which taxonomic rank includes more organisms than a genus, but less than an order?

Answers

Answer 1

A second classification known as a kingdom exists within every domain. Kingdoms are followed by the categories of phylum, class, order, family, genus, and species, which are listed in increasing order of specificity. Figure: Taxonomic classification levels Organisms are more similar between each sublevel of the taxonomic classification system.

Kingdom, phylum or division, class, order, family, genus, and species are the seven main taxonomic ranks. Additionally, despite not being mentioned in any of the nomenclature codes, the Carl Woese-proposed term "domain," which is a synonym for "dominion," is now widely used as a fundamental rank.

Learn more about the Kingdom,

https://brainly.com/question/15026707

#SPJ4,


Related Questions

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Bradford Hill viewpoints or "criteria" for a causal relationship for this specific exposure and disease combination. (2 points each) For the toolhar nresc Al T+F1n rpria nr \( \triangle I T+E M \perp[

Answers

The Bradford Hill viewpoints or criteria can be used to evaluate the causality of an exposure-disease relationship. In brief, Hill’s criteria include strength, consistency, specificity, temporality, biological gradient, plausibility, coherence, experiment, and analogy.

For example, Hill's criteria could be applied to evaluate the association between a history of smoking and lung cancer. It is not necessary to fulfill all the criteria, but it is crucial to consider them when evaluating the association between an exposure and a disease.

Bradford Hill viewpoints or "criteria" for a causal relationship were proposed by the British epidemiologist Sir Austin Bradford Hill in 1965. These criteria provide a framework for evaluating the likelihood of a causal relationship between an exposure and a disease. They are often referred to as Hill’s criteria or Hill’s guidelines. These viewpoints have been widely adopted by epidemiologists as a tool for evaluating the causal relationship between exposure and disease.

According to Hill, there are nine different criteria that should be used when evaluating causality. These are strength, consistency, specificity, temporality, biological gradient, plausibility, coherence, experiment, and analogy. A brief explanation of these criteria is given below:

Strength: The strength of the association between the exposure and disease is one of the most important criteria. If the relationship is strong, then it is more likely to be causal. On the other hand, if the association is weak, it is less likely to be causal.

Consistency: If the same association is observed in different populations, then it is considered consistent. The more consistent the relationship, the more likely it is to be causal.

Specificity: The association between exposure and disease should be specific. A specific relationship implies that the exposure causes only one type of disease and no other.

Temporality: Temporality is the criterion that relates to the sequence of events. The exposure must precede the onset of the disease.

Biological gradient: The existence of a biological gradient is another important criterion. This means that there is a dose-response relationship between the exposure and the disease.

Plusibility: The association between the exposure and the disease should be biologically plausible.

Coherence: Coherence refers to the compatibility of the evidence with the current knowledge of the natural history and biology of the disease.

Experiment: If possible, the exposure should be manipulated to determine whether it causes the disease.

Analogy: Finally, the analogy criterion states that if there is a similar relationship between another exposure and disease, it is more likely that the relationship between the exposure and the disease under investigation is causal.

Bradford Hill viewpoints or "criteria" for a causal relationship are widely used by epidemiologists as a tool for evaluating the causal relationship between exposure and disease. These criteria provide a framework for evaluating the likelihood of a causal relationship between an exposure and a disease.

Hill's criteria include strength, consistency, specificity, temporality, biological gradient, plausibility, coherence, experiment, and analogy. It is not necessary to fulfill all the criteria, but it is crucial to consider them when evaluating the association between an exposure and a disease.

To know more about  lung cancer :

brainly.com/question/4431432

#SPJ11

how come human populations differ from other animal populations

Answers

Answer:

Animal species come in many shapes and sizes, as do the individuals and populations that make up each species. To us, humans might seem to show particularly high levels of morphological variation, but perhaps this perception is simply based on enhanced recognition of individual conspecifics relative to individual heterospecifics. We here more objectively ask how humans compare to other animals ...

Explanation:

With in population, humans show low levels  body height variation in comparison to variation observed in other animal population.

Similarly, human population does not show distinctive levels of body mass variation.

What are the importance of studying human population?

The study of population helps us to understand the process that influence the size, growth, characteristics, and distribution.

Population studies highlight these problems for society, administrators,  political System, economic Planning

The most important terminology which is immensely studied called demography where the study of human population is extremely essential to determine the age, composition.

It is essential to study in every country by analyzing patterns of life expectancy and accurately predict the future.

Demography is important to study, as it characterize the nature population changes over time, such as the aging population

Hence, humans population show low levels  body height variation in comparison to variation observed in other animal population.

Learn more about population, here:

https://brainly.com/question/27991860

#SPJ2

An unknown specimen was grown on Indole media. Based on your observation of this specimen choose the appropriate statements.
A. This test is a part of the IMViC panel of tests
B. The organism tested converts tryptophan to indole.
C. This media is inoculated by stabbing the agar in the tube.
D. This is a picture of a negative test result.
E. This is a picture of a positive test result.
F. The organism tested fermented indole.

Answers

Here are the appropriate statements about an unknown specimen grown on Indole media based on your observation: B. The organism tested converts tryptophan to indole.C. This media is inoculated by stabbing the agar in the tube.E. This is a picture of a positive test result.F. The organism tested fermented indole.

The indole test is used to determine an organism's ability to decompose the amino acid tryptophan into indole. The indole production is detected by adding Kovac's reagent, which contains p-dimethylaminobenzaldehyde, to the medium after incubation.

Tryptophan is an amino acid that is the precursor to indole production in this test. The amino acid tryptophan is a prerequisite for indole production. It is for this reason that organisms that can break down tryptophan into indole are positive.

This is the appropriate response to the student's question:

An unknown specimen was grown on Indole media. Based on your observation of this specimen choose the appropriate statements. B. The organism tested converts tryptophan to indole.C. This media is inoculated by stabbing the agar in the tube.E. This is a picture of a positive test result.F. The organism tested fermented indole.

To know more about specimen refer to-

brainly.com/question/31248655#

#SPJ11

the study of the evolutionary relationships between organisms, which is called , may influence the discipline of identifying and grouping organisms, which is called

Answers

The study of the evolutionary relationships between different organisms which is known as phylogeny might influence the discipline of grouping and identifying organisms which is known as taxonomy.

Phylogeny is can be defined as the evolutionary history of a particular  species or a group. The relationships amongst the organisms can be represented as an evolutionary tree which is known as the phylogenetic tree. In a phylogenetic tree, the species or groups are organized in  a way that it allows us to know how they evolved from the common ancestors.

Taxonomy is a discipline which involves the grouping as well as the identification of different organisms. Phylogeny influences taxonomy as the phylogenetic relationship amongst organisms determines the groups in which they must be classified.

To know more about phylogeny here

https://brainly.com/question/1640611

#SPJ4

Blood flowing through the tissue capillaries picks up carbon dioxide because active tissues, such as skeletal muscle, have a relatively ______ pco2pco2 compared to the blood.

Answers

Blood flowing through tissue capillaries picks up carbon dioxide because active tissues, such as skeletal muscle, have a relatively higher partial pressure of carbon dioxide (PCO2) compared to the blood.

When tissues are active, they require energy in the form of ATP, which is produced through cellular respiration. During this process, carbon dioxide (CO2) is produced as a waste product. The high metabolic activity of active tissues, such as skeletal muscle during exercise, leads to increased production of CO2. As a result, the concentration of CO2 in the interstitial fluid surrounding the active tissues is higher than that in the blood.

Diffusion is the primary mechanism by which gases, including CO2, move across the capillary walls. Due to the concentration gradient, CO2 diffuses from the tissue interstitial fluid into the capillaries. The higher PCO2 in the active tissues drives the movement of CO2 into the blood, where it binds with hemoglobin or dissolves in plasma for transportation back to the lungs for elimination.

This efficient exchange of gases at the capillaries ensures that the tissues receive an adequate oxygen supply and that waste products, such as CO2, are efficiently removed. The relatively higher PCO2 in active tissues compared to the blood allows for the effective uptake of CO2 by the blood, facilitating the removal of metabolic waste and maintaining homeostasis in the body.

Learn more about tissue capillaries here:

https://brainly.com/question/32815145

#SPJ11

When a boatman pushes the shore with the paddle and the shore pushed into the paddle. Is this property called?​

Answers

Answer:

\(this \: is \: an \: example \: for \: newtons \: third \: law \\ for \: everty \: action \: there \: is \: \\ an \: equal \: and \: opposite \: reaction \\ here \: action \: is \: pushing \: of \: water \\ reaction \: is \: moving \: of \: boat \\ thank \: you\)

Why are RNA and DNA called complementary bases ?

Answers

both rna and DNA are part of macromolecules

neurons can have processes as long as 3 feet in the nerves of the leg. explain how this structure relates to the function of nervous tissue.

Answers

Nerve cells are commonly very lengthy and branched in order that it allows the transmission of signals or electrical impulses over all parts of the frame.

Multipolar neurons are defined as having 3 or greater approaches that expand out from the cell frame. They incorporate greater than 99% of the neurons in people and are the important neuron type found in the CNS and the efferent department of the PNS.

The axon of 1 neuron connects to the dendrite of every other to shape a synapse, and that is how nerve indicators are transmitted from one neuron to the subsequent. Axons may be very long, with some human axons extending extra than three toes from the mobile body.

Their feature is to send electric impulses and chemical alerts to and from the mind. maximum neurons have 3 elements, inclusive of a mobile frame, which includes the nucleus and the cytoplasm, an axon, which transmits data far from the nucleus, and dendrites, which receive messages from other neurons.

Learn more about nervous tissue here:-https://brainly.com/question/869589

#SPJ4

Atoms of the same element that differ in the number of neutrons they contain are called

Answers

Answer:

isotopes

Explanation:

Atoms in a chemical element that have different numbers of neutrons than protons and electrons are called isotopes. The atoms in a particular element have an identical number of protons and electrons but can have varying numbers of neutrons.

hope this helps!!!

Which type of wetlands are shrub-filled, watery, coastal, freshwater bogs? a. fens b. marshes c. pocosins d. riparians

Answers

Answer:

The kind of wetland that are shrub-filled,watery,coastal,fresh water bogs are Marshes.

Answer:

Marshes

Explanation:

WILL GIVE BRAINLEST AND WORTH 60 POINTS
Which statement best describes the cycling of carbon between the hydrosphere and geosphere?
Transfer of organic material to lakes and streams by runoff
Precipitation and condensation increasing the groundwater supply
Glaciers melting due to an increase in global climate temperatures
Organisms breaking down nutrients in the soil which helps plants grow

Answers

Answer:

A. Tranfer of organic material to lakes and streams by runoff.

Answer:

Transfer of organic material to lakes and streams b runoff.

Below is the chemical formula for the substance sucrose (Sugar). How
many different elements (types of atoms) make up sugar?*
С6H12O6
Sugar

Answers

Answer:

Sugar is made up of 6 Carbon, 12 Hydrogen, and 6 Oxygen.

So three different elements make up sugar.

Because plants are unable to move as much as animals, on what does their ability to reproduce

depend?
a. Vascular tissue
b. Roots
c. Seeds and spores
d. Leaves

Answers

Answer:

Seeds and spores

Explanation:

Plants are unable to move as much as animals, hence their ability to reproduce depends on seeds and spores.

What do you mean by Reproduction?

Reproduction may be defined as the process of producing offspring with the help of parental gametes.

Vascular tissues are responsible for the transport of minerals and nutrients throughout the plants, leaves perform the process of photosynthesis, and roots provide mechanical strength to the plants.

Therefore, plants are unable to move as much as animals, hence their ability to reproduce depends on seeds and spores.

To learn more about Plants, refer to the link:

https://brainly.com/question/600212

#SPJ2

There are FOUR major events in cell division. Which of the following is NOT one of them? a. DNA Replication b. Cytokinesis, the division of the cytoplasm and separation of the two new cells c. Reproductive signals initiate cell division d. Cell cycle arrest to allow the cells to recuperate e. DNA segregation, which is the distribution of the DNA into the two new daugther cells

Answers

Among the given options, the event that is NOT one of the major events in cell division is d. Cell cycle arrest to allow the cells to recuperate.

The major events in cell division include DNA replication, cytokinesis, reproductive signals initiating cell division, and DNA segregation.

While cell cycle arrest can occur in response to certain conditions, such as DNA damage or lack of essential nutrients, it is not considered one of the fundamental events of cell division.

Cell cycle arrest is a regulatory mechanism that temporarily halts the progression of the cell cycle to ensure proper DNA repair or cellular recovery before continuing with cell division.

To learn more about cell, refer below:

https://brainly.com/question/12129097

#SPJ11

what is an example of an illness or disease that is transmitted by airborne transmission?hivcommon coldtuberculosismrsa

Answers

An example of an illness or disease that is transmitted by airborne transmission is tuberculosis (TB).

TB is a bacterial infection that primarily affects the lungs and is spread through the air when an infected person coughs, sneezes, or talks. Other examples of airborne transmitted diseases include COVID-19, influenza, and measles.
Unlike tuberculosis, HIV and MRSA are not airborne diseases, and the common cold can be transmitted through both airborne and direct contact transmission.

A Mycobacteria, is the infection that causes tuberculosis (TB), which can be treated with particular medications.

Therefore, mycobacterial infections are often sluggish and sneaky, symptoms may not appear for a very long time after infection.

To know more about  Tuberculosis refer here:

https://brainly.com/question/18173152

#SPJ11

A unicellular organism has how many cells?

Answers

Answer:

A unicellular organism has one cell.

Explanation:

A unicellular organism consists of one cell.

The prefix 'uni - ' means one.

A multicellular organism has multiple cells ('multi -').

Hope this helps.

A unicellular organism has only one cell. Unicellular organisms are composed of a single cell that carries out all the functions necessary for their survival.

Unlike multicellular organisms, which are made up of multiple cells organized into tissues, organs, and systems, unicellular organisms are complete and self-sufficient on their own. They are considered the simplest form of life.

The single cell of a unicellular organism contains all the structures and organelles required for essential life processes such as metabolism, reproduction, and response to stimuli. This includes the cell membrane, cytoplasm, genetic material (DNA or RNA), and various organelles like mitochondria, ribosomes, and nucleus (if present). The unicellular organism carries out all its life functions within this single cell.

Examples of unicellular organisms include bacteria, archaea, protozoa, and some types of algae. These organisms can live independently and carry out all necessary functions within their single cell. They can reproduce through cell division, where the parent cell divides into two identical daughter cells.

Overall, the characteristic feature of a unicellular organism is its simplicity, consisting of a single cell that encompasses all the structures and processes required for life.

To learn more about unicellular organisms, here

https://brainly.com/question/15299967

#SPJ6

How are the algae cells different from the other cells?

Answers

Hello there, Jaelyn!

Although algae and plants are both photosynthetic and categorized as eukaryotes (cells with unique features such as the nucleus), they vary in the following ways: Algae can be unicellular or multicellular, whereas plants contain numerous cells.

Have an amazing day!

-William

In most algal cells there is only a single nucleus althrough some cells are multinucleate. Some algae are siphonaceous, meaning the many nuclei are not separated by cell walls.

Match the given symbol or molecular formula to the term that best describes it.
SO2
K
Cl2
C6H6
element

organic compound

inorganic elemental molecule

inorganic compound

Answers

Answer:

SO2 ==> inorganic compound

Cl2 ==> inorganic elemental molecule

C6H6 ==> organic compound

Explanation:

k=element

SO2=inorganic compound

cl2=inorganic elemental molecule

C6H6=organic compound is your answer.

happy new year (:

Construct an argument. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

I believe its ethical to artificially select traits in plants.

Explanation:

This is my opinion

Answer:

I believe its ethical to artificially select traits in plants.

Explanation:

my opinion

how can muscle and nervous tissue be used in postmortem analysis?

Answers

Answer:

by checking if the muscles are injured

In the Northern Hemisphere, climate scientists observe seasonal changes in carbon dioxide concentration with the highest levels measured in May and the lowest levels measured in October. Hypothesize how photosynthesis can affect these changes. Explain your answer in three to five sentences

Answers

A plausible hypothesis associated with seasonal changes in carbon dioxide concentration being the highest levels measured in May and the lowest levels measured in October is that the rate of photosynthesis will be higher in May because carbon dioxide is a reactant.

What is the rate of photosynthesis?

The rate of photosynthesis refers to the amount of photosynthetic products that are generated in a given unit of time, which are generally measured as units of biomass both for plants and algae.

The rate of photosynthesis depends on the presence of reactants for this process which includes sun light and also carbon dioxide, which is a fundamental substance in order to produce carbohydrates during this process.

Therefore, with this data, we can see that carbon dioxide is a reactant of photosynthesis and therefore its concentration is fundamental to carry out this process.

Learn more about carbon dioxide in photosynthesis here:

https://brainly.com/question/303300

#SPJ1

How is your body temperature held constant?​

Answers

 The elasticity of those capillaries plays a central role in our ability to maintain constant body temperatures. When there's too much heat in the body, our capillaries automatically expand and increase the blood flow to the skin, allowing the excess heat to transfer to the air.

this is one of the first muscles to atrophy post knee immobilization question 9 options: vastus lateralis vastus medialis oblique rectus femoris vastus medialis vastus intermedius

Answers

The vastus medialis is one of the first muscles to atrophy following knee immobilization.

When a knee is immobilized, such as in the case of prolonged bed rest or post-surgery recovery, the muscles surrounding the knee joint can experience disuse and undergo atrophy. Atrophy refers to the decrease in muscle size and strength due to inactivity or reduced use. Among the options provided, the vastus medialis is identified as one of the muscles that tend to atrophy early on during knee immobilization.

The vastus medialis is one of the four muscles that make up the quadriceps muscle group in the front of the thigh. It lies on the inner side of the thigh, closer to the midline of the body. This muscle plays a crucial role in knee extension and stabilization. During knee immobilization, the lack of movement and functional stress on the quadriceps muscles can lead to muscle wasting.

The reason the vastus medialis is prone to atrophy early on is due to its anatomical location. Compared to the other quadriceps muscles, such as the vastus lateralis and vastus intermedius, the vastus medialis has a smaller cross-sectional area and is more susceptible to disuse-induced muscle loss. Additionally, the vastus medialis may experience a greater reduction in neural activation during immobilization, further contributing to its atrophy.

It is important to note that while the vastus medialis is highlighted as one of the first muscles to atrophy post-knee immobilization, other muscles in the quadriceps group, such as the vastus lateralis and rectus femoris, can also experience varying degrees of atrophy. The extent and speed of atrophy may differ depending on individual factors, the duration of immobilization, and the specific conditions of immobilization. Rehabilitation exercises and physical therapy are typically employed to minimize muscle atrophy and regain strength and function in the knee joint following immobilization.

To know more about knee immobilization click here:

https://brainly.com/question/13403298

#SPJ11

which of the following best describes why secondary succession generally occurs more quickly than primary succession? responses secondary succession is not hindered by the presence of any existing vegetation, but primary succession is. secondary succession is not hindered by the presence of any existing vegetation, but primary succession is. secondary succession takes place in areas that already have soil and nutrients in place, whereas primary succession occurs in areas that lack soil. secondary succession takes place in areas that already have soil and nutrients in place, whereas primary succession occurs in areas that lack soil. secondary succession includes the return of plants and animal species, whereas primary succession includes only the return of plants. secondary succession includes the return of plants and animal species, whereas primary succession includes only the return of plants. secondary succession requires pioneer species, including lichen and mosses, in the earliest stages, but primary succession does not.

Answers

Secondary succession generally occurs more quickly than primary succession because it takes place in areas that already have soil and nutrients in place, whereas primary succession occurs in areas that lack soil. The Correct option is B

In primary succession, the area is barren and devoid of soil, so the process of soil formation must occur before plant growth can begin. In contrast, secondary succession occurs in areas where the soil has already been formed, but has been disturbed or damaged, allowing for rapid recolonization by plants and animals.

Additionally, secondary succession includes the return of both plants and animals, which can accelerate the recovery process by dispersing seeds and nutrients, whereas primary succession includes only the return of plants.

Learn more about Secondary succession

https://brainly.com/question/29788937

#SPJ4

Complete question:

Which of the following best describes why secondary succession generally occurs more quickly than primary succession? Select the most appropriate response from the following options:

A. Secondary succession is not hindered by the presence of any existing vegetation, but primary succession is.

B. Secondary succession takes place in areas that already have soil and nutrients in place, whereas primary succession occurs in areas that lack soil.

C. Secondary succession includes the return of plants and animal species, whereas primary succession includes only the return of plants.

D. Secondary succession requires pioneer species, including lichen and mosses, in the earliest stages, but primary succession does not.

Chemical and Waste Management:
Discuss the packaging of regulated waste for transport.
(Dental Assistant Related Chapter 23)

Answers

Answer:

los  cupoo

Explanation:

kk

List four characteristics of plants.

Answers

Answer:

1. Plants produce their own food.

2. Plant cells have a cell wall.

3. Plants reproduce with spores and sex cells.

4. Plants have a vascular system.

Explanation:

Here is four characteristics plants have.

Plants produce food through photosynthesis so I included that here.

Hope this is correct, have a great day.

Catabolism of food molecules involves ________. group of answer choices glycogenesis dehydration reactions synthesis reactions hydrolysis reactions

Answers

Catabolism of food molecules involves Hydrolysis reaction. It is the chemical bonds,its water breaks one or more chemical bonds.The cleavage of bio-molecules where a water molecule is consumed into component parts.

Hydrolysis reaction break the covalent bonds by consuming a water molecules and dividing its atoms between separate molecules these reactions are catabolic . It gives out energy and its exergonic. In this reaction large molecules are broken down into smaller ones.

There are some examples such as reverse of the condensation reactions described above. The process that dissolve a piece of bread into simple nutrients your body can use like glucose.

To learn more Catabolism here

https://brainly.com/question/28060160

#SPJ4

how to make a plant cell model using recycled materials

Answers

The following is a step-by-step guide to making a plant cell model using recycled materials.
Materials required: Large Styrofoam ball , Recycled plastic container , Recycled cardboard,Green and brown paint,Glue, Scissors, Marker

Making a plant cell model is a fun and easy way to learn more about the different parts of a plant cell. The materials that are required are readily available in any household.

The following is a step-by-step guide to making a plant cell model using recycled materials.
Materials required:
- Large Styrofoam ball
- Recycled plastic container
- Recycled cardboard
- Green and brown paint
- Glue
- Scissors
- Marker
Instructions:
1. Start by painting the Styrofoam ball with green paint to create the cell membrane of the plant cell.
2. Allow the paint to dry completely before continuing.
3. Cut the recycled plastic container into small pieces and paint them brown. These will represent the cell wall of the plant cell.
4. Glue the brown pieces around the outside of the Styrofoam ball to create the cell wall.
5. Cut out different shapes from recycled cardboard to create the different organelles of the plant cell.
6. Paint the organelles different colors. For example, the nucleus could be painted blue, the mitochondria could be painted red, and the chloroplasts could be painted green.
7. Once the paint has dried, glue the different organelles onto the inside of the cell membrane.
8. Use a marker to label the different organelles to help identify them.

By following these steps, you can create a plant cell model using recycled materials. This project is a great way to learn more about the different parts of a plant cell and how they function.

To know more about model visit;

brainly.com/question/32196451

#SPJ11

What is the relationship between the temperature of a star and its color?

Answers

The surface temperature of a star determines the colour of light it emits. The more temperature the more colour.
Other Questions
draw the lewis structure for bcl3 in the marvin window below and then decide if the molecule is polar or nonpolar. which of the following melodic features is used in the treble clef in measures 45 and 46 ? PLLLLEEEEASSEEE OKAY GUYS I NEED HELP... I need to write a story about the future, I have an idea but don't know how to start the story so I need an attention-grabbing/good story starter. The story is about a guy who drives to Chicago from California as he almost gets to his destination he thinks he is about to get into a car crash except he goes/glitches through a car because he is now invisible as he is now in the future where his future self is already there with kids a wife, house etc. When he gets to Chicago its actually two years ahead but he doesn't know how, he is invisible to everyone he cant change anything. He tries to make it back to two years ago but barely find a way until he finds a loophole Part I: Identify which group of words are a fragment, Ind. clause, phrase, and Dep. clause.a. Onto the stage in the moon's bright lightb. When she slapped my facec. Caught me in a big lie and dumped me on the spot.d.She held my hand. on the last day of its session, congress passes a law that the president strongly opposes. which of the following may the president do to limit the power of congress? choose 1 answer: choose 1 answer: (choice a) a neither sign nor veto the bill, allowing it to die (choice b) b refuse to allocate tax money to fund the law (choice c) c persuade members of congress to vote against the law (choice d) d declare the law unconstitutional, thereby killing it A(n) is the area of separation where a firm performs better than anyone else in the market that it serves. What do you write in a mailing letter? The unemployment rate is calculated as (A) the number of people not working divided by the population (B) the number of people not working divided by the number of people working both full-time and part-time (C) the number of people working part-time but actively seeking full-time employment divided by the number of people in the labor force (D) the number of people not working but actively seeking employment divided by the number of people in the labor force (E) the number of people in the labor force divided by the population Please can I have help I will give 100 points and mark brainliest Exercise 1 Add commas where necessary. Delete unnecessary commas. Some sentences may be correct.The little, brown house on Adams Street is for sale again. A function f(x)= 3^x is transformed into the function g(x)= 2^3x-4+5Name the transformations that occurred to the parent cube root function. Film directors at Pixar use daily _____ with their animation teams to review progress and to make sure that the film stays on budget and on schedule. in using educational level as an initial selection criterion, which of the following statements is false? which statement regarding viral species is true? which statement regarding viral species is true? viral species are taxonomically differentiated based upon their cell wall. viral species are classified within the kingdom plantae in the domain eukarya. viruses are classified as prokaryotes. viral species are not classified as part of any of the three domains. please help.. pleaseeee protocol within the tcp/ip suite which translates a fully qualified domain name that identifies a computer or server on the network into an ip address if at least one child in a family with 2 children is a boy, what is the probability that both children are boys? Which type of test tries to measure how truthful and trustworthy a candidate is likely to be? What are some medical reasons a doctor would write on a doctors note that would allow a kid to stay home from school for a week? What type of photography is most likely to be seen on websites and in advertising? Stock photography Artistic photography Forensic photography Time-lapse photography