Answer:
Osmotic homeostasis is maintained despite the influence of external factors such as temperature, diet, and weather conditions. Osmosis is the diffusion of water across a membrane in response to osmotic pressure caused by an imbalance of molecules on either side of the membrane.
The boy is pushing a box with force 30 N. How much force is the box pushing back with and why
Answer:
30N
Explanation:
Newton's third law states that when you apply a force onto something, it gives the same force in an equal but opposite direction.
helppppppppppppp im stuck
Answer:
Ecosystem
Explanation:
Ecosystems are the largest organizational level found in one coral reef
What would happen to the
water temperature in the
surface zone if convection
currents did not form there?
Explain your answer
If all convection currents on Earth stopped that would be a natural disaster. The amount of heat which the sun radiates at us sets the temperature of the Earth's surface. If it weren't for convection, then the North and South poles would be even colder and the equator even hotter.
Answer:
If all convection currents on Earth stopped that would be a natural disaster. The amount of heat which the sun radiates at us sets the temperature of the Earth's surface. If it weren't for convection, then the North and South poles would be even colder and the equator even hotter.
Explanation:
I did reasearch from three different trusted sites
please help
5 points for each question
1. define enzymes in your own words
2. distinguish between absorption and digestion
3. compare the functions of the stomach and the small intestine
4. give an example of how the digestive system affects other systems
Enzymes are biological catalysts of chemical reactions. Absorption refers to the intake of substances from the small intestine while digestion also involves breaking down foods by enzymatic processes. The stomach mechanically breaks down food into small substances, while the small intestine absorbs these products. The digestive system affects other systems because the chemical energy required by cellular respiration is obtained by digestion.
What is an enzyme?An enzyme is a biological catalyst that acts to lower the activation energy of reactions. These catalysts (enzymes) play a fundamental role in digestion by breaking down foods into smaller particles.
Moreover, the small intestine functions to absorb these small particles which are used by cells during cellular respiration.
Therefore, with this data, we can see that an enzyme is a catalyst that acts to enhance the release of energy in the chemical reaction that occurs during digestion, which is a process that involves many organs such as the stomach and the small intestine.
Learn more about enzymes here:
https://brainly.com/question/11678128
#SPJ1
Why do you think we can say there are multiple interpretations of extinct animals?
Answer:
yes there are because manu animals like dinausaurs get extinct
Draw a simple diagram focusing on these steps of glycolysis and gluconeogenesis. Show glycolysis proceeding Down the page on the right. Show gluconeogenesis proceeding UP the page on the left. Include the key metabolite and the two names of the dual functioning enzyme – one name on right and one on left appropriately based on how it would enhance either glycolysis or gluconeogenesis. Indicate the key metabolite as either Activator or Inhibitor with a simple + or – on the diagram.
Glycolysis and gluconeogenesis, as well as the key metabolites and enzymes involved in each process.
Glycolysis:
Glycolysis occurs in the cytoplasm of cells and is the first step in cellular respiration.
It involves the conversion of glucose (6-carbon sugar) to pyruvate (2-carbon molecule) and the production of ATP (energy) and NADH (electron carrier).
The key metabolite is glucose, and the dual functioning enzyme is hexokinase, which phosphorylates glucose to glucose-6-phosphate.
Glycolysis is inhibited by high concentrations of glucose.
Gluconeogenesis:
Gluconeogenesis occurs in the liver and kidneys and is the process of converting non-carbohydrate molecules into glucose.
It involves the conversion of non-carbohydrate molecules (such as lactate, glycerol, and alanine) to glucose and the production of ATP and NADH.
The key metabolite is pyruvate, and the dual functioning enzyme is phosphoenolpyruvate carboxykinase (PEPCK), which converts pyruvate to phosphoenolpyruvate (PEP).
Glycolysis is promoted by low concentrations of glucose.
Learn more about Glycolysis Visit: brainly.com/question/1966268
#SPJ4
What is the end result of meiosis?
A. 2 identical cells
B. 4 genetically unique cells
C. 2 unique cells
D. 4 identical cells
Answer:
Meiosis end result: D. 4 identical cells. Mitosis's end result is 2 identical cells.
Answer:
4 genetically unique cells
Explanation:
Describe evidence for thinking in apes from studies of "insight" learning.
The Studies of "insight" learning in apes have provided strong evidence for their cognitive abilities and thinking processes. Insight learning refers to the sudden realization of a solution to a problem that was previously unsolvable. This type of learning has been observed in apes, particularly chimpanzees, through various experiments.
The One famous experiment conducted by Wolfgang Köhler involved placing a banana outside of a chimpanzee's cage and providing them with various tools such as sticks, ropes, and crates to see if they could figure out a way to reach the banana. The chimpanzees were initially unsuccessful in their attempts, but after some time, they suddenly had an "aha" moment and used the tools in a creative way to reach the banana. Similarly, another experiment by David Premack involved teaching chimpanzees how to use a set of symbols to communicate their desires. The chimpanzees were able to use the symbols in a flexible and creative way, indicating their ability to think abstractly and problem-solve. Through insight learning, they have demonstrated the ability to reason, plan, and use tools in innovative ways, providing strong evidence for thinking in apes.
learn more about evidence here.
https://brainly.com/question/31219759
#SPJ11
fast!!!
What two physical structures help protect the plant and animal against environmental conditions? (2 points)
Group of answer choices
Bark and feather
Pistil and ovary
Stamen and testes
Stem and skeleton
Answer:
Bark and feather
Explanation:
The outer covering of a plant is an example of a physical structure. Plants can have a waxy covering, fuzzy hair, feather,bark, thorns, or spines. These outer coverings help protect the plant from harsh weather conditions, predators, and can help reduce water loss. So your answer would be ( Bark and Feather)
A ferret's haploid number of chromosomes is 20. How would the number of chromosomes in the ferret's body cells compare to the number of chromosomes in its gametes? (4 points)
A. Its body cells would have 20 chromosomes, and its gametes would have 40 chromosomes.
B. Its body cells and gametes would both have 40 chromosomes.
C. Its body cells and gametes would both have 20 chromosomes.
D. Its body cells would have 40 chromosomes, and its gametes would have 20 chromosomes.
Answer:d
Explanation:d
Which on the following characteristics is a property that scientist use when identifying minerals?
A. Mass
B. Volume
C. Length
D. Luster
Answer:
i think it is A or B
Explanation:
sorry if its wrong have a good day/night
Answer:
D. Luster
Explanation:
Using Characteristics of Minerals to Identify Them. Most minerals can be characterized and classified by their unique physical properties: hardness, luster, color, streak, specific gravity, cleavage, fracture, and tenacity.
Which of the following contributes to the diversity of an ecosystem?
Increased keystone species
Reduced species richness
Increased invasive species
Increased foundation species
Answer:
Increased keystone species
Explanation:
An organism is a keystone species when it contributes to the definition of a given ecosystem such that the absence of the keystone species in an ecosystem, the ecosystem will change dramatically or be gradually wiped out
The effect of the keystone on its environment is unevenly large when compared to its abundance relative among other organisms within the ecosystem
The keystone is therefore, a prime source of balance of nature, diversity and well-being of the ecosystem
Therefore, the option that contributes to the diversity of the ecosystem is;
Increased keystone species.
what is newton's firt law
Newton's First Law, the Law of Inertia, states that an object at rest stays at rest and an object in motion stays in motion with the same speed and in the same direction unless acted upon by an unbalanced force.
What is motion?Motion is the physical movement of an object that changes its position over time. It can be linear or circular, and can occur in a straight line or an arc. Motion is a fundamental part of the physical world and is studied in many branches of science, including physics, astronomy, and mathematics. In physics, motion is studied in terms of displacement, velocity, acceleration, time, and energy. Motion can be represented graphically with the use of graphs and diagrams. Motion can also be expressed in terms of equations and mathematical formulas. Motion is an important factor in the understanding of the laws of physics, and in the application of engineering principles. Motion is also used to describe the motions of objects in the universe, such as planets, stars, and galaxies. Motion is also used in everyday life and is used in sports, transportation, and entertainment.
To learn more about motion
https://brainly.com/question/453639
#SPJ1
Deep facial bones that separate the oral and nasal cavities & form the nasal septum
The deep facial bones that separate the oral and nasal cavities and form the nasal septum are known as the ethmoid bone, the vomer bone, and the maxilla bone.
These bones are responsible for maintaining the structural integrity of the face and supporting the various functions of the oral and nasal cavities. The ethmoid bone, in particular, plays a crucial role in separating the two nasal cavities and providing structural support for the nasal passages. The vomer bone, on the other hand, helps to form the lower part of the nasal septum, while the maxilla bone contributes to the overall structure of the upper jaw and helps to support the teeth and gums. Together, these deep facial bones play an essential role in maintaining the health and proper functioning of the oral and nasal cavities.
The deep facial bone that separates the oral and nasal cavities and forms the nasal septum is the "vomer" bone. The vomer is a thin, flat bone that is located in the midline of the skull and divides the nasal cavity into left and right halves. It plays an essential role in supporting the structure of the nasal cavity and contributing to the overall structure of the face.
Visit here to learn more about nasal septum:
brainly.com/question/13386908
#SPJ11
the glomerulus is a unique high-pressure capillary bed because the
The glomerulus is a unique high-pressure capillary bed in the kidneys. This filtration bed is considered high pressure due to the type of vessels feeding and draining it. The afferent arteriole feeding the glomerulus is larger in diameter than the efferent arteriole draining the bed.
This anatomical characteristic makes the blood entering the bed to be under high pressure and leaves the bed under lower pressure. This pressure differential between the two arterioles forces fluids and solutes through the walls of the capillaries and into the urinary tubules for further filtration. Therefore, the larger diameter of the afferent arteriole provides a higher volume of blood under higher pressure to the glomerulus, increasing the efficiency of the filtration. The smaller diameter of the efferent arteriole slows the blood flow, increasing the pressure inside the capillaries and maintaining the high pressure in the bed. This anatomical feature provides a unique and efficient filtration mechanism to the kidneys.
learn more about glomerulus refer: https://brainly.com/question/30466548
#SPJ11
complete question: The glomerulus is a unique high-pressure capillary bed, because the ______ arteriole feeding it is larger in diameter than the ______ arteriole draining the bed.
How are basic anterior-posterior differences thought to arise along the neural ectoderm?
The basic anterior-posterior differences along the neural ectoderm are thought to arise through a combination of molecular signaling and positional information.
The ectoderm is initially patterned during early development, with certain regions being specified to become the neural plate. As the neural plate elongates and differentiates, various signaling molecules such as Wnts, BMPs, and FGFs help to establish distinct regions along the anterior-posterior axis. These signaling molecules act in concert with positional information from neighboring tissues to determine the identity and fate of different regions along the neural tube. For example, the hindbrain is specified by a combination of signals from the mesoderm and neighboring ectodermal regions, while the forebrain is induced by signals from the anterior endoderm. As the neural tube continues to develop, additional molecular signaling and patterning events help to further refine the anterior-posterior identity of different regions along the neural tube.
To know more about ectoderm please visit:
https://brainly.com/question/28303751
#SPJ11
Most species of bacteria cannot be eaten by humans because the bacteria contain.a. Trueb. False
True because they contain hazardous amounts of nucleotides, the majority of bacterial species are poisonous to humans. In comparison to eukaryotes, several bacterial species may contain 8% of their weight in nucleotides.
Humans are hazardous to such high concentrations of nitrogen-containing nucleotides. Two families of nucleoside analogs have been created to treat cancer and viral infections, but due to their absorption and subcellular action being controlled by host enzymes and transporters, these drugs can be harmful to specific tissues and cell types. Nucleoside transporters, which have identical functional properties but different substrate specificities, are necessary for the cellular uptake of these molecules. This is a limiting factor in the treatment of cancer and retroviruses because tissue-specific cellular production of these transporters permits nucleoside analogs to produce their tissue-specific harmful effects.
To learn more about species of bacteria click here:
https://brainly.com/question/27750488
#SPJ4
darwin studied this bird species and noticed their beaks are different shapes and sizes based on the type of food available to them.
Darwin studied the finch species in the Galapagos Islands and observed that their beaks vary in shape and size depending on the available food sources.
This variation in beak morphology is an example of adaptive radiation, where natural selection favors individuals with traits that are better suited to their specific environment and food sources. The different beak shapes allow the finches to efficiently exploit different types of food, highlighting the process of natural selection and adaptation.
Darwin typically refers to Charles Darwin, an English naturalist and biologist who is renowned for his contributions to the theory of evolution. Charles Darwin is best known for his book "On the Origin of Species," published in 1859, which presented his theory of natural selection.
Charles Darwin's theory of evolution revolutionized the way we understand the diversity of life on Earth. He proposed that species evolve over time through a process called natural selection, where individuals with advantageous traits are more likely to survive, reproduce, and pass on those traits to their offspring. This process leads to the gradual change and adaptation of species over generations.
Learn more about Darwin
https://brainly.com/question/30360938
#SPJ11
At the beginning of the film is a quote by Nobel Prize Winner Joshua Lederberg.
""The single biggest threat to man’s continued dominance on this planet is the virus. ""
Discuss this quote. Do you agree with it? Why or why not? What evidence from this film supports Lederberg’s view? What evidence from other sources that you have read or viewed lends support? What do you feel is significant about Lederberg’s statement in light of recent news regarding bioterrorism? What do you feel will be the future of human dominance on earth? Support your views with facts and logical thought
I agree with the quote. Viruses have caused pandemics and epidemics throughout history, and they continue to pose a threat to human health and survival.
Answering the questions about Virus in stagesThe COVID-19 pandemic, which began in late 2019, has demonstrated the devastating impact that a new virus can have on global health, the economy, and society as a whole.
In the film, we see how viruses can spread rapidly and cause illness and death. The footage of the Ebola outbreak in West Africa in 2014 and 2015 shows the devastating impact of a highly infectious and deadly virus on communities and healthcare systems. The film also highlights the ongoing threat of emerging viruses, such as Nipah virus and Lassa fever virus, which could potentially cause the next pandemic.
Outside of the film, there is a vast body of scientific research that supports Lederberg's statement. The World Health Organization (WHO) has warned that emerging infectious diseases, including viral diseases, pose a significant threat to global health and security. The WHO has also highlighted the need for better preparedness and response to infectious disease outbreaks to prevent future pandemics.
In light of recent news regarding bioterrorism, Lederberg's statement takes on even greater significance. Advances in biotechnology and genetic engineering have made it possible to create and modify viruses for nefarious purposes. The potential for a bioterrorist attack using a genetically modified virus is a real threat that governments and public health organizations must be prepared to address.
Looking to the future, it is difficult to predict the course of human dominance on Earth. However, it is clear that emerging infectious diseases and bioterrorism pose significant challenges to human survival and prosperity. To maintain our dominance, we must continue to invest in research, technology, and public health infrastructure to prevent and respond to infectious disease outbreaks. We must also prioritize international cooperation and collaboration to address global health threats, as viruses do not respect national borders.
Learn more about virus here https://brainly.com/question/25236237
#SPJ1
how does blood works?
Answer:
Blood is a mixture of two components: cells and plasma. The heart pumps blood through the arteries, capillaries and veins to provide oxygen and nutrients to every cell of the body. The blood also carries away waste products.
The adult human body contains approximately 5 liters (5.3 quarts) of blood; it makes up 7 to 8 percent of a person's body weight. Approximately 2.75 to 3 liters of blood is plasma and the rest is the cellular portion.
Plasma is the liquid portion of the blood. Blood cells like red blood cells float in the plasma. Also dissolved in plasma are electrolytes, nutrients and vitamins (absorbed from the intestines or produced by the body), hormones, clotting factors, and proteins such as albumin and immunoglobulins (antibodies to fight infection). Plasma distributes the substances it contains as it circulates throughout the body.
Explanation:
Zappos says goodbye to bosses - The Washington Post
Reflect on the changes to organizational structure
taking place at Zappos. What concepts are illustrated in this
article? Has it been a successful i
The changes taking place at Zappos illustrates numerous concepts related to organizational structure. The Holacracy system being adopted by the company removes the traditional line of command; instead tasks are delegated by employees to “circles” which are then serviced by members of those circles.
It focuses on efficiency of operations, as decisions are made in a decentralized fashion. Furthermore, the organization encourages employees to engage in learning and development to reach their potential, which is complemented by the company’s employee-first mentality.
It is difficult to ascertain whether these changes have been successful in so far as it is too early to ascertain the long-term effects. While the initial reports from the media focus on the positive aspects such as improved communication, job autonomy and growth, it remains to be seen if the company will continue to succeed or fall flat.
know more about growth here
https://brainly.com/question/28789953#
#SPJ11
please help me!! will give crown!
Answer:
2
Explanation:
2
Please can I have help asap
If one nerve stimulus arrives at a muscle fiber so soon that the fiber has only partially relaxed from the previous twitch, the most likely result will be __________.
If one nerve stimulus arrives at a muscle fiber so soon that the fiber has only partially relaxed from the previous twitch, the most likely result will be paralyze.
What is nerve?The lag phase refers to the interval between a motor neuron's activation and the onset of muscle contraction (sometimes called the latent phase). A signal known as an action potential travels to the motor neuron's end during the lag period (axon terminal).
Acetylcholine is released as a result, and the motor end plate depolarizes. The sarcoplasmic reticulum releases calcium as a result of the depolarization, and calcium then binds to troponin, exposing the myosin binding site.
The actual muscular contraction that creates tension in the muscle occurs next. The contraction phase is the following stage. Actin and myosin cross-bridges form during the contraction phase. Actin is moved by myosin, which also releases and modifies cross-bridges.
Therefore, If one nerve stimulus arrives at a muscle fiber so soon that the fiber has only partially relaxed from the previous twitch, the most likely result will be paralyze.
To learn more about paralyze, refer to the link:
https://brainly.com/question/27369833
#SPJ1
Type the correct answer in the box. Spell all words correctly.
Henry went on a field trip to a national park. He not only observed the aquatic life in the
land. Which type of diversity did Henry come across in the national park?
pond, but also the trees, vegetation, and animal's species on
Henry came across the
diversity.
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Why is the oxidation of NADPH energetically favorable? A) None of these answers B) The reduced form of NADPH is more stable than the oxidized form. C) The biosynthetic reactions that are coupled to NADPH oxidation are energetically favorable. D) NADPH is the form of the molecule that can gain two high-energy electrons. E) The oxidized form, NADP+, is more stable than the reduced form NADPH F) Oxidation of NADPH breaks a high-energy phosphoanhydride bond
The correct answer is option C) The biosynthetic reactions that are coupled to NADPH oxidation are energetically favorable.
Because it is connected to a biosynthetic reaction, NADPH oxidation is an energetically advantageous activity.
The synthesis of organic compounds like fatty acids and amino acids is fueled by two highly energetic electrons that come from the reduced form of NADPH. As a result, the oxidation of NADPH produces energy that drives the biosynthetic process.
The reaction is not triggered by the dissociation of a high-energy phosphoanhydride bond because the oxidised form, NADP+, is less stable than the reduced form, NADPH.
Consequently, because it is linked to a biosynthetic reaction, the oxidation of NADPH is energetically advantageous.
To learn more about oxidation visit:
https://brainly.com/question/25886015
#SPJ4
Arrange the following events in the proper order in which they occur during meiosis I.
1 = Separation of homologous chromosomes
2 = Synapsis
3 = Crossing-over
4 = Independent assortment
The events of meiosis I should occur in the following order: 2, 3, 4, 1. The initial phase of meiosis I, known as synaptogenesis, is when homologous chromosomes link together to generate tetrads.
The exchange of genetic material between homologous chromosomes, known as crossing-over, comes next. The random alignment of the paternal and maternal chromosomes on the metaphase plate is known as independent assortment.
The homologous chromosomes finally separate and travel to the opposing poles, a process known as homologous chromosomal separation.
Learn more about chromosomes at:
https://brainly.com/question/30993611
#SPJ1
Which substance's cycle can be disrupted by the addition of fertilizer and can result in eutrophication?
nitrogen
water
oxygen
carbon
Answer:
Oxygen
Explanation:
When excessive minerals(N.P.K) and nutrient are released into the body of water from leaching and other sources,(detergents,fertilizers application,sewage etc )which leads to corresponding increase in the population of algae(algae boom)the condition is called Eutrophication.
This disrupts the oxygen cycle because,the increased algae population(algae boom) makes use of available oxygen in the habitat for respiration.With continue supply of the nutrients,the population continue to rise.The competition for oxygen with other fauna leads to shortage of available oxygen,and therefore death of these fauna,and later of the algae.
The decomposing bacteria,also used the fragment pf oxygen to decompose the algae and other dead fauna,further reducing the oxygen levels of the water,with increase in water pollution.
Answer:
nitrogen because...
Explanation:
When nitrogen and phosphorus from fertilizer are carried in runoff to lakes and oceans, they can cause eutrophication, the overgrowth of algae.
2. A lunar eclipse can occur when the Moon is in......in its orbit.
Help me this is from amplify
Answer:
Lunar eclipses can only happen when the Moon is opposite the Sun in the sky, a monthly occurrence we know as a full Moon. But lunar eclipses do not occur every month because the Moon's orbit is tilted five degrees from Earth's orbit around the Sun. Without the tilt, lunar eclipses would occur every month.
A lunar eclipse occurs when the moon moves into the earth's shadow, it occurs when the earth, moon, and sun are close together.
What is a lunar eclipse?When the Moon passes through the shadow of the Earth, a lunar eclipse happens and also depends on the sun.
Only on the night of a full moon when the Moon is close to either lunar node can the Sun, Earth, and Moon be precisely or extremely closely aligned with Earth between the other two.
When the Moon and Sun are on opposing sides of Earth, a total lunar eclipse takes place. When only a portion of the Moon is covered by Earth's shadow, a partial lunar eclipse occurs.
Therefore when the moon moves into the earth's shadow lunar eclipse happens.
Learn more about the eclipse, here:
https://brainly.com/question/28679608
#SPJ3