Answer: When fossil fuels are burned, they release large amounts of carbon dioxide, a greenhouse gas, into the air. As a result of greenhouse gases, heat is trapped in our atmosphere, resulting in global warming.
Explanation:
Why are enzymes needed by the plants?
Which of the following species is an R-selected species?a.Giant tortoisesb.Mosquitoesc.Elephantsd.Redwoods
Answer:
b. Mosquitoes
Explanation:
Mosquitoes are an R-selected species.
The process that starts with dna and ends with 2 dna is called
Answer:
Vague, but I think you are talking about duplication or mitosis
Explanation:
Mitosis is duplicating DNA to make two geneticly identical daugher cells
Duplications is just unwinding the DNA to make a second copy
Evaluate your understanding with the following question: 4. Which statement best describes cell theory? a. Cells are part of complex organisms that work together to produce new cells. b. Cells perform a single life function, and most cells come from existing cells. c. Cells use energy from food to be able to perform life functions and work together to produce new cells. d. Cells are the basic unit of structure for all organisms, and all cells come from existing cells.
Answer:
d. Cells are the basic unit of structure for all organisms, and all cells come from existing cells.
Cells are the basic unit of structure for all organisms, and all cells come from existing cells.
Describes cell theory?
The cell theory states that all living organisms are composed of cells which are the basic unit of life and all life come from preexisting life. All living organisms are made up of cells i.e. unicellular and multicellular
So we can conclude that option D is the correct answer.
Learn more about cell here: https://brainly.com/question/13123319
#SPJ2
Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3´
The correct mRNA sequence transcribed from the given DNA sequence is: 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' Here option B is the correct answer.
To determine the correct mRNA sequence transcribed from the given DNA sequence, we need to apply the rules of DNA transcription. During transcription, the DNA sequence is used as a template to synthesize an mRNA molecule, with the RNA base uracil (U) substituting for thymine (T) in the DNA.
The given DNA sequence is:
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'
To transcribe this DNA sequence into mRNA, we replace each DNA base with its RNA counterpart:
G (Guanine) → C (Cytosine)
C (Cytosine) → G (Guanine)
A (Adenine) → U (Uracil)
T (Thymine) → A (Adenine)
Applying these conversions, we get the mRNA sequence:
5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'
Therefore, option b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' represents the correct mRNA sequence transcribed from the given DNA sequence.
To learn more about mRNA
https://brainly.com/question/29314591
#SPJ4
Complete question:
Which of the following represents the correct mRNA sequence transcribed from the given DNA sequence?
a) 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'
b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'
c) 5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'
d) 5' GGGATCGATGCCCCTTAAAGAGUUUACAUUAUUGCUGGAGGCGUUAACCCCGGA 3'
Does the Second Amendment need to be "revisited" in 2021? yes and why?
I need help pleasee
Answer:
It needs to be revisited because of the random acts of violence that it enables.
Explanation:
People that have access to weapons of mass destruction use them to kill people for no reason. For example, the sandy hook shooting, the recent Stoneman Douglas shooting, and the Christchurch shooting. All these shootings could have been prevented if there was stronger gun control. If people did not have access to automatic firing machine guns, less people would have died.
* DISCLAIMER *
All ideas expressed in this answer do not necessarily reflect my person views, they are meant for educational purposes, not to spark a debate about the 2nd amendment, do not get offended. (put this in cus some peeps crazy)
If a spinach plant with flat (FF) green (GG) leaves is crossed (pollination and fertilization occur) with another spinach plant with crinkly (ff) purple (gg) leaves, what alleles and traits will the offspring inherit?
Answer:
The offsprings of this cross will inherit the flat (F) and green (G) alleles from the first parent and also the crinkly (f) and purple (g) alleles from the second parent. However, the offsprings will only inherit the flat, green traits.
Explanation:
This question involves two different genes coding for leaf shape and leaf color respectively. The alleles for flat (F) and green (G) leaves are dominant over the alleles for crinkly (f) and purple (g) leaves.
According to this question, If a spinach plant with flat (FF) green (GG) leaves is crossed with another spinach plant with crinkly (ff) purple (gg) leaves, all the offsprings in the F1 generation will possess a FfGg heterozygous genotype.
This genotype means that the F1 offsprings of this cross will inherit the flat (F) and green (G) alleles from the first parent and also the crinkly (f) and purple (g) alleles from the second parent. However, they will only inherit the flat, green traits because they are dominant over the crinkly and purple trait.
The four parts of a seed include all of the following, except _____.
a. seed
b. embryo
c. cotyledon
d. epidermis
e. endosperm
f. coat
The products of photosynthesis that begin cellular respiration are
Answer:
d
Explanation:
The structure of gamma hydroxybutyric acid, or GHB, is fairly close to the inhibitory neurotransmitter _____.
Answer:
y-aminobutyric acid, or GABA
the northern leopard frog, tree frog, and wood frog are all different species of frogs. why is having a scientific name for each species of an organism important for scientists?
Every recognized species on Earth is identified using the two-part binomial nomenclature. They are essential because they allow for interspecies communication on a global scale.
Why is it important for scientists to understand what each species of an organism is known by in science?Scientific names are used to universally designate different types of species so that scientists from all over the world can instantly recognize the same animal.
The use of scientific names, which give organisms a universal name that acts as a code, avoids misunderstanding among numerous countries that may have different common names for them. Scientists from diverse nations can communicate with one another about various organisms by using scientific names.
To know more about scientific names, refer
https://brainly.com/question/9590531
#SPJ4
why did mendel choose pea plants for his research? multiple choice peas are easy to cultivate. pea plants have a short generation time. pea plants are self-pollinating but can be cross-fertilized easily. many true-breeding varieties were available. all of these were important characteristics in mendel's selection.
All of the given choices were important characteristics in Mendel's selection.
Mendel chose pea plants (Pisum sativum) for his research for multiple reasons. Peas are easy to cultivate and have a short generation time, which allowed Mendel to conduct multiple experiments in a short period of time. Pea plants are also self-pollinating but can be easily cross-fertilized, allowing Mendel to control the mating of different varieties.
Additionally, many true-breeding varieties were available, which meant that offspring would display the same traits as their parents. All of these characteristics made pea plants an ideal organism for Mendel to study the principles of inheritance and develop his laws of segregation and independent assortment.
To know more about Mendel's selection, refer here:
https://brainly.com/question/30336899#
#SPJ11
"
Describe the biotic and abiotic components of an urban
ecosystem with suitable examples within 200-250 words.
Abiotic (non-living) and biotic (living) elements that interact in an urban setting make up an urban ecosystem.
The biotic components are -
Humans: Urban ecosystems contain a sizable biotic component in the form of people. Through their involvement in activities like construction, transportation, and trash production, they dwell and influence the urban environment.
Flora: Both native and exotic plant species may be present in urban settings. Parks, street medians, and urban gardens all have trees, bushes, grasses, and floral plants. Oak trees, rose, and turf grasses are a few examples.
Fauna: A variety of animals live in cities and have adapted to the urban environment. Birds like pigeons, sparrows, and crows are examples of common urban fauna. There may also be small mammals like rats, raccoons etc. In urban gardens, insects like bees, butterflies, and ants flourish.
The abiotic components are -
Air: The urban environment has an impact on the ecosystem as an abiotic component. It covers air composition, temperature, humidity, and air quality. Due to emissions from cars, factories, and urban activities, urban areas frequently have greater levels of air pollution.
Water: Urban ecosystems contain a variety of bodies of water, including lakes, rivers, ponds, and man-made water features. These provide as habitats for water animals and plants, including fish and frogs. Water quality can be impacted by urbanisation because runoff carries pollutants from roadways and human activity.
Soil: Although being frequently disturbed and compacted, is essential. It offers a growing environment for plants and sustains creatures like insects and soil microorganisms. The existence of healthier soils in urban contexts is facilitated by the presence of urban gardens and green spaces.
Read more about biotic components on:
https://brainly.com/question/12689972
#SPJ4
What is an example of a control in risk management?
Testing, routine internal audits as well as inspections, and sometimes even your training programme are examples of controls. The risk evaluation will determine the dangers that your business faces and what controls need to be put in place to safeguard your assets.
Avoidance, asset protection, loss reduction, segregation, duplication, & diversity are all examples of risk control techniques. In risk management, controls are defined as "any process, policy, device, practise, or other acts that change risk," according to the ISO 31000 standard. When examining numerous risk registers, "controls" are identified as a variety of items, including: HR guidelines Risk control is a business technique that enables firms to assess prospective losses and take steps to reduce or eliminate such risks. It is an essential component of a risk management process. Personal protective equipment (PPE), extraction systems, decontamination equipment, and ventilation equipment all fall under the category of control equipment. Controlling is a management function that aids in obtaining desired results from employees at all organisational levels, including managers and subordinates.
Learn more about risk
https://brainly.com/question/28625580
#SPJ4
Which of the following is an example of pseudoscience?
A. Electromagnetism
B. Horoscopes
C. Radiometric dating
D. Biology
Does anyone know what is the answer
Answer:
A. The answer is a plate tectonics
Need Help Due in 5 min: Earth Science
Answers:
hurricane
snowstorm
tornado
flooding
Answer: a snowstorm would occur
4.4 Emile did an experiment to compare the rate of respiration in woodlice (small crustaceans) and maggots (the larvae of houseflics). The diagram shows how he set up his experiment. Limewater is a clear liquid. It goes cloudy when carbon dioxide is present. bung test tube gauze platform live maggots limewater A B live woodlice A 6 minutes B 6 minutes C 8 minutes D 9 minutes C a Suggest why Emile used four tubes in his experiment, rather than two. b Describe three variables that Emile needed to keep the same in his experiment. c Emile timed how long it took for the limewater to go cloudy in each tube. These are his results. D Draw a results table, and write in Emile's results. d Write a conclusion that Emile can make from his results. [2] [3] BE [1]
a) Emile used four tubes to compare the rate of respiration in woodlice and maggots for a more accurate and reliable comparison.
b) The three variables Emile needed to keep the same were temperature, amount of limewater, and time.
c) Results Table:
Tube | Time (minutes)
--------------------------
Maggots A | 6
Maggots B | 6
Woodlice A| 8
Woodlice B| 9
d) Emile can conclude that woodlice have a slower rate of respiration than maggots based on the longer time taken for the limewater to go cloudy.
a) Emile used four tubes in his experiment instead of two to have a comparison between woodlice and maggots.
By having multiple tubes for each organism, he can ensure that any differences observed in the rate of respiration are due to the organisms themselves and not variations in the experimental setup or conditions.
b) The three variables that Emile needed to keep the same in his experiment are:
1. Temperature: The temperature should be consistent throughout the experiment as it can affect the rate of respiration.
2. Amount of limewater: Emile needs to ensure that equal amounts of limewater are added to each test tube to maintain consistency.
3. Time: Emile needs to measure the time consistently for each tube to ensure accurate comparison of the rate of respiration.
c) Results Table:
Tube | Time taken for limewater to go cloudy (minutes)
----------------------------------------------------------
Maggots A | 6
Maggots B | 6
Woodlice A | 8
Woodlice B | 9
d) Conclusion: Emile can conclude from his results that woodlice have a slower rate of respiration compared to maggots.
This conclusion is based on the observation that it took woodlice 8 to 9 minutes for the limewater to go cloudy, while maggots only took 6 minutes.
The difference in the time taken suggests that woodlice have a lower production of carbon dioxide, indicating a slower rate of respiration compared to maggots.
For more such questions on Maggots:
https://brainly.com/question/26054054
#SPJ8
streptomycin is a broad-spectrum antibiotic that binds to ribosomes. which bacterial process does streptomycin inhibit?
This substance thereby disrupts the formation of the initiation complex between mRNA and the bacterial ribosome, preventing the start of protein synthesis.
Which microorganisms is streptomycin effective against?A monosubstituted aminocyclitol with a disaccharide connected makes up the pseudotrisaccharide streptomycin. 9–11 Streptomycin, in contrast to penicillin, inhibited both Gram-positive and Gram-negative bacteria as well as Mycobacterium tuberculosis.
Who or what does streptomycin combat?The first aminoglycoside antibiotic, streptomycin, was first isolated from the bacteria Streptomyces griseus. It now primarily functions as a component of a multi-drug regimen used to treat pulmonary tuberculosis. Multiple aerobic gram-negative bacteria are also susceptible to its extra activity.
To know more about streptomycin visit:-
https://brainly.com/question/13252018
#SPJ4
!!NEED HELP ASAP!! DUE IN 23MIN!!
jshbrrbrhendbirnrbhrbf trying to fill up the space so I can send it
Salmonella typhi is a bacteria that reproduces by splitting into two
identical organisms. What type of asexual reproduction is this?
1Binary Fission
2O Vegetative Propagation
3Budding
4Fragmentation
Answer:
Binary fission
Explanation:
Binary fission is a type of asexual reproduction in bacteria in which two identical daughter cells arise from a new cell. It is asexual in the sense that it does not require two parents but only one.
According to this question, Salmonella typhi is a bacteria that reproduces by splitting into two identical organisms. This is evidently a type of BINARY FISSION reproduction by the bacteria cell.
The study of the surface of the body is often called what type of anatomy? a. supine b. surface c. subdural d. superficial
The study of the surface of the body is often called superficial anatomy. Option d is correct.
Superficial anatomy focuses on the external structures and features of the body, such as the skin, muscles, and bones that are visible without the need for dissection or invasive procedures. It involves observing and palpating the body's surface to identify landmarks, muscles, tendons, and other superficial structures.
For example, in superficial anatomy, you might study the bony landmarks on the skull or the superficial muscles of the arm. This type of anatomy is essential for healthcare professionals, such as physical therapists or nurses, to assess patients, locate specific structures, or perform certain procedures.
It provides a foundation for understanding how the body is organized and how its various parts relate to each other. It involves examining the external structures and features of the body without the need for invasive procedures.
Therefore, Option d is correct.
Learn more about anatomy -
brainly.com/question/28289955
#SPJ11
Abundant plant material accumulating in a swampy environment with __________ is required for peat to form.
Abundant plant material accumulating in a swampy environment with low oxygen level is required for peat to form.
It takes a lot of plant material to build up in a swampy environment with low oxygen for peat to form. Peatlands are able to withstand toxic, low-oxygen, high-water, and nutrient-poor conditions.
An area of land that is consistently damp or muddy is called a swampy environment. Even marshes frequently have water covering them. There are two types of swampy environment : freshwater swamps and saltwater swamps. In marshes, trees predominate.
Caddo Lake, the Great Dismal, and Reelfoot are three swamps that are centred on large lakes. swampy environment and bayous are frequently associated in the Southeast of the United States, especially in the Gulf Coast region. A type of marsh known as a baygall can be found in the woodlands of the states around the Gulf Coast.
To learn more about swampy environment please visit
https://brainly.com/question/30290638
#SPJ4
There is/are usually _______ tolerance limit(s) responsible for limiting the number and location of a species. however, some organisms have ____________ that limit(s) their distribution.
There is/are usually one or more tolerance limits responsible for limiting the number and location of a species. However, some organisms have habitat preference(s) that limit(s) their distribution.
In the ecology of species, the tolerance limit refers to the range of physical and chemical factors that an organism can survive and grow in. Physical factors like temperature, rainfall, humidity, soil type, and altitude are the main environmental factors that affect the survival and reproduction of species.Limiting factors are ecological factors that prevent a population from expanding any more.
These include availability of food, shelter, mates, and the presence of predators, disease, and competition with other species. For example, the presence of predators can limit the distribution of some organisms. Predators can kill organisms before they reproduce and occupy new habitats.Habitat preferences are the ecological factors that determine the distribution of a species.
A habitat preference is an ecological niche that a species occupies. It is determined by the physical and chemical factors that the species requires for survival and growth. For example, cacti plants can only survive in arid environments that are not conducive to other plant species. Thus, cacti plants have a limited distribution because they can only grow in specific habitats.
Therefore, it can be concluded that usually, there is/are one or more tolerance limits responsible for limiting the number and location of a species. However, some organisms have habitat preferences that limit their distribution. The habitat preference is determined by the physical and chemical factors required by the species for survival and growth.
Know more about organisms here,
https://brainly.com/question/13278945
#SPJ11
Arthropod' means 'jointed foot'. Which animal is NOT an arthropod?a) a praying mantisb) all of these animals are arthropodsc) a millipeded) a horseshoe crabe) a spider
The correct option is B ; All of these animals are arthropods , Arthropods (/rrpd/, from Ancient Greek o (arthron) 'joint' and (pous) 'foot' (gen. )) are invertebrates with an exoskeleton, segmented bodies, and paired jointed appendages.
Arthropods are classified as members of the phylum Arthropoda. They are distinguished by their jointed limbs and chitin cuticle, which is frequently mineralised with calcium carbonate. The arthropod body plan is made up of segments, each with two appendages.
Arthropods have an external skeleton and are bilaterally symmetrical. To continue growing, they must go through moulting stages, in which they shed their exoskeleton to reveal a new one. Some animals have wings. They are a hugely diverse group, with up to ten million different species.
Learn more about Arthropods
https://brainly.com/question/2244172
#SPJ4
Full Question ;
'Arthropod' means 'jointed foot'. Which animal is NOT an arthropod?
a praying mantis
all of these animals are arthropods
a millipede
a horseshoe crab
a spider
Gregor Mendel experimented on Mango plant to study genetics.
True or false
Answer:
I think false
Explanation:
Im pretty sure he experimented with Pea plants
quantitative in a population of 3400, how many babies would you expect to carry an allele for cystic fibrosis, a homozygous recessive condition, but not be affected by it? assume that the frequency of the dominant allele is 0.8 and the population is at hardy-weinberg equilibrium.
Inside the Caucasian population in the United States, cystic fibrosis is a genetic disorder that affects roughly 1 in 2,500 newborns.
The sum of the alleles is equal to the sum of the people multiplied by two. Because there are two BB genotypes and two Bb genotypes with in small population, 2x2 + 2 = six B alleles. 5 individuals equal a total of 2 x 5 = 10 alleles. The numerator of the heterozygous genome number is equivalent to the allele frequency, according the Hardy-Weinberg principle. 0.7 is the rate of the dominant allele, and q is the percentage of the recessive phenotype in a population. 2 p q 2pq The heterozygous dominant genotype's frequency is 2pq. p 2 p^ The homozygous dominant genotype frequency is 2p2. Inside the Caucasian population in the United States, cystic fibrosis is a genetic disorder that affects roughly 1 in 2,500 newborns. There is a 75% likelihood that any of the offspring of parents who are heterozygous (Ww) will have a queen's peak.
Learn more about cystic fibrosis
https://brainly.com/question/14467649
#SPJ4
In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?
A. 0%
B. 25%
C. 50%
D. 100%
Answer:
i think it may be 50 dont be mad if im wrong
Explanation:
recessive takes over from what i read i dont see any o so it can be half a half b so 50...
which is a fertilized egg attached to the wall of
Embryology is the study of the development of an
the mother's uterus.
the answer would be embryo, its in the name.
Answer:
The uterus.
Explanation:
A fertilized egg (or Zygote) attaches to the wall of the uterus and grows. The cell multiplies again and again to form an embryo. It further develops and grows inside of a placenta.
Please Mark Brainliest!
What are some ways that plants can defend themselves? Give at least two examples and explain how it is a defense system.
The first physical barrier to herbivores feeding on plants is made up of leaf surface wax, thorns and trichomes, cell wall thickness, and lignification. The second barrier is made up of secondary metabolites that function as poisons.
Which two methods do plants use to protect themselves?The first line of defence against infections is the outermost part of a plant, which is comparable to human skin and is additionally referred to as the epidermis. In some plant parts, such as the bark of a tree or the waxy cuticle on leaves, extra layers protect the epidermis itself. Moreover, plants produce substances that are poisonous to insects or pathogens.
How do plants protect themselves?Many flowers have a coating of fine hairs covering the surface on their leaves to deter small predators. Some plants have harsh spines or thorns, whereas others produce leaves which sting or have a sour taste to repel larger animals.
To know more about metabolites visit:
https://brainly.com/question/15094735
#SPJ1