if you want to put a pool in your yard, you must check the _____
Answer:
SLOPE ....
YOU MUST CHECK THE SLOPE Before YOU PUT A POOL
why is local government so important?
here's your answer
Explanation:
The significance of the local self government is that it bestows numerous benefits upon the inhabitants of the areas it operates in. ... The Local Self-government generally unites the people with democracy and encourages them to participate in its activities without any bias or prejudice.
Answer: to provide an organized system where councils exercise their power and responsibilities to work together for peace, order, and good governance of their municipal districts. Local governments provide overall quality of life for the people who reside in their communities!
Explanation:
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
Which of the following actions is illegal for selling alcohol
Answer:
no options
Explanation:
Anthony (29) and Vanessa (31) have lived together for the last couple of years. They are not married and do not present themselves as married. Vanessa's daughter, Sasha (9), lived with them all year. Sasha is not Anthony's daughter.
answer is Vanessa because of her relationship and time Sasha stays with her.
Sasha as a dependent of the Vanessa, She as the stayed with nine years. Sasha as a whole responsibility to Vanessa.
What is married?
The term married refer to the boy and girl are agreed to the relationship as the stay with each as the lifetime. The married to the couple are the agreed with the all the terms and the conditions to the loved with each other.
The Sasha as the daughter of the Vanessa. Vanessa responsibility to tack care her daughter. The Anthony (29) and Vanessa (31) are the relation to each other not the married, Sasha, are also staying with her.
As a result, the Sasha stays with her Vanessa to the whole responsibility.
Learn more about on married, here:
https://brainly.com/question/964414
#SPJ1
Jerry's Market had gross sales of $378,000 in 2019. In 2020 his gross sales increased to
$426,000. What was the percentage increase from 2019 to 2020. Round to the nearest tenth.
Answer:
12.7%
Explanation:
Increase in sales: $426,000 -$378,000 = $48,000
$48,000/$378,000 x 100%= 12.7% increase
In appellate procedures, each party files a(n) _____ that contains a short description of a case, a factual summary, legal points and authorities, and arguments for reversing or affirming a lower court decision
Answer;
Brief
Explanation:
Appellate courts are usually higher courts in charge of reviewing and retrial of cases which had previously been tried by a lower court.
In appellate procedures, each party files a brief that contains a short description of a case, a factual summary, legal points and authorities, and arguments for reversing or affirming a lower court decision. This is then thoroughly scrutinized by the appellate court in order to arrive at the best verdict possible.
Select the correct answer
Harry has been called to be part of a criminal trial as a witness on behalf of the prosecution. The trial concerns first-degree murder. Harry claims
to have seen the defendant, Shawn, near the crime scene. Which type of evidence is this?
OA
real evidence
circumstantial evidence
OC
testimonial evidence
OD
direct evidence
Option (b), As a witness for the prosecution in a criminal trial, Harry has been asked to testify. There is a first-degree murder trial going on. Harry claimed to have seen Shawn, the accused, close to the crime scene. Circumstantial evidence is what this is.
How does circumstantial evidence apply to this situation?In a case involving circumstantial evidence, the evidence must only support the guilt of the accused, and the Court must carefully analyze each and every circumstantial option that is given to it as proof.
A fingerprint discovered at the crime scene is an example of circumstantial evidence, which relies on an inference to connect it to a finding of fact. Direct evidence provides immediate confirmation of a claim's veracity as opposed to indirect evidence or assumptions, which need to be further supported.
Circumstantial evidence is proof of a fact from which the court may infer other facts. If an attack took place there around 6:15 p.m., you may mention in your testimony that you observed the suspect walking down O'Connell Street at that time. In that case, you are offering suppositional evidence to the court.
Learn more about circumstantial evidence: https://brainly.com/question/14263276
#SPJ1
On February 2019, Melinda applies and nominates herself for the prestigious North American Literary Prize. In June 2019, she wins the prize for her academic and literary works. The award comes with a $1,000,000 cash prize that Melinda then donates to the City of Denver. Melinda is not required to take any action after receiving the cash prize. Is Melinda required to include the cash award in Gross Income?
Answer:
Melinda is required to include the cash prize in the Gross Income.
Explanation:
Gross Income is the total payment in cash, goods and services that a person received before tax reductions, that is, it is the general value of everything that a person received in a given period of time, including wages, premiums, real estate, among other things . In this case, we can confirm that the cash prize received by Melinda must be included in her Gross Income, in addition, if she has received a prize with an economic value, she must also include this prize in the Gross Income, even if she has donated .
What does this sign mean?
DETOUR
O Watch for a traffic signal ahead
O Stop and ask for road information
o Watch for a temporary route ahead
how do elections in a single member district differ from elections in states that filed their seats?
Single-member districts are those with only one representative in the legislature. The opposite of single member districts is multi-member districts. Many electoral systems, like runoff voting and range plurality, employ single member districts.
Members of the lower house of parliament of India are chosen from single-member districts, whereas those of the upper house are chosen from multi-member districts. The president of Singapore is chosen from districts with both single and multiple members.
Single-member districts are used to conduct the elections for the State Board of Education's (SBOE) members.
Therefore, every choice relating to public education, including graduation standards and textbook adoptions, will undoubtedly be influenced by Texas voters.
For such more question on Single-member
https://brainly.com/question/26529616
#SPJ4
The exclusionary rule states that Group of answer choices federal law cannot be applied in state courts. the laws of one state court cannot be applied in the courts of another state. evidence obtained illegally is inadmissible in court. state law cannot be applied in federal courts. none of the above.
The exclusionary rule states that evidence obtained illegally is inadmissible in court. Therefore option (C) is the correct answer.
The exclusionary rule is a legal principle that prohibits the use of illegally obtained evidence in a criminal trial. This rule prevents police officers from using evidence that they have collected in violation of an individual's constitutional rights. Therefore, if the court finds that evidence was obtained through illegal means, it will not be allowed to be used during a trial.The exclusionary rule does not prohibit the use of illegally obtained evidence in all circumstances. The rule only applies if the evidence was obtained in a manner that violates a person's constitutional rights.
The exclusionary rule states that evidence obtained illegally is inadmissible in court. This means that if the evidence is collected in violation of a person's constitutional rights, it cannot be used in court against that individual. In summary, the correct option for the question is: Evidence obtained illegally is inadmissible in court. Option (C) is correct answer.
Learn more about exclusionary rule https://brainly.com/question/12239906
#SPJ11
Ned is a registered nurse who gains a certification to identify and interpret injuries for violent causes. Which type of certification has he gained?
A.
CCI
B.
CMI
C.
ACFEI
D.
CFN
E.
ABFA
Answer:
acfel
Explanation:
Answer:
The answer is D
Explanation:
absolutely not
Explain the importance of ballistics in solving crimes.
Answer: Ballistic evidence is used to identify the type of weapon that was used in the commission of a crime and other details of the crime—for example, where the shooter was standing in relation to his or her target.
What is the conclusion of forensic?
The main use of forensic science is for purposes of law enforcement to investigate crimes such as murder, theft, or fraud. Forensic scientists are also involved in investigating accidents such as train or plane crashes to establish if they were accidental or a result of foul play. Therefore it is very important
Explanation:
How have voting requirements changed over the years?
Answer: Over time, voting rights have been extended to more Americans. Voting qualifications based on property ownership, religion, race, and sex have all been eliminated through federal laws and constitutional amendments. The Constitution originally gave the power to decide voter qualifications to the States.
Explanation:
Answer:
Voting requirements have changed over the years in response to social, political, and legal developments. Some of the them could be about age requirements: The minimum age to vote has also changed over time. In the United States, the minimum voting age was originally 21, but it was lowered to 18 by the 26th Amendment in 1971.
Select the correct answer.
Who can propose an amendment to the Constitution?
A a simple majority of Congress
B. the president
с.
the Supreme Court
D.
a two-thirds majority of Congress
Answer:
d
Explanation:
a two-thirds majority of Congress
what is justice means to me?
Answer:
quero justuça mim
Explanation:
acho q assim espero ter ajudado ñ entendo muito de ingles
Answer:
the head of a supreme Court of a country or state
Peremptory challenges:
Question 19 options:
are challenges for cause.
are generally limited in each case.
require specific reasons for use.
require proof of bias or prejudice of the juror.
none of the above
Peremptory challenges are a type of challenge used during the jury selection process. These challenges allow attorneys to dismiss potential jurors without providing a specific reason or proof of bias or prejudice. So, None Of The Above option is appropriate.
Peremptory challenges are a separate category of challenges used during jury selection, distinct from challenges for cause. Peremptory challenges allow attorneys to dismiss potential jurors without providing a specific reason or proof of bias or prejudice. These challenges are typically limited in number in each case, although the specific limit can vary depending on the jurisdiction. While challenges for cause require a specific reason based on bias or prejudice of a juror, peremptory challenges provide attorneys with the opportunity to exercise discretion in selecting jurors they believe will be more favorable to their client's case, without needing to justify their decision with explicit reasons.
To know more about Peremptory challenges
brainly.com/question/32409799
#SPJ11
should chase be able to enforce the waiver clause (under ucc 9-403), prohibiting burning lake tire from raising defenses against chase?
Under UCC 9-403, a party who has waived a right or defense may still assert it if the waiver was not intended to be binding or if the other party had no knowledge of the waiver.
Therefore, whether Chase can enforce the waiver clause prohibiting Burning Lake Tire from raising defenses against Chase will depend on whether Chase's waiver was intended to be binding and whether Burning Lake Tire had knowledge of the waiver.
If Chase's waiver was clearly communicated to Burning Lake Tire and Burning Lake Tire had knowledge of the waiver, then Chase may be able to enforce the waiver clause and prohibit Burning Lake Tire from raising defenses against Chase. However, if Burning Lake Tire did not have knowledge of the waiver or if the waiver was not intended to be binding, then Chase may not be able to enforce the waiver clause.
It is important to consult with a licensed attorney who is familiar with UCC 9-403 and the specific facts and circumstances of your case to determine whether Chase can enforce the waiver clause prohibiting Burning Lake Tire from raising defenses against Chase.
Learn more about UCC visit :brainly.com/question/20235251
#SPJ11
distinguish social behavior and legal behavior for example
Answer:
What is the difference between ethical behavior and legal behavior?
The distinction is important. Actions are 'legal' if they do not violate the laws or codes of the local government, state, or federal government. ... A formally adopted code of ethics is a legal requirement; when you violate a state or local government code of ethics there are specific consequences.
Explanation:
• Projectile are propelled out of a gun barrel due to the contorined
explosion that occurs within a firearm true or false?
It is true that a firearm's internal explosion, which causes projectiles to be launched out of the barrel, causes this. a thing moved by the gasses released by gunpowder that is blazing quickly.
The first known chemical explosion is gunpowder, usually known as "black powder" to distinguish it from smokeless powder used today. Saltpeter is made out of a combination of sulfur, carbon (in the form of charcoal), and potassium nitrate. The saltpeter functions as an oxidant, while the sulfur and carbon serve as fuels.
Gunpowder has long served as a common propellant in firearms, artillery, rocketry, and pyrotechnics, as well as a blasting agent for explosives used in mining, quarrying, building pipelines, and constructing roads.
Learn more about gunpowder from:
brainly.com/question/30521851
#SPJ1
Canada Contractual Law
Valerie wants to splurge on her new she-shed (outdoor female equivalent of a man cave) Although her she-shed did have a lovely wine fridge and a crystal chandelier, something was missing. She hired a landscaping company – Major Tom’s Ground Control to provide a boxwood hedge, an angel stone path leading up to the shed, and several exotic plants and trees. A contract was drawn up which spelled out what Major Tom would do in exchange for $10,000.00. Valerie provided Major Tom with a $5,000.00 deposit to begin the work they had agreed upon. One stipulation in the contract, was that Major Tom would remove all leftover plant material and debris and clean the property before they left.
On the afternoon the landscaping was to be completed, she arrived home from work with her friends ready to begin enjoying the she-shed. The she shed looked lovely. Major Tom was nowhere to be found but they had left behind a hill of dirt, several shovels, a pair of work boots and two empty cases of beer. Valerie was not happy. She called Major Tom and told them that she would not pay the balance of $5000.00 because they had failed to clean the property as indicated by the contract after the work was completed.
What are the legal concepts and laws that are triggered by this scenario? Does she have a case?
Based on the material in Chapter 7, provide a clear and detailed rationale as to what can be done to solve the problem in this scenario.
The legal concepts and laws that are triggered by this scenario are the Breach of Contract and Contractual Remedies. Valerie has a case in this scenario.
What can be done to solve the problem in this scenario is that a demand letter can be sent to Major Tom’s Ground Control company. This letter should indicate that they breached the contract by failing to clean the property after completing the work and that she will not be paying the balance of $5000.00. In addition, Valerie should include that she is willing to pay a fair amount to have another company come in and clean up the property. Finally, she could inform Major Tom’s Ground Control that if they fail to comply with her demands, she will take legal action against them.
It is necessary to note that a demand letter should be sent with registered mail. This ensures that the letter is received by the intended recipient. If the letter is ignored, Valerie may need to file a claim in Small Claims Court. The evidence to support her claim includes the contract, deposit, pictures of the property, the demand letter, and any other correspondence between her and Major Tom's Ground Control.
Learn more about Small Claims Court: https://brainly.com/question/16507110
#SPJ11
You are in a Vehicle Pursuit with a suspect. While in the chase, the primary unit crashes into a pole. You are, however, close to catching a wanted criminal for murder. What do you do?
While starting a police chase, an officer also bears the duty of deciding when to terminate it. It may be determined for him by events or a higher power.
While in the chase, What do you do?
During the quest, this risk vs. return analysis should be ongoing. It's possible that the risks and conditions will change from one second to the next. Constantly reevaluating the situation may help to reduce danger and keep the officer focused and thinking logically rather than emotionally.
The police is relieved from having to take traffic density or congestion into account when a chase starts and continues on a mostly empty roadway. Sadly, chases frequently travel through locations with different levels of traffic congestion. The pursuit might shift from a rural route to the heart of the metropolis, or vice versa. The dynamics of an 80 mph chase on an open motorway differ from those on city surface streets.
To learn more about crime and murder:
https://brainly.com/question/13048126
#SPJ1
the reason the uniform commercial code (ucc) is significant is because it clarifies sales law and makes this area of the law: blank .
The National Conference of Commissioners on Uniform State Laws (NCCUSL) and the American Law Institute (ALI) jointly developed the Uniform Commercial Code (UCC), whose main goal is to ensure that commercial operations are uniform and, consequently, effective, nationwide.
The UCC's goal is to simplify business transactions by removing the formality found in other types of contracts. What happens if the agreement covers both products and services? Contracts for GOODS include goods related to real estate (such as agriculture, minerals, oil, and gas). The Uniform Commercial Code ("UCC") is a body of legislation that establishes legal guidelines for conducting commerce and interactions. Personal property transfers and sales are subject to UCC Uniform Commercial Code regulations. Transactions or finance involving real estate are not covered by the UCC. The Since goods are frequently bought and shipped across state lines, UCC helps to promote uniformity among state laws, which is frequently helpful in commercial sales. When dealing with breach of contract and related civil litigation arising from the sale of goods, the UCC frequently comes into play.
Learn more about Uniform Commercial Code hear :
https://brainly.com/question/18882781
#SPJ4
Which type of insurance would a person most likely purchase if he or she
owns an apartment building and is worried about being sued if someone is
injured there?
Answer: Liability insurance
Explanation:
What is your opinion or belief as to the Electoral College vote process for the Presidential Elections?
Your food preparation area surface needs to contain smooth, nonabsorbent food contact surfaces
Explanation:
if not possible, customer should not pass through food prep area to get to the restroom should be convenient, sanitary ... -be placed on smooth, durable, nonabsorbent surface (asphalt and concrete) -have tight fitting
All surfaces that come into contact with food during production, processing or packaging are considered food contact surfaces. Stainless steel are commonly used, however other materials such as wood, rubber or glass can also be used.
The correct thing is that surfaces that come into contact with food are smooth, non-absorbent and easy to clean.
A smooth, non-absorbent and easy-to-clean surface prevents:-
The proliferation of bacteria. The accumulation of organic particles. The accumulation of dirt. The possibility of causing food infection.To know more about food contact surfaces, refer to the link:
https://brainly.com/question/4491389
Give me the example of custodial arrest about investigation and criminal justice system
Answer:
Explanation:
Lia and Bianca entered into a contract. It was agreed that if Lia will be Bianca’s event coordinator for four weeks, the latter will give Lia the amount of P50,000. Is Lia’s obligation legally enforceable?
.
Officers have been called to the scene of an altercation outside a crowded restaurant. Two men were evidently arguing over a sports event. The argument escalated, with both men throwing punches. By the time officers arrived on the scene, one man was holding his nose, which was profusely bleeding. The other was nursing a quickly blackening eye. Several people loitered around the entrance to the club. After speaking with both men on the scene, officers leave without making an arrest. What is the MOST likely reason for their choice in this situation?
Neither man wanted to press charges.
There were no witnesses to verify the fight.
There was no video camera footage of the fight.
The officers did not see evidence of a crime.
Answer:
Neither man wanted to press charges.
Explanation:
I'll just say why the other answers are wrong
B. There are witnesses, it says that several people were loitering around the club
C. There does not need to be camera footage of the fight to arrest one or both of the men and charge them with assault, battery, etc.
D. The officers arrived after the fight had ended and they had been injured, also officers do not personally have to witness a crime to charge an individual with one.
A motorist should keep at least ___ feet behind a signaling
A motorist should keep at least 100 feet behind a signaling.
Drivers, often known as motorists, must pay attention to pedestrians and avoid using bike lanes.
The term "motorists" is frequently used in news reports when discussing groups of drivers, such as all of the drivers in Chicago's downtown or the rural drivers on two-lane highways.
Motorist is another word for "driver," which initially originated in the late 19th century, around the time the first autos did, and originally meant "motor car driver." Motorists need to be alert of pedestrians and stay out of bike lanes.
The word "motorists" frequently appears in news reports when discussing drivers as a group, such as all the motorists in downtown Chicago.
To know more about the Motorist visit:
https://brainly.com/question/1114291
#SPJ9