glaciers?

The movement of glaciers, which resemble rivers of ice, is known as glacial motion. It has been crucial in the shaping of numerous landscapes. The majority of lakes on earth are located in glacier-carved basins.

To know more about geosphere visit:-

https://brainly.com/question/5137630

#SPJ1

What are the steps of stellar evolution of a high mass star.

Answers

Answer:

The exact stages of evolutions are: Subgiant Branch (SGB) - hydrogen shell burning - outer layers swell. Red Giant Branch - helium ash core compresses - increased hydrogen shell burning. First Dredge Up - expanding atmosphere cools star - stirs carbon, nitrogen and oxygen upward - star heats up.

Please answer the following questions based on the titration curve:
1. From the plot, determine the number and types of titratable groups for the unknown amino acid.
2. Determine best you can the experimental pKa values for each titratable group from the plot
3. Determine best you can the molecular weight of your unknown amino acid from data obtained from
your plot.
4. Calculate the isoelectric point of your sample. a) What is the definition of isoelectric point? b)
Where would you find the isoelectric point on a titration curve?
5. What is the identity of your unknown amino acid? Justify your conclusion by comparing the
observed molecular weight and pKa values to those for all of the amino acid

Please answer the following questions based on the titration curve: 1. From the plot, determine the number

Answers

Titration is a useful tool in the determination of amino acid side chains and the ionizable groups. There are two titratable groups for the unknown amino acid. These are α-COOH and α-NH₃⁺. The experimental pKa values for the groups are- pK₁ = 2.35 for α-COOH and pK₂ = 9.78 for α-NH₃⁺.

What is Isoelectric point?

Amino acids are the organic compounds that contain both amino and carboxylic acid functional groups. Isoelectric point (pI) is the pH at which the net charge on an amino acid is zero. The isoelectric point of the given amino acid can be calculated by the formula:

pI = (pK1+pK2)/2 = (2.35+9.78)/2 = 6.065

Isoelectric point will be in the middle part of the curve in the buffer region. Buffer region is the section of curve between the initial point and the equivalence point.

The unknown acid would be glycine. The curve gas two dissociation steps- loss of H⁺ from the carboxyl group at low pKa value and gain of H⁺ by the amino group at high pKa value.

Learn more about Titration here :

https://brainly.com/question/2728613

#SPJ1

All changes saved
15. What did people use for energy before fossil fuel and electrical power
energy was harnessed?
They used whale oil and steam power to run machines.
O Humans had only their own muscles and a knowledge of levers and
pulleys for power.
Humans used muscle power and direct wind and water power.
Humans burned wood to power their machines.

Answers

Before fossil fuel and electrical power energy were harnessed, Humans used muscle power and direct wind and water power.

The correct option is C.

What is muscle power?

Muscle power refers to the power generated by humans during the contraction and relaxation of their muscles.

Muscle power can be used to accomplish a variety of tasks such as lifting objects, walking, running, etc.

Before the discovery of fossil fuels, humans use muscle power as well as wind and water power to accomplish tasks such as driving of motors, sailing ships, cutting trees, etc.

Learn more about muscle power at: https://brainly.com/question/16225402

#SPJ1

Why do you think it is important to have a standardized (only 1) Scientific classification system like taxonomy?

Answers

Answer:

Having a standard taxonomic system benefits the scientific community by allowing scientists from all over the world to do which of the following?

Explanation:

The Linnaean taxonomic system classifies organisms into divisions called taxa. If two organisms belong to the same taxonomic group, they are related. ( I am not sure )

The________ theory believed personality included three components: ego, superego, and Id.

Answers

Answer: freud's psychoanalytic theory

what organelle is similar to the muscular system

Answers

The answer to this would be mitochondria

What are your thoughts on extraterrestrial life in our galaxy/universe?

Do you think there is life elsewhere? Where might we find it?

What might that life look like, or how might it be different from what we know?

Would it be primitive or developed/intelligent?

Would that other life form try to explore the galaxy/universe or find other life forms like us?

Answers

Answer:

Yes I do indeed believe in aliens of extraterrestrial life

Explain how digestive organs depend upon each other to provide nutrients to the body.

Answers

Answer:

The function of an organ system depends on the integrated activity of its organs. For instance, digestive system organs cooperate to process food. The survival of the organism depends on the integrated activity of all the organ systems, often coordinated by the endocrine and nervous systems.

Explanation:

Two students are working together to build a birdhouse. Student 1 applies a force of 10 N to a wooden board in order to slide it across the table to Student 2. If the force of friction resisting the student's push is 4 N, what is the net force acting on the board? A) 4N B) GN C) 10 N D) 14 N​

Answers

Answer:

Net force acting on the board = 6 N

Explanation:

Given:

Force acting by student 1 = 10 N

Force acting by student 2 = 4 N

Find:

Net force acting on the board

Computation:

Net force acting on the board = Force acting by student 1 - Force acting by student 2

Net force acting on the board = 10 N - 2 N

Net force acting on the board = 6 N

Answer: 6N

Explanation:

HELP GUYSSSSS PLS

Explain the role of insulin in the homeostatic regulation of blood glucose levels

Answers

Answer:

Insulin helps the cells absorb glucose, reducing blood sugar and providing the cells with glucose for energy. When blood sugar levels are too low, the pancreas releases glucagon. Glucagon instructs the liver to release stored glucose, which causes blood sugar to rise.

What difference would it make if the southern sea otter (Core Case Study) became extinct primarily because of human activities?

Answers

there would be less sea otters

Which organism is likely to carry out the process shown in the diagram?
CO, + H,O
Heat
www
Chloroplast
Mitochondrion
MASS
Respiration
OA. Barn owl
OB. Mushroom
C. Alligator
-0₂
Sugar
ATP

Which organism is likely to carry out the process shown in the diagram?CO, + H,OHeatwwwChloroplastMitochondrionMASSRespirationOA.

Answers

The organism that is most likely to carry out the process shown in the diagram is Calla lily (option D).

What is cellular respiration?

Cellular respiration is the process by which cells obtain chemical energy by the consumption of oxygen and the release of carbon dioxide.

According to this question, a diagrammatic representation of cellular respiration is given in the above chart. Based on the chart, chloroplast is included to release oxygen gas needed for respiration.

Only green plants possess chloroplast used for photosynthesis, hence, Cana lily is the most likely organism to carry out the above process.

Learn more about respiration at: https://brainly.com/question/29760658

#SPJ1

5. Assume that blood type is inherited as A and B dominant over O, but A and B are codominant
over each other. Genotypes (la la) and (lai) are then phenotypically type A, genotypes (le le) and
(lei) are type B, genotype (la ls) is type AB, and genotype (ii) is type O blood. A man with blood
type la la marries a woman with type AB blood. What are the genotypic and phenotypic ratios of
the children?

Answers

Answer:

Genotypic ratio = 1 (IaIa) : 1 (IaIe)

Phenotypic ratio = 1 (Type A) : 1 (Type AB)

Explanation:

This question involves a single gene coding for the inheritance of blood type in humans. However, three alleles (multiple alleles) are responsible for this inheritance. Alleles ia and ie, according to the question, are dominant over alleles i.

According to this question, a man with blood type "laIa" (blood type A) marries a woman with type AB blood (IaIe). The following gametes will be produced by each parent:

IaIa - Ia and Ia

IaIe - Ia and Ie

Using these gametes in a punnet square (see attached image), the following proportion of offsprings will be produced:

2 IaIa, and 2 IaIe offsprings

Therefore,

Genotypic ratio = 1 (IaIa) : 1 (IaIe)

Phenotypic ratio = 1 (Type A) : 1 (Type AB)

5. Assume that blood type is inherited as A and B dominant over O, but A and B are codominantover each

The frequency of allele A2 is 0.3 or 30%. Does this mean that 30% of the individuals in the population will have an A2 phenotype?​

Answers

Answer:

No, the frequency of an allele (in this case, A2) refers to the proportion of all alleles in the population that are A2. This does not necessarily mean that 30% of the individuals in the population will have an A2 phenotype, as the phenotype of an individual is determined by their specific combination of alleles.

Other Questions
A stream carves a channel through soil rock by removing a few small particles of rock at a time. The stream water slows down when it enters a pond, allowing the rock particles to settle at the bottom of the pond. Pressure combines these particles into a solid rock. What is the new rock called?A) quartz rockB) igneous rockC) sedimentary rockD) metamorphic rock It takes John 1 hour to walk to Jareds house 2. 6 miles away from eachother It only takes 20 minutes on his bike to get to Jareds house how much faster does he travel on his bike vvb4. a) In Part B what compound is present in test tube 2? Explain your reasoning. b) Is the compound present in test tube 2 pure? Explain your reasoning. Find the cost function if the marginal cost function is x and the fixed cost is $. Bruce retiled his kitchen. Originally, he bought three boxes of tile with the same number of tiles in each. He ran out of tile and had to go back to get three extra boxes of tile. However, he only used two tiles from the last box to finish the job.Felicia also retiled her kitchen. She bought five boxes of tile, and each box contained the same number of tiles as each of Bruces boxes. She also ran out of tile. She had to go back to the store and get five more tiles to finish the job.Is it possible for Bruce and Felicia to have used the same number of tiles? Use complete sentences to explain your reasoning. The realization that your mother has the same appearance and does not shrink as you watch her walk away from you (even though she appears to get smaller) means that you understand ______ constancy. Can someone plz help me with this one problem!!! 14. The local credit union is offering a special student checking account. The monthly cost of the account is $15. The first 10 checks are free, and each additional check costs $0.75. You searchthe Internet and find a bank that offers a student checking account with no monthly charge. The first 10 checks are free, but each additional check costs $2.50.a. Assume that you will be writing more than 10 checks a month. Let n represent the number of checks written in a month. Write a function rule for the cost c of each account in terms of n.b. Write an inequality to determine what number of checks in the bank account would be more expensive than the credit union account.c. Solve the inequality in part b. 2. what does the international monetary fund (imf) offer to a less developed country? o health and education services o wage and price controls o policy advice and technical assistance o foreign grants and loans which of the following is an accurate statement about the body? group of answer choices a. bodies are socially constructed. b. bodies are sites of regulation. c. bodies are sites for subversion. d. gender is inscribed on bodies. e. all of the above Which of the following sentences is grammatically correct?Multiple ChoiceA. Because Europe had suffered a great deal of damage during World War lI, the United States helped rebuild its infrastructure.B. Because Europe had suffered a great deal of damage during World War I the United States helped rebuild its infrastructure.C. Because Europe had suffered a great deal of damage during World War Il. The United States helped rebuild its infrastructure. Write a function. Choose three input values and find the corresponding output values. Show your work. A block slides down a smooth ramp, starting from rest at a height h. When it reaches the bottom it's moving at speed v. It then continues to slide up a second smooth ramp. At what height is its speed equal to v/2 you can simplify your report writing by breaking the job into three main sections: an introduction, body, and a close.T/F The AA schedule relates exchange rates and output levels that keep the money and foreign exchange markets in equilibrium. (a) Derive the AA schedule and (b) explain how the AA schedule shifts when there is an increase in the domestic money supply. A simplistic definition of crime is that it is anything that violates criminal law. A more complex definition would characterize it as a/an ________ event arising out of an intricate social nexus that involves a variety of participants. What is the name of the molecule shown below? Examine the image shown.Which transformation would move figure 1 to figure 2?k Which of the following is a specialized and highly targeted media selection that an advertiser might use to reach smaller customer segments with personalized content?A) radioB) magazinesC) newspapersD) network televisionE) online social networks What is the biblical definition of theology?