The diagram of the types of cells such as the prokaryotic cells and eukaryotic cells ( including plants and animal cells) are found in the attachment.
What are the types of cells?There are two major types of cells: prokaryotic cells and eukaryotic cells.
Prokaryotic cells lack organelles, have no nucleus, and are significantly smaller than eukaryotic cells. A cell wall protects every prokaryotic cell. Many additionally include a polysaccharide-based capsule or slime layer. Examples are bacteria and archaea.
Every multicellular organism, including animals, plants, humans, and some unicellular organisms, are composed of eukaryotic cells, or cells with membrane-bound structures.
Learn more about types of cells at: https://brainly.com/question/29071624
#SPJ1
in order to identify a bacterial species that may be the cause of a disease in a patient clinicians can use quizlet
To identify a bacterial species that may be the cause of a disease in a patient, clinicians have several methods at their disposal. One commonly used approach is the use of laboratory tests and diagnostic techniques. These tests aim to identify the specific bacterial species responsible for the disease.
Here are the general steps that clinicians may follow to identify a bacterial species:
1. Clinical Assessment: The clinician will first evaluate the patient's symptoms, medical history, and conduct a physical examination. This initial assessment provides valuable information that can help guide the diagnostic process.
2. Specimen Collection: The clinician will collect a specimen from the patient that may contain the bacteria causing the disease. This can include samples such as blood, urine, sputum, wound swabs, or tissue biopsies.
3. Laboratory Testing: The collected specimen will be sent to the laboratory for testing. Various diagnostic tests can be performed to identify the presence of bacteria and determine the species. Some common tests include:
- Gram Staining: This technique involves staining the bacteria with crystal violet and iodine, followed by the application of a counterstain. It helps to classify bacteria into two main groups: gram-positive and gram-negative. This classification provides initial information about the bacterial cell wall structure.
- Culture and Sensitivity Testing: The specimen is cultured on specific growth media that encourage the growth of bacteria. Once the bacteria have grown, they can be identified using various methods such as biochemical tests, serological tests, or genetic techniques. Sensitivity testing can also be performed to determine which antibiotics are effective against the identified bacteria.
- Molecular Techniques: These advanced techniques involve analyzing the DNA or RNA of the bacteria to identify the species accurately. Polymerase chain reaction (PCR) and DNA sequencing are examples of molecular techniques used in bacterial identification.
4. Data Interpretation: The results of the laboratory tests are analyzed and interpreted by the clinician. The identified bacterial species, along with their characteristics and antibiotic susceptibility, are considered in determining the cause of the disease.
It is important to note that the use of quizlet is not a standard practice in the identification of bacterial species that may cause disease in patients. Quizlet is an online study platform that provides flashcards and study materials, which can be helpful for learning and reviewing information but not for diagnostic purposes.
Clinicians rely on established laboratory methods and diagnostic techniques to accurately identify the bacterial species responsible for a patient's disease. This information is crucial for guiding appropriate treatment and patient care.
To know more about bacterial species visit:
https://brainly.com/question/28602871
#SPJ11
What is the primary cause of poor air quality in Mexico City?
O gas emissions from drilling
O pollution from car exhaust
O particulates from erosion
Odust from deforestation
Answer:
Located in the crater of an extinct volcano, Mexico City is about 2,240 metres above sea level. The lower atmospheric oxygen levels at this altitude cause incomplete fuel combustion in engines and higher emissions of carbon monoxide and other compounds
Second option: pollution from car exhaust
Explanation:
Help me with number 3!!!!!!!!!!!! Please
Answer: (D)
Explanation: All planets have circular orbits around the Sun. Comets have elliptical orbit.
In sexual reproduction does offspring inherit twoce the DNA of each parent
Answer: No
Explanation: During meiosis the sex cells split into 4 cells instead of 2. The genes are copied during the first half, then they split alone during the second half. In the end, you have the cells with 23 chromosomes instead of 46. After the sperm fuses with the egg, the zygote has 46 chromasomes, the normal amount.
after 1min I will post a question for brainlist
Answer:
ok
Explanation:
HELP PLEASE I DONT UNDERSTAND
Answer:
Well i'm not going to tell you the answer but i can help
Explanation:
You have to use this picture and make a argument about these parts of dog they list what are there major movement like how they move
NEED ANSWER ASAP!!
8) A _____ has a nucleus, a corona, and a tail.
meteors
comet
stars
planet
asteroid
Answer:
I'm pretty sure it's a comet!
Explanation:
A comet's nucleus is like a snowball made of ice. As the comet nears the Sun, the ice starts to melt off, along with particles of dust. These particles and gases make a cloud around the nucleus, called a coma. A comet's nucleus, or heart, is the solid chunk of something in the center of its fuzzy coma.
Most comets have two tails. ... Because the comet dust particles are so small, they are pushed away from the Sun into a long tail. Another tail is made of electrically charged molecules of gas (called ions). Very rarely a comet will have a third tail made of sodium, which we usually don't see with our unaided eyes.
Very sorry if this is incorrect, I hope this helps!
~Kweenie~
what structure, composed of connective tissue, transmits force from contracting skeletal muscle to bone? group of answer choices myfibril tendon fascicle ligament aponeurosis
The structure composed of connective tissue that transmits force from contracting skeletal muscle to bone is called tendon.
Tendons are strong, fibrous cords of connective tissue that attach muscles to bones. They are responsible for transmitting the force generated by the muscle to the bone, allowing movement of the body. Tendons are made up of tough, collagenous fibers that are arranged in parallel bundles, and they are highly resistant to tensile stress.
Tendons can vary in size and shape depending on their location in the body and the function they perform. For example, the Achilles tendon, which connects the calf muscle to the heel bone, is one of the largest and strongest tendons in the body, while the tendons in the fingers are much smaller and more delicate.
To know more about Tendons
brainly.com/question/3205735
#SPJ4
A fungus the number of acorns to decrease significantly Which other populations of organisms will be directly affected, how Will these organisms be affected,Which one population will be affected the most why?
URGENT!
Last question guys pls help me
what do deep roots do for the plant
Even though a distinct classification of “deep roots” is missing to date, deep roots provide important functions for individual plants such as nutrient and water uptake but can also shape plant
a cell or an area of high pressure is said to have ___________ wind circulation, which means wind blows outward and away from the center.
A cell or an area of high pressure is said to have "anticyclonic" wind circulation, which means wind blows outward and away from the center. In this type of wind circulation, the air is descending, leading to clear skies and generally calm weather conditions.
What is anti-cyclonic wind circulation?
In an anti-cyclone or high-pressure region, the wind circulates clockwise in the Northern Hemisphere and counterclockwise in the Southern Hemisphere, with the flow turning outward from the center. In an area of high atmospheric pressure, the wind circulation is called anticyclonic circulation.
What is an anticyclone?
An anticyclone is a weather system in which the winds circulate clockwise in the Northern Hemisphere and counterclockwise in the Southern Hemisphere. In such weather systems, the wind blows outward and away from the center in a clockwise direction. Thus, a cell or an area of high pressure is said to have anti-cyclonic wind circulation.
To know more about anti-cyclones, visit:
https://brainly.com/question/31007961
#SPJ11
HELPPPP what goes where??? will give brainliest to first/best answer please pleaseee
Answer:
it should go in this order (starting and going from left to right) [see explanation]
Explanation:
carbon dioxide and water are your reactants
sunlight should go in the blue box
glucose and oxygen are your products
hope this helped xx
Answer:
first one is carbon dioxide. The second one is water. The third one is sunlight. The fourth one is sugar. And the last one is oxygen
Explanation:
Where is most of the baryonic matter (ordinary matter) of the universe found?
A. in planets and natural satellites
B. in comets and asteroids
C. in dark matter and dark energy
D. in interstellar gases and stars
Most of the baryonic matter (ordinary matter) of the universe is interstellar gases and stars. Baryonic matter is the visible matter. Thus, the correct answer is D.
What is Baryonic matter?Visible matter is also known as the baryonic matter. It consists of baryons which are subatomic particles such as protons, neutrons and electrons.
In cosmology, baryonic dark matter is the dark matter composed of baryons. Only a small proportion of the dark matter in the universe is likely to be baryonic the rest of the matter is all dark matter. Baryonic matter only includes matter composed of baryons. It can be described as the baryons are made up of protons, neutrons and all the objects composed of them (i.e. atomic nuclei), but exclude other things like electrons and neutrinos.
Therefore, the correct answer is D.
Learn more about Baryonic matter here:
https://brainly.com/question/20339321
#SPJ2
the hormone that helps plants respond to drought is
The hormone that helps plants respond to drought is called abscisic acid (ABA).
ABA is produced in response to water stress and helps plants conserve water by closing the stomata, the tiny pores on the leaves that allow for gas exchange with the atmosphere. By reducing the amount of water lost through transpiration, plants can conserve their water resources and survive in conditions of drought.
In addition to regulating water loss, ABA also plays a role in seed dormancy, germination, and other plant processes. It acts as a signaling molecule, transmitting information about environmental conditions to different parts of the plant and allowing it to respond appropriately.
To know more about abscisic acid here
https://brainly.com/question/13800529
#SPJ4
if t takes P-wave five minutes to travel from the epicenter of an earthquake to seismic station, approximately how long will it take for a S-wave to travel the same distance?
An S-wave would therefore need to travel the same distance from the epicenter to the seismic station in about 8.33 minutes.
S-waves move at a speed that is typically between 60% and 70% that of P-waves. For this computation, a cautious estimate of 60% is used.
We can calculate the time it would take for an S-wave to traverse the same distance if P-waves take five minutes to reach the seismic station by dividing the P-wave time by 0.6:
Time for S-wave equals Time for P-wave / 0.6, or 5 minutes divided by 0.6 results in 8.33 minutes.
To know more about S-waves:
https://brainly.com/question/19091422
#SPJ1
differentiate the types of muscle- skeletal, cardiac, smooth
Answer:
Skeletal muscle moves bones and other structures. Cardiac muscle contracts the heart to pump blood. The smooth muscle tissue that forms organs like the stomach and bladder changes shape to facilitate bodily functions.
Explanation:
Answer:
cardiac muscles perform involuntary muscular movements of the heart, aiding the heart to pump blood throughout the body, while skeletal muscles perform voluntary muscular movements of bones, aiding physical movements of the body such as walking, running, and writing and smooth muscles perform an involuntary muscular movements of internal organs, aiding functions of the body such as digestion, urination, and breathing.
suppose it is the year 2805 in the movie wall-e. humans have been forced to evacuate earth, and have been living on a spaceship where they're rarely exercising and have been eating as much as possible. the average bmi of every single human on the ship has exceedingly passed the obese stage. which of the following statements below is likely to be the most accurate regarding the weight gain of humans? group of answer choices the humans are experiencing an evolutionary mismatch which can be explained proximally (by the consistent eating of junk food over time) and evolutionary (energy conservation in ancestors was selected for since they would go long periods without eating) humans are not experiencing an evolutionary mismatch since natural selection is no longer acting on them. the humans are experiencing an evolutionary mismatch which can be explained developmentally (by the consistent eating of junk food over time) and evolutionarily (energy conservation in ancestors was selected for since they would go long periods without eating). the humans are experiencing an evolutionary mismatch which can only be explained developmentally (by the consistent eating of junk food over time)
The most accurate statement regarding the weight gain of humans in the scenario described in Wall-E is that they are experiencing an evolutionary mismatch which can be explained developmentally (by the consistent eating of junk food over time) and evolutionarily (energy conservation in ancestors was selected for since they would go long periods without eating). The lack of exercise and excessive consumption of food on the spaceship has disrupted the natural balance of energy intake and output, leading to weight gain and obesity.
Additionally, the evolutionary mismatch is caused by the difference between the current environment (consistent access to food) and the ancestral environment (periods of scarcity). This has led to a genetic predisposition to store excess energy as fat, which is exacerbated by the current lifestyle.
In the year 2805 in the movie Wall-E, the most accurate statement regarding the weight gain of humans is that they are experiencing an evolutionary mismatch, which can be explained both proximally (by the consistent eating of junk food over time) and evolutionarily (energy conservation in ancestors was selected for since they would go long periods without eating). This mismatch occurs because their current lifestyle drastically differs from the environment in which their ancestors evolved, leading to negative health consequences.
To know more about conservation visit-
https://brainly.com/question/29220242
#SPJ11
please help me
\((7)\)
Answer:
The answer is b
Explanation:
Wind is considered to be an abiotic factor because it
a. is not in any ecosystem.
b. is in equilibrium.
c. is not related to biodiversity.
d. is a nonliving thing
Wind is considered to be an abiotic factor because it is a nonliving thing. Option D.
Why is wind an abiotic factor?Wind is considered to be an abiotic factor because it is a nonliving thing. Abiotic factors are components of an ecosystem that are not living organisms but still have an impact on the ecosystem.
These factors can include physical and chemical elements such as temperature, sunlight, water, soil composition, and, in this case, wind.
While wind can affect the distribution and behavior of living organisms, it does not possess biological characteristics and is thus classified as nonliving or abiotic.
More on abiotic factors can be found here: https://brainly.com/question/19500256
#SPJ4
Geotropism is another word for
Select one:
O geology
Ogravitropism
Ophototropism
Answer:
Gravitropism
Step-by-step explanation
The growth of certain parts of plants that are respected by the force of gravity
How do extremophiles survive in the most extreme conditions?
There are several ways that extremophiles can survive in these extreme conditions like: Heat shock proteins, Membrane adaptations, Enzyme adaptations, DNA repair mechanisms and Metabolic flexibility.
Extremophiles are organisms that can survive and thrive in extreme environments that are inhospitable to most other life forms. These environments can include high temperatures, low temperatures, high pressure, low pressure, and other extreme conditions.
Heat shock proteins: Many extremophiles produce special proteins called heat shock proteins that help protect their cells from damage caused by high temperatures.
Membrane adaptations: Extremophiles often have membranes that are adapted to withstand extreme conditions. For example, some thermophilic bacteria have membranes that are rich in saturated fatty acids, which help maintain their structure and function at high temperatures.
Enzyme adaptations: Extremophiles often produce enzymes that are adapted to work at extreme temperatures or pH levels. These enzymes may have different amino acid sequences, and different shapes, compared to enzymes from non-extremophilic organisms.
DNA repair mechanisms: Some extremophiles have specialized DNA repair mechanisms that allow them to repair DNA damage caused by extreme conditions, such as high levels of radiation.
Metabolic flexibility: Extremophiles often have a wide range of metabolic pathways, which allows them to adapt to different nutrient and energy sources in their extreme environments.
To know more about extremophiles here
https://brainly.com/question/11409948
#SPJ4
how does photosynthesis contribute towards maintaining a clean environment and ensuring food security?
faster please I will mark you as brainlist for best answers
Answer:
Well for one photosynthesis gives out oxygen. This makes all animals able to live. So in that way it helps us and the world around us. Without photosynthesis we also could not eat food. No animals could live and no plants ould live. VERY IMPORTANT!
Explanation:
a biome is an ecosystem characterized by related animal populations. a large, stable terrestrial ecosystem or aquatic ecosystem. the smallest local designation of a community. a natural community that is unaffected by human activity.
A biome is a large, stable terrestrial ecosystem or aquatic ecosystem.
Because they belong to certain areas or zones that share a climate, flora, and fauna because of their geographical characteristics, biomes provide the primary support for the harmony of nature. A biome is a more general phrase than habitat because it can include a wide range of environments.
The rainforest biome is home to more than half of the world's plant and animal species, yet making up only 5% of the planet. Aquatic biomes make up over 75% of the Earth's surface, making them the biggest biomes.
To know more about Biome here
https://brainly.com/question/28063112
#SPJ4
Q7.5. Opponents of intelligent design refer to irreducible complexity as an "argument from personal incredulity" (i.e., "I personally can't imagine how this could have evolved, so it must not have evolved.").
Opponents of intelligent design do indeed refer to
irreducible complexity
as an "argument from personal incredulity." This term is used to highlight the logical fallacy underlying the argument.
The concept of irreducible complexity, often associated with the work of
biochemist
Michael Behe, suggests that certain biological systems are too complex to have evolved gradually through natural selection and must therefore be the product of intelligent design.
The criticism of irreducible complexity as an argument from personal incredulity stems from the fact that it relies on one's subjective inability to envision a stepwise
evolutionary
pathway for a particular biological feature or system. Just because something is difficult to comprehend or imagine does not imply that it is impossible or requires the involvement of an intelligent designer.
The argument from personal incredulity essentially states, "I personally cannot fathom how this could have evolved, so it must not have evolved." This line of
reasoning
overlooks the vast amount of scientific evidence supporting the theory of evolution and the gradual development of complex biological structures over time.
Critics argue that when faced with complex biological systems, scientists approach the problem by investigating and studying the available evidence, constructing
hypotheses
, conducting experiments, and analyzing data to understand the mechanisms behind their evolution. The scientific method encourages a systematic investigation rather than relying on personal incredulity.
Moreover, examples once considered irreducibly complex have been explained through subsequent scientific research. Proposed examples of irreducible complexity, such as the bacterial flagellum and blood-clotting cascade, have been shown to have
plausible
evolutionary pathways with intermediate stages that provide selective advantages.
In summary, opponents of intelligent design criticize irreducible complexity as an argument from personal incredulity because it relies on one's personal inability to
envision
or understand the evolutionary processes involved. They argue that scientific inquiry and evidence-based reasoning offer more reliable methods for understanding the origins and complexities of biological systems.
learn more about
irreducible complexity
here
https://brainly.com/question/30138436
#SPJ11
What is the term opponents of intelligent design use to describe irreducible complexity, characterizing it as an "argument from personal incredulity"?
The percentage of cells in each phase or stage can be used as a measure of how long each phase lasts. The cell cycle in onion cells takes 1,440 minutes (24 hours), so if you take the percentage of cells in each phase and convert it to a decimal figure by dividing by 100 and then multiply the amount of time the cell cycle takes, you can calculate the approximate time each stage or phase of the cell cycle lasts. Formula: Duration of phase (in minutes) = percentage/100 X 1,440 minutes
The formula for calculating the duration of each phase or stage of the cell cycle in onion cells is as follows: Duration of phase (in minutes) = (percentage/100) × 1,440 minutes.
The cell cycle in onion cells takes 1,440 minutes or 24 hours. By determining the percentage of cells in each phase and converting it to a decimal by dividing by 100, we can calculate the proportion of time each phase or stage lasts within the total cell cycle. Multiplying this proportion by the total duration of the cell cycle (1,440 minutes) gives us an estimate of the time each phase or stage lasts. This formula allows us to approximate the duration of different phases of the cell cycle based on the percentage of cells observed in each phase.
learn more about:- cell cycle here
https://brainly.com/question/25282664
#SPJ11
7.
The diagram below represents the flow of energy through a food chain.
5,000 units of energy
50 units of energy
500 units of energy
5.0 units of energy
If 5,000 units of energy are available from the producers, how much energy will be available to the secondary consumers?
Science not biology
our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a change to a g result in a change in gene expression?
No, a change to a G would not result in a change in gene expression as the underlined C is a non-coding nucleotide and does not have any effect on gene expression.
Non-coding DNA corresponds to the portion of an organism's genome that does not code for amino acids, the building blocks of proteins. Some noncoding DNA sequences are known to play functional roles such as regulation of gene expression, whereas other regions of noncoding DNA have no known function. Other regions of non-coding DNA are important for protein assembly. By altering one of these regions, a variant (also known as a mutation) in the noncoding DNA can turn on the gene, causing the protein to be produced in the wrong place or at the wrong time. There are two types of SNPs in the coding region.Synonymous and non-synonymous SNPs. Synonymous SNPs do not affect the protein sequence, whereas non-synonymous SNPs change the amino acid sequence of the protein.
To know more about Non-coding DNA visit:
https://brainly.com/question/28360970?referrer=searchResults
#SPJ4
(No links)
Which is NOT a characteristic of unsaturated fats?
A. liquid at room temperature
B. animal fats
C. kinks in the carbon chain
D. not fully saturated with hydrogens
Answer:
C
Explanation:
what kinds of things has air pollution done? why should we care?
Answer:
Pollution may muddy landscapes, poison soils and waterways, or kill plants and animals. Humans are also regularly harmed by pollution. Long-term exposure to air pollution,And we should care because it can lead to chronic respiratory disease, lung cancer and other diseases,ETC
Explanation: