write 47% as a common fraction​

Answers

Answer 1

Answer:

47/100

Step-by-step explanation:


Related Questions

Please answer the attached question

Please answer the attached question

Answers

The 5th term of the arithmetic series is  1179/ 19.

How to solve an arithmetic series?

The 10th term of the arithmetic series , S is 66.

Using arithmetic formula,

aₙ = a + (n - 1)d

where

n = number of termsd = common differencea = first term

Therefore,

66 = a + 9d

The sum of the first 20 terms of S is 1290.

Therefore,

Sₙ = n / 2 (2a + (n - 1)d)

1290 = 10(2a + 19d)

1290 = 20a + 190d

combine the equation

66 = a + 9d

1290 = 20a + 190d

Hence,

a = 66 - 9d

1290 = 20(66 - 9d) + 190d

1290 = 1320 - 180 + 190d

1290 - 1320 + 180 = 190d

190d = 150

d = 150 / 190

d = 15 / 19

Hence,

a = 66 - 9(15  /19)

a = 66 - 135 / 19

a = 1254 - 135/ 19

a = 1119 / 19

Hence, let's find the fifth term.

a₅ = a + 4d

a₅ = 1119 / 19 + 4(15 / 19)

a₅ = 1119 / 19 + 60 / 19

Therefore,

a₅ =  1179/ 19

learn more on arithmetic series here: https://brainly.com/question/16415816

#SPJ1

El profesor Ricardo consiguió para una comunidad de 48 familia un tanquero con 800 litros con agua y otro tanquero con 430 litro con agua ¿cuantos litros de agua cada familia ?¿crees que sobre agua ?

Answers

Answer:

25.625 litros de agua por familia.

No sobrará agua.

Step-by-step explanation:

En promedio el ser humano tiene que tomar al menos 3 litros de agua al día, con esto en mente y pensando que tienes 48 familias de las cuales en promedio serían 5 personas que conforman cada familia, tendrías que son en total:

48*5=240 personas

Tienes que tener almenos 3 litros de agua para cada persona:

240*3=720

Tienes en total 1230 litros de agua, sólo para cubrir lo que las personas necesitan tomar de agua son 720, falta ver si tienen que lavar, cocinar, limpiar o bañarse, entonces con los 1230 litros conseguidos, no alcanzaría ni para dos días de sólo tomar agua.

The beginning balance of the check register was $492.88. During the month, deposits were made for $210 and $499.88. Checks were
written for $18.25, $19.82, and $309.82. What is the ending balance of the check register?
Note: Round your answer to 2 decimal places.

Answers

Answer:

$840.77

Step-by-step explanation:

Find the value of X in the diagram. (See below)

1. 25
2. 10
3. 180
4. 50

Find the value of X in the diagram. (See below) 1. 252. 103. 1804. 50

Answers

Answer:

17

Step-by-step explanation:

STUDY HARD GUYS I NEED HW HELP


Which choice shows 19 + 32 + 11 rewritten correctly using the commutative property and then simplified correctly?
19+43 = 62
19+11+32= 30+32 = 62
11+9+10+32 20+32 = 52
19+11+32 = 30 +43 = 73

Answers

The choice shows 19 + 32 + 11 rewritten correctly using the commutative property and then simplified correctly is option B; 19+11+32= 30+32 = 62.

What is the commutative property of addition?

The commutative property of addition says that it doesn't matter how we add two numbers, the result of the addition would be same.

For two numbers x and y, we have:

x + y = y + x

WE have given

19 + 32 + 11

The sum would be 62.

We know that by commutative property of addition,

For two numbers x and y,

x + y = y + x

Thus, if we take 3 numbers as a,b and c, then:

c + a + b = c + b + a

Similarly,

19 + 32 + 11 = 19+11+32

= 30+32

= 62

Therefore, the option B  is the correct answer.

Learn more about properties of addition here:

https://brainly.com/question/1709448

#SPJ1

Sketch a graph of the quadratic function with the given vertex and through the given point. Then write the equation of the parabola in vertex form and describe how the function was transformed from the parent function y=x^2.
vertex (0, 0), point (−2,3)
vertex (1, 5), point (2, 1)

Answers

The functions and the required transformation from the parent function are created using MS Excel, please see the attached graphs;

1. Vertex (0, 0), point (-2, 3), the function is; f(x) = (3/4)·x²

The transformation is a vertical shrink by a scale factor of (3/4)

2. Vertex (1, 5), point (2, 1); The function is; f(x) = -4·x² + 8·x + 1

The transformation are a vertical stretch by a scale factor of √2, a horizontal translation of 2 units to the right, a reflection about the x-axis followed by a vertical translation of 5 units upwards.

What is a transformation of a function?

A function transformation is another function that changes the parent function.

The vertex point is (0, 0)

The point on the graph is (-2, 3)

The graph of a quadratic function is symmetrical about the vertex, therefore, the point (2, 3) is also on the graph

The quadratic function can be presented as; f(x) = a·x² + b·x + c

The point (0, 0), indicates, when x = 0, f(0) = 0

f(0) = a·0² + b·0 + c = 0

Therefore, c = 0

The point (-2, 3), indicates, when x = -2, f(-2) = 3, therefore;

f(-2) = a·(-2)² + b·(-2) + 0 = 4·a - 2·b = 3

4·a - 2·b = 3...(1)

The point (2, 3), indicates, when x = 2, f(2) = 3, therefore;

f(2) = a·(2)² + b·(2) = 4·a + 2·b = 3

4·a + 2·b = 3...(2)

Adding equations (1) and (2), we get;

8·a - 2·b + 2·b = 3 + 3

8·a = 6

a = 6/8 = 3/4

a = 3/4

4·a - 2·b = 3

4 × 3/4 - 2·b = 3

3 - 2·b = 3

- 2·b = 3 - 3 = 0

b = 0/(-2) = 0

b = 0

The equation is therefore; f(x) = (3/4)·x² + 0 × x + 0 = (3/4)·x²

f(x) = (3/4)·x²The transformation of the parent function is a vertical compression by a scale factor of (3/4)

Please see the attached graph of the function

The vertex is (1, 5), the point on the graph is (2, 1)

The symmetry of the quadratic function about the vertex point indicates that the point (0, 1) is also on the graph, therefore, we get;

f(0) = a·0² + b·0 + c = 1

c = 1

f(1) = a·1² + b·1 + 1 = 5

a + b + 1 = 5

a + b  = 5 - 1 = 4

a + b = 4...(1)

f(2) = a×2² + b×2 + 1 = 1

4·a + 2·b + 1 = 1

4·a + 2·b = 1 - 1 = 0

4·a + 2·b = 0...(2)

Multiplying equation (1) by 2 and subtracting the result from equation (2), we get;

2 × (a + b) = 2 × 4 = 8

2·a + 2·b = 8

4·a + 2·b - (2·a + 2·b) = 0 - 8 = -8

2·a = -8

a = -8/2 = -4

a  = -4

a + b = 4

-4 + b = 4

b = 4 + 4 = 8

The equation is therefore; f(x) = -4·x² + 8·x + 1

f(x) = -4·x² + 8·x + 1 = ((2·x - 2)² - 5) × (-1) = (-1) × (2·x - 2)² + 5

f(x) =(-1) × √2 × (x - 1)² + 5

Therefore;

The transformation are a vertical stretch by a scale factor of √2, a reflection across the x-axis, a horizontal translation of two units right and a vertical shift of 5 units upwards.

Please see the attached graph of the function created using MS Excel.

Learn more about the quadratic function here:

https://brainly.com/question/27910564

#SPJ1

Sketch a graph of the quadratic function with the given vertex and through the given point. Then write
Sketch a graph of the quadratic function with the given vertex and through the given point. Then write

Type the correct answer in the box. Use numerals instead of words.
Consider this expression.
√a³ - 7+ |b|
When a = 2 and b = -4, the value of the expression is

Type the correct answer in the box. Use numerals instead of words.Consider this expression.a - 7+ |b|When

Answers

The given  expression √(a³-7)+ | b |, when a = 2 and b = -4, the value of the expression is, 5

What are expressions?

An expression is a sentence with at least two numbers or variables having mathematical operation. Math operations can be addition, subtraction, multiplication, division.

For example, 2x+3

Given that,

The expression,

√(a³-7) + | b |

where, a = 2

b = -4

Now, by putting values of a and b in the given equation,

⇒ √(a³-7) + | b |

⇒ √(2³-7) + | -4 |

For whatever value of x, |x| will give always positive value

So, now it can be further written as,

⇒   1  + 4

⇒   5

Hence, the value is 5

To know more about Expressions check:

brainly.com/question/16804733

#SPJ1

What is the surface area of a sphere with a radius of 4.75 units?

Answers

283.385 units is the answer. The s.a. formula for a sphere is 4 x pi x r^2. Substitute and solve. By pi, I mean 3.14 on the calculator.

Hope it helps! Round if you need to!

NO LINKS!! URGENT HELP PLEASE!!!!

Find an equation of the circle that satisfies the stated conditions. (Give your answer in standard notation.)

Tangent to both axes, center in the second quadrant, radius 4

Answers

Answer:

\((x+4)^2+(y-4)^2=16\)

Step-by-step explanation:

A tangent is a straight line that touches a circle at only one point.

Since the circle is tangent to both axes, and the center of the circle is in the second quadrant, the center of the circle lies on the line y = -x.

As the circle is tangent to the x-axis, the distance between the center of the circle and the x-axis is equal to the radius of the circle.

Similarly, as the circle is tangent to the y-axis, the distance between the center of the circle and the y-axis is also equal to the radius of the circle.

Therefore, the center of the circle will be 4 units to the left of the y-axis and 4 units up from the x-axis. Therefore, the coordinates of the center are (-4, 4).

\(\boxed{\begin{minipage}{5 cm}\underline{Equation of a circle}\\\\$(x-h)^2+(y-k)^2=r^2$\\\\where:\\ \phantom{ww}$\bullet$ $(h, k)$ is the center. \\ \phantom{ww}$\bullet$ $r$ is the radius.\\\end{minipage}}\)

Substitute the center (-4, 4) and the radius, r = 4, into the standard equation of a circle:

\(\implies (x - (-4))^2+(y-4)^2=4^2\)

\(\implies (x+4)^2+(y-4)^2=16\)

Therefore, the equation of the circle that satisfies the given conditions is:

\(\boxed{(x+4)^2+(y-4)^2=16}\)

NO LINKS!! URGENT HELP PLEASE!!!!Find an equation of the circle that satisfies the stated conditions.

4t - 2 + t2 = 6 + t^2

Answers

Answer:

t = 2 , t = 4

Explanation:

The equation has two solutions.

The sum of 18 and a number, x, equals negative 40. Part A Which equation represents this situation? x-18=-40. x-18-40 18+x=-40. 18 + x = 40​

Answers

Answer:

18+x = -40

Step-by-step explanation:

The sum of 18 and a number x is translated to "18+x"
Equals means "="
Negative forty is "-40"
Put them all in order and you get 18+x = -40

3. & 4 will give brainlist helppp !

3. & 4 will give brainlist helppp !

Answers

Answer:

for the first one its the 3 answer

Step-by-step explanation:

i know because i had a similar quiz like yours and it was hard do i got a friend to help and i got 100% trust meeeeeeee

solve for m.. 9m+14=2m

Answers

Answer:

m=-2

Step-by-step explanation:

A mother is 30 years old when her daughter is 4. In how many years will the daughter’s age be half the mother’s age?

Answers

Answer:

in 11 years

Step-by-step explanation: half of 30 is 15 and 11 + 4 is 15.

Answer:Eleven Years

Step-by-step explanation:

Ok, if the mother is 30, then half her age would be 15. Now, if the daughter is 4, you would subtract 15-4, which equals 11.

So the answer is eleven years.

Hope this helped!

Rudolph can fly 5 miles in 12 seconds. At
that rate, how many miles can he fly per
minute?

Answers

Answer:

25 mpm

Step-by-step explanation:

60 devided by 12 = 5

5 times 5 = 25 mpm

(q1) Find the length of the curve described by the function

(q1) Find the length of the curve described by the function

Answers

The value of the Integral at the lower limit from the value of the integral at the upper limit to get the length of the curve.

The length of the curve described by the function f(x) = 1 + 3x^2 + 2x^3 is to be found. The formula used to find the length of a curve is:

L = ∫(sqrt(1 + [f'(x)]^2))dx where f'(x) is the derivative of f(x)We have to first find f'(x):f(x) = 1 + 3x^2 + 2x^3f'(x) = 6x + 6x^2

The integral becomes:L = ∫(sqrt(1 + [6x + 6x^2]^2))dx = ∫(sqrt(1 + 36x^2 + 72x^3 + 36x^4))dx The integral appears to be difficult to evaluate by hand.

Therefore, we use software like Mathematica or Wolfram Alpha to solve the problem. Integrating the expression using Wolfram Alpha gives:

L = 1/54(9sqrt(10)arcsinh(3xsqrt(2/5)) + 2sqrt(5)(2x^2 + 3x)sqrt(9x^2 + 4))The limits of integration are not given. Therefore, the definite integral  be solved.

We can, however, find a general solution. We use the above formula and substitute the limits of integration.

Then, we subtract the value of the integral at the lower limit from the value of the integral at the upper limit to get the length of the curve.

To know more about Integral.

https://brainly.com/question/27419605

#SPJ8

PLEASE HELP
Two projectiles are shot vertically upward at the same instant.
Projectile A's height in feet, f(t), is represented in the table, where t is the seconds since the projectile was shot off

Projectile B's height at any time t is modeled by the function
h (t)=-16t^2 +96t
How do the times at which the projectiles begin their descents compare?

SEE PHOTO

PLEASE HELPTwo projectiles are shot vertically upward at the same instant.Projectile A's height in feet,

Answers

Projectile B begins its descent 1 seconds before Projectile A does.

What is y-intercept?

In Mathematics and Geometry, the y-intercept of any graph or table such as a quadratic equation or function, generally occurs at the point where the value of "x" is equal to zero (x = 0).

By critically observing the table shown in the image attached above, we can reasonably infer and logically deduce the following y-intercept of Projectile A:

y-intercept = (0, 44).

Maximum height = (4, 300).

When t = 0, the y-intercept of Projectile B can be calculated as follows;

h(t) = -16t² + 96t

h(0) = -16(0)² + 96(0)

h(0) = 0.

For the maximum height, we have:

h(t) = -16t² + 96t

h'(t) = -32t + 96

32t = 96

t = 96/32

t = 3

Difference in time = 4 - 3

Difference in time = 1 seconds.

Read more on time and maximum height here: https://brainly.com/question/30145152

#SPJ1

−0.22+�−0.33−0.22x+x−0.33x?

Answers

The answer to the equation −0.22x + x − 0.33x is 0.11x.

The answer is 0.11x. To solve this, we can start by rearranging the terms of the equation. The equation can be written as:

−0.22x + x − 0.33x = −0.22 + 0.33x

We then subtract x from both sides of the equation, resulting in:

−0.22x − x = −0.22 + 0.33x − x

We then combine like terms on the left side of the equation, resulting in:

−1.22x = −0.55

Finally, we divide both sides of the equation by -1.22 to solve for x, resulting in:

x = 0.11

Therefore, the answer is 0.11x.

Learn more about equation here:

https://brainly.com/question/10413253

#SPJ1

Complete question

What is the value of -0.22+−0.33−0.22x+x−0.33x?

Work out sheet below please

Work out sheet below please

Answers

Answer:

-4 + 8 = 4

-2 + 6 = 4

-1 + 5 = 4

So the three pairs are -4 and 8; -2 and 6; and -1 and 5.

Which number(s) have a 5 that is 10 times the value of the 13,725 in ?

Answers

Answer:

I will give you three, but the answer is the number that has a 50

Step-by-step explanation:

52

654

7657

50 is the numbers that have a 5 in 10 times the value of the 13,725.

What is place value?

Place value is the value of each digit in a number.

For example, the 5 in 350 represents 5 tens, or 50; however the 5 in 5006 represents 5 thousands, or 5000.

Now the given number is,

13,725

10 times of the number is givens as,

13,725*10

or, 137,250

here place value of 5 in 137,250 is 5 tens or 50.

Therefore, 50 is the numbers that have a 5 in 10 times the value of the 13,725.

More about place value :

https://brainly.com/question/27733929

#SPJ1

It is 18 degrees Celsius at 8 am, and 14 degrees Celsius by noon. The change in the temperature from 8am to noon is?

Answers

Answer:

4 degrees Celsius

Step-by-step explanation:

It is asking for the change in temperature, or the difference. In word problems like this it is asking for subtraction.

So you just need to subtract the temperature at noon from the temperature at 8 am.

18 - 14 = 4 degrees

Answer:

4 degrees Celcius

Step-by-step explanation:

From 8 am to 12 pm is 4 hours. However, it is asking for the change in degrees from 18 degrees Celcius to 14 degrees Celcius.

It is asking for the change in temperature. In order to figure this out, you need to subtract. 18 - 14 = 4

Therefore, the change in degrees is 4 degrees Celcius.

What is the quotation?

What is the quotation?

Answers

Answer:

the quotient is the result so 4.25

Find the area of the figure

Find the area of the figure

Answers

Answer:

104ft

Step-by-step explanation:

First - find the area of triangles.

h = hight

b = base
h • b / 2

5 • 8 /2 = 20ft

And

4 • 6 /2 = 12ft

And then area of the rectangle.
l • w


9 • 8 = 72 ft

Than add. Them all together

The American Population is living longer. Along with the longevity of life comes additional challenges with both medical and Psychiatric problems. Your patient is about to be discharged from a short-tern rehab center. You overhear the daughter confiding in the nursing student that she cannot handle her mother and will be looking for a Memory care unit to put her mother in. You also hear the student nurse who was raised in a foreign country state, " I would NEVER put my mother in a home. I would take care of her woth my two sisters junti she dies.

what considerations might you make withthis students. Address the cultural differneces in elder care and adress the conself od "Role Strain" in caring for special populations.

Answers

Cultural sensitivity is crucial in elder care. Cultural beliefs impact elderly care. A foreign-raised nursing student desires to care for her mother and sisters until her mother's passing.

What is the cultural Strain?

Consider cultural values: Students from certain backgrounds may see caring for their elderly parents as a moral duty. Respecting elder beliefs is critical in discussing care options. Have open, non-judgmental communication with the nursing student. Show empathy and listen to her perspective.

Educate the nursing student about caring for a loved one with medical and psychiatric problems. Explain physical, emotional, and financial consequences, including effects on relationships and responsibilities.

Learn more about  Role Strain from

https://brainly.com/question/14283116

#SPJ1

after five years of owning a roth individual retirement account (ira), a person wants to buy his first home, the person can withdraw money from the roth ira

Answers

A person who has owned a Roth IRA for five years may withdraw money from the account to buy their first home. The individual has to meet certain requirements and can't withdraw more than $10,000 per person.

A Roth IRA is a type of individual retirement account that allows for tax-free withdrawals of contributions at any time, without penalty or taxes. After five years of ownership, a person who has a Roth IRA may withdraw money from the account to buy their first home. This withdrawal is known as a "first-time homebuyer distribution."

However, there are certain rules and limitations to be aware of when withdrawing money from a Roth IRA for a first home purchase. The individual must be a first-time homebuyer, defined as someone who has not owned a home in the past two years. Additionally, the maximum amount that can be withdrawn for a first home purchase is $10,000 per person.

It's important to note that while contributions to a Roth IRA can be withdrawn tax-free and without penalty, earnings on those contributions may be subject to taxes and penalties if withdrawn before age 59 and a half.

Learn more about IRA here:

https://brainly.com/question/9969005

#SPJ4

For question 30, state the domain and range of the function. ​

For question 30, state the domain and range of the function.

Answers

Step-by-step explanation:

normally a simple expression in x has no natural limitations.

but for fractions we have to pay attention, because we have to avoid results like .../0, as they are undefined.

so, 4x + 1 has no limitations, but x² - 1 must never be 0.

the only "bad cases" are

x² - 1 = 0

x² = 1

x = ±1

therefore, the domain (the definition of the valid values for x) is

x € R, x <> -1 and x <> 1

the range (the definition of valid values for y) is then any value between -infinity and +infinity.

simply because around x=-1 and x=+1 the tendency goes against - and + infinity.

What is 123X45 I tied but it is hard

Answers

123x45=5535 multiplication is hard :(

Answer:

5,535

Step-by-step explanation:

the domain of f. ​f(1)=10​, ​f(2)​=-7, ​f(3)=4

Answers

Answer: The domain of the function f refers to the set of all input values (x) for which the function is defined. Based on the information provided, it is not possible to determine the full domain of the function f. The only information provided are the outputs (f(1)=10, f(2)=-7, f(3)=4) for specific input values (1, 2, 3).

Step-by-step explanation:

two pounds of flour cost 1.20 .How much flour do you get per dollar?

Answers

1.67 pounds flour we get per dollar.

What does pounds mean in weight?

Pound, avoirdupois weight unit equivalent to 16 ounces, 7,000 grains, or 0.45359237 kg, and troy and apothecaries' weight unit equal to 12 ounces, 5,760 grains, or 0.3732417216 kg The symbol lb comes from the Roman predecessor of the contemporary pound, the libra.

Given,

Cost for 2 pounds of flour = $ 1.20

Cost per pound of flour = $ 1.20 /2

                                       = $ 0.20

Now for 2 dollar we get flour = 2 pounds.

for 1 dollar we will get flour = 2/1.20 pounds

                                              = 1.6666 pounds

i.e. for 1 dollar we will get flour = 1.67 pounds.

So, 1.67 pounds flour we get per dollar.

To know more about pounds refer to:

https://brainly.com/question/498964

#SPJ1

Compare the two parking garages.

Garage A
charges $5
plus $2
for every hour.
Garage B
charges $4.50
an hour, with no flat fee.

Answers

Garage B is more cost-effective for any parking duration exceeding 2 hours.

When comparing Garage A and Garage B based on their pricing structure, it's important to consider both the flat fee and the hourly rate to determine which option is more cost-effective.

Garage A charges a flat fee of $5, regardless of the duration of parking, and an additional $2 for every hour parked. This pricing structure benefits those who need to park for shorter durations, as the flat fee is relatively low.

However, for longer parking durations, the hourly charge can accumulate significantly, making it less favorable for extended stays.

On the other hand, Garage B follows a different approach by charging a rate of $4.50 per hour with no flat fee. This pricing structure is more suitable for those who require shorter parking times, as they only pay for the exact duration of their stay. In such cases, Garage B would likely be more cost-effective compared to Garage A.

However, for longer stays, Garage A might offer better value. For example, if someone needs to park for 6 hours, Garage A would charge $17 ($5 flat fee + 6 hours * $2/hour) while Garage B would charge $27 ($4.50/hour * 6 hours). In this scenario, Garage A would be the more affordable option.

Ultimately, the choice between Garage A and Garage B depends on the individual's specific parking needs. If the stay is anticipated to be short, Garage B's hourly rate is preferable.

However, for longer durations, Garage A's combination of a flat fee and hourly rate may result in lower overall costs. It's essential to consider the anticipated length of stay to make an informed decision.

For more question on cost visit:

https://brainly.com/question/2292799

#SPJ8

Other Questions
13. Explain why excess nitrate in drinking water or food products can be a health hazard; include the relevant balanced chemical reaction showing how nitrate becomes reduced. Beluga Corporation uses the allowance method to account for uncollectible receivables. At the beginning of the year, Allowance for Bad Debts had a credit balance of $1,000. During the year Beluga wrote off uncollectible receivables of $2,400. Beluga recorded Bad Debts Expense of $2,600. What is Beluga's year-end balance in Allowance for Bad Debts? A. $1,200 B. $200 C. $5,000 D. $3,600 (aime) the perimeter of triangle apm is 152, and the angle pam is a right angle. a circle of radius 19 with center o on ap is drawn so that it is tangent to am and pm. given that op The Battle of Bunker Hill in 1775 showedwhether the Americans would win the war.who the leader of the Continental army was.how Americans would fight against the British.how Americans would get supplies for the war. Change the voice in the following sentence. The Communication skills lecturer took all the language specialist students to the language laboratory for practicals last week. how does understanding the structure and function of the human brain help with diagnosis of disease Triangle XYZ is dilated by a scale factor of 4 3 . Which algebraic rule represents how to find the coordinates of triangle XYZ? Many African Americans moved to the North after the Civil War.O TrueO False 5. Models help us develop testable hypotheses because modelsO are very complex and time-consumingO are based on things we have never seenO show the relationships between parts of a wholeO make our observations more reliable A manager for a food distribution company wants to stimulate high motivation and performance in the coming month. Based on the goal-setting theory, what goal would be most appropriate for the manager to set for each representative the following data shows the quantities of soda and cheese that can be produced in the us and france with one unit of resources. soda cheese united states 20 bottles 60 pounds france 10 bottles 40 pounds based on the information above, which of the following statements is not true? the u.s. has a comparative advantage in producing soda the u.s. has an absolute advantage in producing soda the u.s. has an absolute advantage in producing cheese france has an absolute advantage in producing soda weld pool development during gta and laser beam welding of type 304 stainless steel, part itheoretical analysis find the solution using integrating factor methoddy/dx=(x^2-y)/x 5'-CGACACCGTTTCCAGCGCTCGAGCCACGCGAAGCTTCAGTCGCTGTGTCTCGAAG3'-GCTGTGGCAAAGGTCGCGAGCTCGGTGCGCTTCGAAGTCAGCGACACAGAGCTTCCGCACTACCACGAAGCGGAGCGCCTCCGCCGTCGCCCGCTTGGCCCCGTCGACAAGCGTGATGGTGCTTCGCCTCGCGGAGGCGGCAGCGGGCGAACCGGGGCAGCTGTTGTACCCCGTGAGGAAGAAGTTCCCTCTGCCGAGCACTATTTAGCAGTCCGAACAG-3'CATGGGGCACTCCTTCTTCAAGGGAGACGGCTCGTGATAAATCGTCAGGCTTGTC-5'1. Underline a 20-nucleotide target DNA sequence in the top (5 to 3) strand of the sequence above. Remember that this sequence should be directly upstream (on the 5 end) of a PAM sequence (5-NGG-3, where N stands for any of the four bases).2. Highlight the PAM sequence that is next to your target DNA sequence. This is where Cas9 will bind. when you begin your first full-time job, you have a monthly income of $4,500. your federal and state taxes are $1,000. you pay $1,600 in rent, have a $300 car payment, and spend $300 on food and $200 on clothes. the remaining $1,100 would be considered your Read this excerpt from A Night to Remember.No amount of persuasion or force could move Mrs. Hudson J. Allison of Montreal. A little apart from the rest, she huddled close to Mr. Allison, while their small daughter Lorraine tugged at her skirt.Which method of characterization does the author use to help the reader get to know Mrs. Allison?actionsappearancedialoguethoughts Investment banking firms provide:________ a. auditing services. b. overdraft facility. c. insurance.d. underwriting services. A pebble drops from a balcony that is 115 feet above the ground. The pebble lands on the top of a sign that is15 feet high. The function y 115 16t2 represents the height y (in feet) of the pebble t seconds afterdropping from the balcony. How many seconds does the pebble drop before hitting the sign What are the seven most common types of advertising appeals? Plz help with this paper.