why is it important to consume enough protein? check all that apply.group of answer choicesto supply the 9 eaas since these are not made by the body and are required from dietary protein.to replenish body proteinsto supply nitrogen to be used in building the neaasto use nitrogen to build other eaato make fat

Answers

Answer 1

Since the nine essential amino acids (EAAs) cannot be produced by the body and must be obtained from dietary protein in order to replenish body proteins and use nitrogen to build other EAAs, it is essential to consume sufficient protein. (Options 1, 2, and 4)

Amino acids make up proteins, including the nine essential amino acids, which the body cannot make and must get from food. Consuming enough protein is important to ensure that the body has sufficient EAAs to support vital functions like growth and repair of tissues, immune system function, and hormone production.

Additionally, protein is required for replenishing body proteins, such as those found in muscles, and for using nitrogen to build other amino acids or even fats.

Learn More about protein

https://brainly.com/question/30235811

#SPJ4

Complete Question:

why is it important to consume enough protein? check all that apply.group of answer choices

to supply the 9 eaas since these are not made by the body and are required from dietary protein.to replenish body proteinsto supply nitrogen to be used in building the neaasto use nitrogen to build other eaato make fat

Related Questions

the best type of fiber to eat for reducing constipation is ________.

Answers

The best type of fiber to eat for reducing constipation is insoluble fiber.What is fiber?Fiber is the carbohydrate that does not get digested in the small intestine. It is commonly classified into two types;

insoluble fiber and soluble fiber. Soluble fiber dissolves in water to form a gel-like substance and is essential for reducing blood cholesterol levels while insoluble fiber does not dissolve in water and its purpose is to promote the movement of material through your digestive system.What is constipation?Constipation is a situation where you have trouble passing stools, or having bowel movements. Constipation affects many people and it is usually caused by lack of fiber in the diet. Fiber increases stool bulk and helps them to pass easily through the digestive system.Reducing constipation and fiberConsuming fiber can reduce constipation. Dietary fiber helps in the digestion process by providing bulk to the fecal matter, thus enabling it to move more smoothly through the colon. According to nutritionists, insoluble fiber is the best type of fiber to eat for reducing constipation. This is because it absorbs water, adding bulk to the stool and thus helping it to move quickly through the digestive tract.In conclusion, insoluble fiber is the best type of fiber to eat for reducing constipation. Soluble fiber, on the other hand, is essential for reducing blood cholesterol levels. Therefore, both types of fiber are vital to the body.

to know more about fiber , visit

https://brainly.com/question/14836257

#SPJ11

Can someone please explain Hardy-Weinberg?! I don't get it!

Answers

Answer:

The Hardy-Weinberg equilibrium is a principle stating that the genetic variation in a population will remain constant from one generation to the next in the absence of disturbing factors. For instance, mutations disrupt the equilibrium of allele frequencies by introducing new alleles into a population.

Explanation:

i hope this helps and can i get brainliest pls

1. After meiosis I, explain what has happened to the number of chromosomes in the daughter cells compared to the parent germ cell (originally contained 46 chromosomes-diploid)?

Answers

After meiosis I, the number of chromosomes in the daughter cells is reduced by half compared to the parent germ cell.

How does the number of chromosomes in daughter cells change after meiosis I?

During meiosis I, which is the first division of meiosis, the parent germ cell undergoes chromosome replication followed by two rounds of division. Meiosis I consists of prophase I, metaphase I, anaphase I, and telophase I.

At the end of meiosis I, the homologous pairs of chromosomes separate, resulting in two daughter cells that are haploid, meaning they contain half the number of chromosomes compared to the parent cell. In humans, for example, where the original germ cell had 46 chromosomes (diploid), each daughter cell resulting from meiosis I would contain 23 chromosomes.

The reduction in chromosome number during meiosis I is essential for sexual reproduction. It ensures that when the haploid gametes from two individuals combine during fertilization, the resulting zygote will have the correct diploid number of chromosomes.

Learn more about meiosis

brainly.com/question/29383386

#SPJ11

PLZZZZZZZZ HELPPPP!
What is an example of an event that can compromise an ecosystem?
1.seasonal climate change
2.seasonal dry period
3.d eveloping land around cities
4.high temperatures

Answers

Answer: Seasonal climate change

Explanation:

Answer:

1. Seasonal climate change

Explanation:

oh, and can you please talk to Miracle, she needs a lot of help right now since her grandma passed away

A strain of neisseria gonorrhoeae has undergone a mutation and is no longer able to make pili. predict the most likely outcome.

Answers

A strain of Neisseria gonorrhoeae has undergone a mutation and is no longer able to make pili because The bacteria will become less virulent and will not be able to readily establish infection.

What is mutation ?

A deviation from the typical DNA sequence at a certain gene locus. Although the phrase is frequently associated with negativity, mutations (including polymorphisms) can affect cell activity in ways that are negative, positive, or neutral.

Because they increase genetic variation and the potential for individual differences, mutations are crucial for evolution to take place. For the most part, mutations have no discernible impact on the organisms in which they arise. Natural selection may increase the frequency of advantageous mutations.

Base substitutions, deletions, and insertions are the three different forms of DNA mutations.

Learn more about Mutation here:

https://brainly.com/question/17031191

#SPJ4

Which body system matures during childhood?
a
circulatory system

b
nervous system

c
lymphatic system

d
endocrine system

Answers

Answer:

Nervous system

Explanation:

- Development of the nervous system continues throughout childhood. The brain reaches its adult size in adolescence.

I think it is the endocrine system because it has something to do with our hormones.

If there is a proximal small intestine obstruction, will gastric reflux be obvious?

Answers

If there is a proximal small intestine obstruction, it is possible that gastric reflux may be present. However, this is not always the case as it depends on the severity and location of the obstruction.

Proximal small intestine obstruction refers to a blockage in the upper part of the small intestine, which can be caused by a variety of conditions such as tumors, hernias, or inflammation. When a proximal small intestine obstruction occurs, it can cause symptoms such as abdominal pain, bloating, nausea, and vomiting. Gastric reflux, also known as gastroesophageal reflux disease (GERD), is a condition in which stomach acid and contents flow back up into the esophagus, causing symptoms such as heartburn, chest pain, and regurgitation. GERD is caused by a malfunction of the lower esophageal sphincter (LES), which is the muscle that separates the stomach from the esophagus.

Learn more about Gastric reflux: https://brainly.com/question/29520560

#SPJ11

A person is comatose in bed for six consecutive months. You would expect their bone density to be?

Answers

If a person has been comatose in bed for six consecutive months, it is likely that their bone density would be significantly lower than a person who is able to partake in regular exercise and a healthy lifestyle.

During a coma, the body is in a complete state of rest, not only reducing the amount of calcium and minerals that is available to be taken in, but also reducing the body's ability to utilize it. Additionally, the lack of physical movement associated with being in a coma can also put a person at risk of developing osteoporosis and other bone diseases.

When someone is bedbound for a long period of time, the body can lose roughly 1 percent of its strength every week. This means that after six months, the person's muscles, bones, and joints will have lost roughly half their strength. This can not only decrease bone density, but also increase the risk of fractures and broken bones down the road.

know more about healthy lifestyle here

https://brainly.com/question/30131834#

#SPJ11

Wind, water, and ice are often involved in weathering and erosion, which can cause changes on Earth’s surface. However, weathering and erosion are not the same processes. Which of the following statements best describes how these two processes are different?

Answers

Answer:

Weathering and erosion constantly change the rocky landscape of Earth. Weathering wears away exposed surfaces over time. The length of exposure often contributes to how vulnerable a rock is to weathering

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Which statement describes the movement of water when a cell shrinks and shrivels due to osmosis?

Water went into the cell because the concentration of water inside the cell was lower than the concentration outside the cell.
Water went out of the cell because the concentration of water inside the cell was higher than the concentration outside the cell.
The cell membrane used energy to move water into the cell through passive transport.
The cell membrane used energy to move water out of the cell through passive transport.
Mark this and return

Answers

Osmosis is the spontaneous net movement or diffusion of solvent molecules through a selectively permeable membrane from a high water potential to a low water potential to equalize solute concentrations. Thus option (B) is correct.

What is osmosis?

Osmosis transports a solvent through a semipermeable membrane between two solutions of different solute concentration. Osmosis transfers solvent from low-solute to high-solute solutions.

Osmosis occurs in both the small and large intestines, with the majority of osmosis occurring in the large intestine. As your body processes food, it moves from the esophagus to the stomach and then to the small intestine. While there, your body absorbs important nutrients via osmosis.

Osmosis helps in stabilizing the internal environment of the organism by balancing the levels of water and intracellular fluids. Also, the nutrients and minerals enter the cell by osmosis which is necessary for the survival of cells.

Learn more about osmosis, here:

https://brainly.com/question/1799974

#SPJ1

On the ventral surface of the brain, you can observe the optic nerves and chiasma, the pituitary gland, and the mammillary bodies. These externally visible structures form the floor of the __________.

Answers

On the ventral surface of the brain, you can observe the optic nerves and chiasma, the pituitary gland, and the mammillary bodies. These externally visible structures form the floor of the diencephalon.

Where is the diencephalon located?

The diencephalon is the central part of the brain located around the third ventricle, superior to the brainstem (medulla, pons, and midbrain), and inferior to the corpus callosum and cerebral cortex.

The diencephalon is divided into four main sections including the epithalamus, thalamus, subthalamus, and hypothalamus. The largest and most significant part of the diencephalon is the thalamus, which is an ovoid gray matter structure that conveys information from the cortex to the rest of the nervous system and vice versa. The epithalamus is a small part of the diencephalon located on the back and tail of the thalamus. The subthalamus and hypothalamus are both located ventral to the thalamus. The subthalamus is involved in the regulation of movement, while the hypothalamus controls vital functions such as hunger and thirst.

Learn more about diencephalon https://brainly.com/question/8917225

#SPJ4

the skeletons of mammalian forelimbs represent variations of a structure that was present in their common ancestor. what has most likely caused the variation in forelimbs?

Answers

The variations in forelimbs of the skeletons of mammalian forelimbs are most likely caused by adaptive radiation, genetic drift, mutation, and natural selection.

Explanation:Adaptive radiation Adaptive radiation occurs when a species colonizes a new environment with an array of ecological niches and evolves to exploit these resources. Adaptive radiation can result in a wide variety of organisms being created that are adapted to specific ecological niches, and this can occur in a relatively short amount of time.Genetic drift Genetic drift refers to the random variations in gene frequencies over generations.

It has the potential to cause significant changes in the genetic make-up of a population in a relatively short amount of time, but it is more commonly seen in small populations. Mutation Mutations are random changes in the genetic material of an organism, usually caused by errors in DNA replication. Mutations may be caused by environmental factors such as radiation, or they may be random. Natural selection Natural selection is a mechanism of evolution that occurs when individuals with beneficial adaptations are more likely to survive and reproduce than individuals without these adaptations.

The variations in forelimbs of the skeletons of mammalian forelimbs are most likely caused by adaptive radiation, genetic drift, mutation, and natural selection.

Learn more about forelimbs

https://brainly.com/question/28313674

#SPJ11

If I mash up my potato then the activity of catalase will increase/decrease/stay the same because

Answers

If I mash up my potato then the activity of catalase will increase because of the increase in the surface area of the substrate.

What is an Enzyme?

This is referred to as a biological catalyst which speeds up the rate of a reaction by lowering the activation energy and is substrate specific.

Enzymatic action increases when there is a corresponding increase in the surface area of the substrate as more enzymes are able to come in contact with them. This is the reason why it is food to chew food so as to ensure enzymatic activity is increased and the digestion process becomes faster.

Read more about Enzyme here https://brainly.com/question/14577353

#SPJ1

Describe the characteristics shared by humans and other primates that suggest they have a common ancestor.

Answers

Answer:

Humans and other primates share many characteristics that suggest they have a common ancestor. Some of these characteristics include:

1. Opposable thumbs: Humans and other primates have opposable thumbs that allow them to grasp objects and manipulate them with precision.

2. Forward-facing eyes: Humans and other primates have forward-facing eyes that give them binocular vision and depth perception.

3. Large brains: Humans and other primates have relatively large brains compared to other animals, which is associated with advanced cognitive abilities.

4. Skeletal structure: Humans and other primates have similar skeletal structures, with four limbs and five digits on each limb.

5. Similar DNA: Humans and other primates share a significant amount of DNA, indicating a common ancestry.

These shared characteristics provide evidence that humans and other primates evolved from a common ancestor.

pls award brainliest!

Explanation:

Choose T (True) or F (False)

Choose T (True) or F (False)

Answers

Answer:

a) true

b) true

c) false

d) true

e) false

why does the electron transport chain occur in the inner mitochondria in cellular respirationl membrane

Answers

The electron transport chain (ETC) occurs in the inner mitochondrial membrane in cellular respiration because this is where the necessary components for the ETC are located.

The inner mitochondrial membrane is a highly specialized structure that is rich in protein complexes and enzymes that are responsible for the transfer of electrons and the production of ATP, which is the primary source of energy for the cell.The inner mitochondrial membrane is also organized into two distinct regions, the inner and outer membranes, that are separated by the intermembrane space.

The ETC takes place in the inner membrane, where the electron carriers, such as cytochromes, are embedded. These electron carriers transfer electrons along the ETC, and the energy released from this process is used to pump protons across the inner mitochondrial membrane, creating a proton gradient. This proton gradient is then used to generate ATP through the process of chemiosmosis.

Moreover, the inner mitochondrial membrane is also selectively permeable and this is important for maintaining the necessary conditions for the ETC to take place. The inner mitochondrial membrane is composed of a phospholipid bilayer that serves as a barrier to prevent the leakage of protons and other small molecules, which would disrupt the proton gradient and inhibit ATP production.

Learn more about electron transport chain (ETC) at : https://brainly.com/question/29544581

#SPJ4

Biology, I need help please!!1

Biology, I need help please!!1

Answers

Answer:

The BBC cell

Explanation:

BBC: The BBC cell means the Big Bad cell aka the big black clock

Adults of species in the order ___ have 2 wings and the greatest variety of mouthparts. Group of answer choices Isoptera Coleoptera Diptera Lepidoptera

Answers

Adults of species in the order Coleoptera have 2 wings and the greatest variety of mouthparts.

Order Coleoptera

The coleopterans, (order Coleoptera), consist of the beetles and weevils. It is the largest order of insects.

They have two pairs of wings:

One of the pair is the hard-shelled outer wings known as the “elytra”. These are not used for flying, but to protect the beetle's flying set of wings and its body as it crawls through narrow passages and tunnels in a tree.

The second set of wings is membranous and is folded under the elytra when not in use.

Learn more about insects:

https://brainly.com/question/2749308

The following segment of mRNA codes for a segment of a polypeptide:
5' ......AUG-AAA-CAA-UUU-AAU-CUA-UUC-UCU-AUU-AAA-ACC .....3'
a) Indicate if it is in RNA or DNA
b) Perform the replication of the molecule.
c) indicate which enzymes and what is the function of each of them in the replication process.
d) Draw a DNA molecule and indicate each of its components.

Answers

The components of a DNA molecule include deoxyribose sugar, phosphate group, and nitrogenous bases (adenine, thymine, cytosine, and guanine).

What are the components of a DNA molecule?

a) The given segment is in mRNA (messenger RNA) form.

b) Since the given segment is already in mRNA form, replication, which is the process of synthesizing a complementary DNA strand, is not applicable here.

c) Enzymes involved in DNA replication include:

 DNA helicase: Unwinds the double-stranded DNA by breaking the hydrogen bonds between the base pairs.   DNA polymerase: Catalyzes the synthesis of a new DNA strand by adding complementary nucleotides to the template strand.  DNA primase: Synthesizes short RNA primers that provide a starting point for DNA polymerase to begin replication.  DNA ligase: Joins the Okazaki fragments (short DNA segments on the lagging strand) by catalyzing the formation of phosphodiester bonds.   DNA topoisomerase: Relieves the torsional strain generated during DNA unwinding.

d) Unfortunately, as a text-based AI, I cannot draw images. However, a DNA molecule consists of two strands forming a double helix structure. The components of DNA include:

  Deoxyribose sugarPhosphate groupNitrogenous bases (adenine, thymine, cytosine, and guanine)

Learn more about DNA molecule

brainly.com/question/30463111

#SPJ11

The cellular structures found in prokaryotes are (select all that apply) Capsules Ribosomes Golgi complex Mitochondria Fimbriae

Answers

Prokaryotic cells are basic cells that lack membrane-bound nuclei and complex organelles and the cellular structures found in prokaryotes are Capsules, Ribosomes, and Fimbriae.

Numerous prokaryotes have a tacky peripheral layer called the capsule, which is generally made of polysaccharides. Ribosomes are found and freely distributed in prokaryotes. Fimbriae are a kind of limb of prokaryotic cells. These hair-like bulges permit prokaryotes to adhere to surfaces in their current circumstance and to one another.

Mitochondria and the Golgi apparatus assembly are remarkable to eukaryotic cells, and won't be tracked down in prokaryotes.

Learn more about prokaryotic cells here,

https://brainly.com/question/13273192

#SPJ4

Over time, a hypothesis that is supported by many experiments and much data becomes a _____________.

Answers

Answer:

Over time, a hypothesis that is supported by many experiments and much data becomes a theory.

Part A

What are the similarities and differences between the two fish varieties?

B I u X

X

Font Sizes

A

A

E EE

M

5

Characters used: 0 / 15000

Answers

Yet, a number of species in this family differ significantly from one another despite these commonalities. Fin fish, including salmon, have scales, gills, and reproduce via laying eggs.

These fish, known as chondrichthyes, have cartilage. Dogfish and whale shark, as examples. Osteichthyes: These fish have jaws and are made of bone. Example: Salmon and lungfish. Fish are divided into two main categories by scientists: fish with jaws (Gnathastomata) and fish without jaws (Agnatha). The shape of fish's heads, the location of their mouths, the type and location of their fins, and their average adult size are some traits that set them apart. When combined with other characteristics, colour markings like vertical stripes and fin spots may also be used to assist distinguish fish.

Learn more about fish

https://brainly.com/question/29871499

#SPJ4

Despite these similarities, a few species in this family differ greatly from one another. Salmon and other finfish have gills, scales, and reproduce by laying eggs.

These fish have cartilage and are referred to as Chondrichthyes. Examples include dogfish and whale shark. Osteichthyes: These fish have bone-covered jaws. Salmon and lungfish, for instance. Scientists categorize fish into two primary groups: fish without jaws (Gnathastomata) and fish with jaws (Agnatha). Some characteristics that distinguish fish include their typical adult size, the type and position of their fins, the form of their heads, and the location of their mouths. Vertical stripes and fin spots are examples of color markings that can help recognize fish when paired with other traits.

The two countries' relationship had been difficult and they were currently facing a serious security issue.

Due to the fact that both countries had nuclear warheads and wanted to ensure that their own strengths and capabilities could surpass those of the other, a security challenge arose.

Learn more about Salmon here

https://brainly.com/question/17708323

#SPJ4

A chewing insect damages the vascular tissue of a plant system. This damage will most directly affect the

Answers

Answer:

Conduction of water and minerals between the roots and leaves

Explanation:

- EIjiro

the sequence of the coding strand of a dna molecule (that is, the dna strand that contains the codons specifying the protein sequence) is 5'-cggatgctta-3'. what is the sequence of the rna made from this dna?

Answers

Transcription of an RNA strand with the sequence "AUUGCGCGAA" from a DNA strand with the sequence "TAACGCCTT" As a result, C is the correct answer.

Transcription is the process by which mRNA is created from DNA in the nucleus of a cell. The nucleus contains all of the enzymes and nucleotides required for the production of mRNA. The messenger RNA (mRNA) is transcribed from DNA The mRNA sequence generated in a cell from DNA is complementary to the leading strand of DNA, with only the thymine residues replaced by uracil residues. Adenine base couples with uracil residues, and thymine base pairs with adenine residues. Cytosine bases couple with guanine bases and vice versa.

To learn more about  DNA please click on below link

https://brainly.com/question/264225

#SPJ4

Since mucus-producing cells and cilia are sparse in the bronchioles and alveoli, how does the body remove microorganisms that make their way into the respiratory zone?.

Answers

The body removes microorganisms that make their way into the respiratory zone in several ways such as the macrophages and other cells that reside in the respiratory system's distal regions. These cells identify and engulf microorganisms, breaking them down and removing them from the respiratory system in this way.

This is facilitated by the fact that the epithelial cells lining the respiratory system are covered with small hair-like projections known as cilia. The cilia in the upper respiratory tract propel mucus and trapped microorganisms up and out of the lungs. Coughing and sneezing help in this process.Apart from this, some alveolar macrophages also engulf microorganisms that make it to the alveoli. In addition, some cells in the lungs produce an enzyme called lysozyme that can break down the walls of certain bacteria.Explain:As we know that the bronchioles and alveoli are parts of the lungs where gases exchange takes place between air and the bloodstream.

In these parts, there are fewer cilia and mucus-producing cells as compared to other parts of the respiratory system. Cilia are tiny, hair-like structures that line the airways of the respiratory system and help to move mucus out of the lungs. While mucus-producing cells produce a sticky liquid called mucus which is helpful in trapping dust, bacteria, and other debris.In case any microorganisms enter the respiratory zone through the bronchioles or alveoli, the body removes them by the action of cells such as macrophages and other cells that live in the distal part of the respiratory system. Moreover, some cells in the lungs produce an enzyme known as lysozyme that can break down the walls of specific bacteria.

To know more about lysozyme visit:-

https://brainly.com/question/31868978

#SPJ11

4. Being a longtime herpesvirus sufferer, Brad was not surprised to learn (at a herpes information session)

that herpesviruses tend to "hide out" in nerve tissue to avoid attack by the body's immune system.

However, their "mode of travel" in the body did surprise him. How do herpesviruses travel to the neuron

cell body?

I NEED HELP!!!!

Answers

Herpesviruses are a family of viruses that are known to cause a range of diseases in humans and animals.

They are characterized by their ability to establish lifelong infections in their hosts, and one of the ways they achieve this is by hiding out in nerve tissue. This strategy allows herpesviruses to evade the immune system, which can't easily reach nerve cells to attack them.
But how do herpesviruses get to the neuron cell body, where they can establish this long-term hiding place. The answer lies in their ability to travel along nerve fibers, a process known as retrograde axonal transport. During this process, the virus particles attach to the ends of nerve fibers and then travel back towards the neuron cell body.
This mode of travel can be both efficient and effective, as it allows herpesviruses to quickly reach the nerve cells where they can establish a latent infection. However, it also presents a challenge for the immune system, which must try to intercept the virus particles as they travel along the nerve fibers.
Overall, the ability of herpesviruses to hide out in nerve tissue and travel to the neuron cell body is just one of the many strategies they use to evade the immune system and establish lifelong infections. Understanding these strategies is an important step in developing better treatments and prevention strategies for herpesvirus infections.

To know more about Herpesviruses visit:

https://brainly.com/question/28116946

#SPJ11

What occurs when there is a higher concentration of molecules on one side of a membrane and the molecules flow to the other side to balance the concentration
Fusion
ОООО
Simulus
Conversion

Answers

Answer:

Diffusion

Explanation:

The concept of diffusion states that molecules like to travel from areas of high concentration to low concentration.

Let's think about an example. Let's say you are having a party at your house and in one room there is 100 people and in the other room connected to it, there is only 10 people. What do you think is going to happen as time passes? Right, people are going to move to the room where there is less people so as to equally disperse themselves across the area. The same thing happens within our body with ions and gases.

Ions can diffuse into or out of cells based off their concentration gradients. If there are too many ions on one side, they will simply move to the other side. There are different types of diffusion. Passive diffusion and facilitated diffusion, but those are for a different conversation.

You have a plant that you want to show off at a party. The party happens during autumn (aka fall). Usually in autumn (aka fall) the leaves of your plant fall off. You want to delay the leaves falling off your plant until after the party. What plant hormone would you use to help keep the leaves on? ethylene O cytokinins O gibberellins auxin

Answers

Answer:

Auxins

Explanation:

Auxin is a plant hormone that has to do with both leaf and fruit fall.

HELP ME PLEASE Which equation shows one way that a plant cell stores energy in an energy-carrier molecule?

HELP ME PLEASE Which equation shows one way that a plant cell stores energy in an energy-carrier molecule?

Answers

Note that the equation that shows how cells use the energy stored in an energy carrier is as follows: ATP → ADP + NADPH (option D).

In the cell, how is energy used?

Energy is the ability to do labor and is a critical criteria for every metabolic activity that happens in living cells.

Adenosine triphosphate is the energy currency in living creatures' cells (ATP). ATP is a biomolecule that provides energy in cellular processes.

When a phosphate group is added to ADP, energy is stored in the cell, whereas energy is discharged for use when a phosphate group is removed from ATP to create ADP.

This implies that the equation that depicts how cells utilise the energy contained in an energy carrier is: ATP ADP + NADPH.

Learn more about energy carrier at:

https://brainly.com/question/14275887

#SPJ1

Other Questions
A circle with radius 1-inch rolls without slipping along the sides of a right triangle whose side lengths are 3 inches, 4 inches, and 5 inches as shown. When the circle gets to a vertex, it continues to rotate around the vertex. The circle stars and ends at the middle of the 5 inch side. The center of the circle travels a total distance of [tex]M+N\pi[/tex]in one complete circuit. Find [tex]M+N[/tex] in simplest form true or false? the sarbanes-oxley act (sox) requires companies to report accurate financial data in order to protect their auditors from harm. please help ill give brainliest What is the slope of the line that passes through the points (5, 1) and (2, -7)? a special organ that provides the embryo with fluids and nutrients is called the A 102 kg man climbs a 5.0-meter-high stair case at constant speed. How much work does he do? what is the main idea of the text Celebrating Juneteenth ? Which of the following STEM discoverers is known for his studies of the universe? Rosa's pretax accounting income in 20X2 is $3,000. Rosa deducts depreciation for tax purposes in excess of accounting depreciation of $300 in 20X1 and $700 in 20X2. It is expected the depreciation deduction will reverse $500 in 20X3 and $500 in 20X4. The income tax rate is 40%. What is the amount in the deferred tax liability account at the end of 20X2 Read this text and change the words goose and child to plurals. What can you do to prevent collisions? Evidence and arguments offered by the defendant to show why the defendant should not be held liable for a criminal charge are called ________. Consider a portion of a gene that contains 48 nucleotides. how many amino acids will be coded for by this section of the gene? im in 10th grade geometry and need help if you have eaten a big meal, which part of the stomach may prevent the diaphragm from moving downward and possibly cause you to have trouble taking a deep breath? Gio used the compound interest formula to calculate the final value of an investment of $4,000 compounded quarterly for 8 years. His calculation was as follows. A=$4,000(1.0235) 32What is the annual interest rate, rounded to the nearest hundredth of a percent? 2.35% 9.40% 24.50% 7.05% Which of the following is an example of statistical interference? A. having a sample size that is too large B. calculation errors C. selecting one demographic for surveying D. selecting a representation of a population and translating it to a larger group What is the volume of 20 moles of H2 at 400 C and 2 atm? A rock falls off a cliff and hits the ground after three seconds. The rock's velocity is 29.4 m/s when it hits the ground. What is its acceleration of the rock in the downward direction? PLS HELP!!! im trying to do this but i forgot how!The ratio of the measures of the three angles is 2:3:7. Find the measure of each angle of the trianglea The angles of the triangle are 20, 30 and 70b The angles of the triangle are 25, 40 and 115c The angles of the triangle are 20, 40 and 120d The angles of the triangle are 30, 45 and 105