Which statement is MOST likely the explanation of why certain animals are able to adapt to changing environments?

Which Statement Is MOST Likely The Explanation Of Why Certain Animals Are Able To Adapt To Changing Environments?

Answers

Answer 1

Answer: D . some species react by mutating

Explanation:

"traits that can be passed down allow organisms to adapt to the environment better than other organisms of the same species. This enables better survival and reproduction compared with other members of the species, leading to evolution."-Adaptation | National Geographic Society

Answer 2

Certain animals are able to adapt to changing environments because some species have greater variation in their genetic makeup. Therefore, option A  is correct.

What is adaptation?

Adaptation refers to the process by which organisms change over time to better suit their environment and increase their chances of survival and reproduction. Adaptations can take many forms, including changes in behavior, physical characteristics, or internal processes.

Adaptation is an important concept in evolutionary biology, as it is a key mechanism by which organisms become better adapted to their environment over time.

Certain animals are able to adapt to changing environments because some species have greater variation in their genetic makeup. Therefore, option A  is correct.

Learn more about adaptation, here:

https://brainly.com/question/28881538

#SPJ3


Related Questions

Which example is a body fossil?
dinosaur footprint


shrimp burrow


fossilized animal droppings


wooly mammoth tusk

Answers

Answer:

D. wooly mammoth tusk

Explanation:

i took the test

Answer: wooly mammoth tusk

Explanation: took da test

Does Pterocaulon Plystachyum affect cell division?

Answers

Answer:

polystachyum infusions produced the greatest inhibition of onion root-tip cell division and decreased mitotic index but there was no statistically significant intra or interpopulational variability for the P. polystachyum populations from different sites in regard to their cytotoxic effects.

1. A rock has a mass of 15 grams and a volume of 5 cm? What is the density of the rock
D=
M=
V=

Answers

Answer:

D= 3

M= 15

V=5

Explanation:

D=m/v

D= 15/5

D=3

what organelle stores water in the plant cell

Answers

Answer: Vacuoles

Explanation:

Answer:

Vacuoles

Explanation:

A vacuole is the storage area of the cell. Vacuoles store water, food, and waste.~hope this helps, Have a good rest of your weekend ! :)

Why do people sleep at night?

Answers

Answer:They sleep to get rest and when they’re tired. If they do not sleep enough they will not be active in the morning

Explanation:

Hope that helps :D

We close our eyes and escape reality.

Which of the following statements about a controlled experiment is accurate?

Answers

Answer: There is no following statements. But a controlled experiment is a scientific test that is directly manipulated by a scientist, in order to test a single variable at a time. The variable being tested is the independent variable, and is adjusted to see the effects on the system being studied.

What type of research study is best for placing objects into categories?

What type of research study is best for placing objects into categories?

Answers

answer is going to be: comparison

Look at the graph below.

A graph is shown with Absolute Brightness shown on y axis and Surface temperature in degree Celsius shown on x axis. The Dwarf stars are shown along a slanting line from coordinates 30,000 and minus 3 to 10,000 and minus 4. The Main Sequence stars are shown along a slanting line from coordinates 20,000 and minus 2 to 2,000 and minus 6. The giants are shown along a line parallel to the x axis from coordinates 5,000 and 2 to 2,000 and 3. The supergiants are shown along a line parallel to the x axis from coordinates 7,500 and 4 to 2,500 and 4. Point A has coordinates 20,000 and minus 4. Point B has coordinates 2,500 and minus 4. Point C has coordinates 5,000 and 2. Point D has coordinates 7,000 and 4.

Which of the following stars is most likely to be blue?

Star A
Star B
Star C
Star D

Answers

The most likely to be blue is  (a) Star A

This is because the position of Star A on the graph falls within the range of temperatures and brightness associated with main sequence stars, which are typically hotter and brighter than other types of stars. Additionally, the location of Star A on the graph suggests that it has a high surface temperature and a relatively low absolute brightness, which is consistent with the characteristics of blue stars.

Stars B, C, and D are not as likely to be blue because their positions on the graph fall outside the temperature and brightness ranges typically associated with blue stars. Star B is a red supergiant, which are typically cool and very bright, while stars C and D are giants and supergiants, respectively, which are cooler and brighter than main sequence stars.

Therefore, the correct option is (a) Star A

To learn more about  absolute brightness here

https://brainly.com/question/21520939

#SPJ1

help please!
attached shows a pic of one single DNA strand, can you please show how to convert that one strand to an RNA strand, and then show how to find the "start and stop" codon in the sequence, and then from the start location, separate the codons into 3's until it hits the "stop" codon!
please show in python!

Answers

To convert a single DNA strand to an RNA strand, replace all thymines (T) with uracils (U). The process is known as transcription. In this process, the start codon is AUG and the stop codons are UAA, UAG, and UGA. To find the codon sequence, we start counting from the start codon until we reach one of the three stop codons.

The given sequence of the single DNA strand is: ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA We can write a python code to convert a DNA strand into an RNA strand. Here is the code:```
def dna_to_rna(strand):
   return strand.replace('T', 'U')

dna_strand = "ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA"
rna_strand = dna_to_rna(dna_strand)
print(rna_strand)```
Output:```
AUGCUAACUCGCGCGACCGAGCCUUGGGAAAUUUAGA```Now, let's find the start and stop codons and separate the sequence into codons of three bases each:```
# Finding start and stop codons
start_codon = 'AUG'
stop_codons = ['UAA', 'UAG', 'UGA']

start_index = dna_strand.find(start_codon)
for stop_codon in stop_codons:
   stop_index = dna_strand.find(stop_codon)
   if stop_index != -1:
       break

# Extracting the sequence between start and stop codons
codon_sequence = dna_strand[start_index:stop_index+3]
print(codon_sequence)

# Separating into codons of three bases each
codons = [codon_sequence[i:i+3] for i in range(0, len(codon_sequence), 3)]
print(codons)```Output:```
ATGCTAACTCGCGCGACCGAGCCT
['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT']```As we can see, the start codon is ATG and the stop codon is TAA. The codon sequence is ATGCTAACTCGCGCGACCGAGCCT, and when separated into codons of three bases each, we get ['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT'].

To know more about thymine visit:

https://brainly.com/question/30645074

#SPJ11

not sure i got this right, help?

not sure i got this right, help?

Answers

Answer:

That should be good!

Explanation:

How do mosses and ferns reproduce?
A. With seeds
B. With cones
C. With spores
D. With flowers

Answers

Answer:

I believe it is spores

Explanation:

Answer:

spores

Explanation:

What is the cell cycle?
A) the time a cell spends actively dividing
B) repeating series of stages a dividing cell goes through
C) repeating process of DNA synthesis
D) process of duplication of genetic material

Answers

Answer: B

Explanation: The cell cycle is a series of events that takes place in a cell that grows and divides. So this means that the cell cycle is described in the different ways that it breaks down and builds up all cells.

Answer:

B. repeating series of stages a dividing cell goes through

Explanation:

I took the test

I really need help I'm about to fail biology. I included the background story and question.

I really need help I'm about to fail biology. I included the background story and question.
I really need help I'm about to fail biology. I included the background story and question.

Answers

Frequency of tuskless elephants in females: 78/260 = 0.3 (30%), Frequency of tuskless elephants in males: 27/270 = 0.1 (10%) and Overall frequency of tuskless elephants: (78+27)/530 = 0.2 (20%).

What is Frequency?

Frequency is a measure of how often a periodic event occurs in a given period of time. It is typically measured in hertz (Hz), which is the number of occurrences of a repeating event per second. Frequency is an important concept in physics, engineering, and many other fields of study. Frequency can also be used to describe the rate at which a signal or waveform is changing over time. In audio applications, this is often referred to as the pitch of a sound. Frequency can also be used to describe the rate of a periodic process or system, such as a heartbeat or a vibrating string.

To learn more about Frequency
https://brainly.com/question/30264293
#SPJ1

what do we store glucose as?

Answers

Answer:

sugar

Explanation:

What are the medical uses of hormones? ​

Answers

The answer is:

Hormone therapy is used to treat cancers that use hormones to grow, such as some prostate and breast cancers. Hormone therapy is a cancer treatment that slows or stops the growth of cancer that uses hormones to grow. Hormone therapy is also called hormonal therapy, hormone treatment, or endocrine therapy

culate the mean, median and mode for the following data: *
0, 27,48,69,90, 80, 50, 50, 45
10 points

Answers

Answer:

mean:59

mode:50

median 90

Explanation:

mean:add all numbers together and divide it by how many there are

0+27+48+69+90+80+50+50+45=459

459÷9=59

mode:number that appears most

median:middle number(pur the numbers in order and find the midle number)

the two ""sister"" chromatids are joined at a constricted region of the chromosome called

Answers

The two "sister" chromatids are joined at a constricted region of the chromosome called the centromere.

The centromere holds the two chromatids together during cell division and ensures that each daughter cell receives a complete set of chromosomes. In other words, the centromere serves as a point of attachment for the spindle fibers that pull the chromatids apart during mitosis.

The centromere can be defined as a specific region of the chromosome where the two sister chromatids are joined together and is responsible for the segregation of the chromatids during cell division. It is typically composed of highly repetitive DNA sequences that are essential for the proper functioning of the centromere. The centromere is also important for the attachment of the spindle fibers during the anaphase of cell division, allowing for the controlled separation of the two sister chromatids.

Learn more about centromere at :https://brainly.com/question/19339239

#SPJ4

please help for my science work its due pretty soon

please help for my science work its due pretty soon

Answers

A. The speed of light in water is 2.3×10⁸ m/s

B. The speed of light in ruby is 1.7×10⁸ m/s

C. The index of refraction is 1.63. The material is carbon disulphide

A. How do I determine the speed in water?

The speed of light in water can be obtained as shown below:

Speed of light in vacuum (c) = 3×10⁸ m/sIndex of refraction of water (n) = 1.33Speed of light in water (v) =?

n = c / v

1.33 = 3×10⁸ / v

Cross multiply

1.33 × v = 3×10⁸

Divide both sides by 1.33

v = 3×10⁸ / 1.33

v = 2.3×10⁸ m/s

B. How do I determine the speed in ruby?

The speed of light in ruby can be obtained as shown below:

Speed of light in vacuum (c) = 3×10⁸ m/sIndex of refraction of water (n) = 1.76Speed of light in ruby (v) =?

n = c / v

1.76 = 3×10⁸ / v

Cross multiply

1.76 × v = 3×10⁸

Divide both sides by 1.76

v = 3×10⁸ / 1.76

v = 1.7×10⁸ m/s

C. How do I determine the refractive index?

The rafractive index can be obtained as follow:

Speed of light in substance (v) = 1.84×10⁸Speed of light in vacuum (c) = 3×10⁸ m/sIndex of refraction (n) =?

n = c / v

n = 3×10⁸ / 1.84×10⁸

n = 1.63

Thus, the material with refractive index of 1.63 is carbon disulphide

Learn more about speed:

https://brainly.com/question/1861559

#SPJ1

Plenty of food, water and suitable temperature are the conditions required for the growth of fungi. Is it true or false?

Answers

True

Explanation:

Some species of fungi do grow better at warm temperatures (70-90°F), but there are some that thrive in very high temperatures of 130-150°F and some that will thrive in very low temperatures below 32°F (below freezing). ... Water: Fungi need lots of water to grow. For most fungi this is true. :)

What is the main job of the digestive system?

Answers

the main job of the digestive system is to turn the food you eat into the nutrients and energy. the nutrients and energy made from the food u eat helps you to survive. your body also uses these nutrients for growth and repair

The main job of the digestive system is to turn food (that you’ve ate) into nutrients and energy you need to survive. Then turn it to solid waste, or stool, for disposal when you have a bowel movement.

3, Describe an example of mutualism with which you are familiar, and that isn't explained in this book.

Answers

Answer: An example of mutualism would be the remora fish and shark.

Explanation: The shark gets cleaned and the remora fish gets something to eat. Both benefit from each other.



2. ATP generally energizes a cellular process by

a. Releasing heat upon hydrolysis.

b. Acting as a catalyst.

c. Coupling free energy released by ATP hydrolysis to free energy needed by other

reactions.

d. Breaking a high-energy bond.

e. Binding directly to the substrate(s) of the enzyme.

Answers

According to the research, the correct answer is Option C. ATP generally energizes a cellular process by coupling free energy released by ATP hydrolysis to free energy needed by other reactions.

What is ATP?

It is a nucleotide that is essential for cells to obtain energy through an energy transfer process known as phosphorylation.

In this sense, the release of energy generally develops in a controlled manner where part of said energy is incorporated into ATP molecules that, thanks to this process, can be used in endothermic processes such as anabolism (the maintenance and development of the organism).

Therefore, we can conclude that according to the research, the ATP is hydrolyzed whose energy that is released serves to fuel the endergonic reactions.

Learn more about ATP here: https://brainly.com/question/11494832

#SPJ1

how has the medium ground finch population changed afte rthe drought

Answers

The medium ground finch population experienced significant changes after the drought. Due to the scarcity of water and food, natural selection played a crucial role in the survival of these finches.

The drought led to a reduction in small seeds, which are the primary food source for medium ground finches. As a result, larger seeds became more prevalent, favoring finches with larger beaks capable of cracking them open.

Consequently, the finch population experienced directional selection, with individuals possessing larger beaks having a higher survival rate and reproductive success. Over time, this led to a shift in the average beak size of the medium ground finch population, making them better adapted to the available food resources.

The observed changes in the finch population after the drought demonstrate the impact of environmental factors on natural selection and the adaptive nature of species in response to challenging conditions.

To know more about finches click here:

https://brainly.com/question/31855915

#SPJ11

Find all of the plural or possessive errors. Select each one and type it correctly.
Mooses' fur grows darker as they grow older. While mature moose have dark,
brown coats, calves have light brown fur.

Answers

Answer: Moose's fur grows darker as they grow older. While mature moose have dark, brown coats, calves have light brown fur.

Explanation:

In the original sentence, "mooses" is the plural form of "moose," but it is not a correct plural form. The correct plural form of "moose" is "moose." The possessive form of "moose" is "moose's." Therefore, the correct sentence should be "Moose's fur grows darker as they grow older. While mature moose have dark, brown coats, calves have light brown fur."

where is earth's most carbon located?

Answers

Answer: On Earth, most carbon is stored in rocks and sediments, while the rest is located in the ocean, atmosphere, and in living organisms. These are the reservoirs, or sinks, through which carbon cycles.

Explanation:

Answer:

rocks, sediments

Explanation:

Which of the following outcomes is a benefit of conventional agriculture?
A.Overuse of monoculture
B. Inexpensive food
C.Overly irrigated soil
D. Heavy fertilizer use

Answers

The benefit of conventional agriculture among the options provided is B. Inexpensive food.

Conventional agriculture refers to the mainstream farming practices that involve the use of synthetic fertilizers, pesticides, and mechanized equipment. While it has its drawbacks, such as potential environmental impacts, there are also benefits associated with this approach. One significant advantage of conventional agriculture is the production of inexpensive food. The large-scale production methods and efficient techniques employed in conventional farming help to meet the high demand for food in a cost-effective manner. By using mechanization and modern technologies, conventional farmers can achieve higher yields and lower production costs, which can translate into more affordable food prices for consumers. The ability to provide affordable food is crucial in ensuring food security and access to nutrition for a large population. It allows people with limited financial resources to meet their dietary needs and contributes to reducing hunger and malnutrition. Sustainable farming practices that minimize environmental harm while still ensuring affordable food production are increasingly being explored and adopted as alternatives to conventional agriculture. The correct answer in option B Inexpensive food.
for more questions on agriculture
https://brainly.com/question/30176912
#SPJ8

Neomyxine biplinicata is an eel-like hagfish. When they sense a threat, they excrete a substance from their pores that turns into a jelly-like fluid when mixed with water. This jelly like fluid can either trap predators or clog their gills. Which two systems alert the hagfish to danger and help produce the slime that defense?​

Answers

Neomyxine biniplicata is an endemic hagfish from the east coast of New Zealand. This species produces holocrine secretions by the slime glands and merocrine secretions by the epidermis.

The systems that alert the hagfish to danger and help produce the slime that it uses as a defense are INTEGUMENTARY and NERVOUS SYSTEMS.

Neomyxine biniplicata (slender hagfish) is well-known to release slime that expands into the surrounding water in response to predator attacks.

In response to threat, the nervous system of the slender hagfish stimulates an increase in the secretion of slime.

The hagfish produces holocrine secretions by the slime glands and merocrine secretions by the epidermis.

Learn more in:

https://brainly.com/question/5575860?referrer=searchResults

Examine the food web below. Which organisms in the food web are primary consumers

Answers

The organisms in the food web that are primary consumers are the grasshopper, caterpillar, and deer.

What is the role of primary consumers in a food web?

Primary consumers are organisms that eat producers (plants) and are the first level of consumers in a food web. They play an important role in transferring energy from the sun to the rest of the ecosystem.

What is the difference between a primary consumer and a secondary consumer?

Primary consumers are organisms that eat producers, while secondary consumers are organisms that eat primary consumers. In other words, secondary consumers are one level higher in the food chain than primary consumers.

Learn more about food web here:

https://brainly.com/question/18816028

#SPJ1

Hydropathy plots can be used to predict ... extracellular fibrous proteins isoelectric points of proteins integral membrane proteins open reading frames in DNA

Answers

Hydropathy plots can be used to predict the location of proteins in the cell membrane. Hydropathy plots are a graphical representation of the hydrophobicity/hydrophilicity profile of a protein sequence.

Proteins, especially integral membrane proteins, have a unique sequence that determines their location within the cell membrane. These hydropathy plots assist in identifying the hydrophobicity of the protein at different regions of the amino acid sequence.

Hydropathy plots can predict whether a protein will have a transmembrane domain, which is important for integral membrane proteins.

The hydropathy index is used to measure the hydrophobicity of amino acids. By analyzing the hydropathy index, it is possible to identify transmembrane domains and amphipathic regions in proteins. Hydrophobic amino acids tend to be located within the membrane and can be used to predict the location of a protein.

Hydropathy plots can be generated using various software packages and tools, such as the Kyte-Doolittle hydropathy plot.

To know more about Hydropathy visit;

brainly.com/question/32014995

#SPJ11

Which step in photosynthesis does not need light

Answers

Answer: carbon fixation phase

Explanation:

Other Questions
Compressing a file is also called _____ the file. where qs is the quantity supplied of the good, p is the price of the good, pi is the price of an input, and f is the number of firms producing the good. if pi If the price of flu shots is $10 and 10,000 of them are purchased, how many will consumers buy if the price moves to $20 and elasticity of demand is -0.25? (You may assume constant elasticity of demand.) What type of forces must be overcome within the solid I2 when I2 dissolves in methanol, CH3OH? What type of forces must be disrupted between CH3OH molecules when I2 dissolves? What type of forces exist between I2 and CH3OH molecules in solution? what did the constitution replace as our governing document in the united states? At a minimum, to create an effective topic cluster, you need to link __________. The ratio of dogs to cats in a veterinarians office is 9:7. What is the ratio of the number of dogs to the total number of dogs and cats in the veterinarians office?7:117:169:119:16 Who is considered the founder of Romanticism in French literature? what action must a mechanic take if the aircraft being inspected on a 100-hour inspection fails because of an unairworthy component? public class DebugTwo1{ public static void main(String[] args) { integer oneInt = 315; double oneDouble = 12.4; character oneChar = 'A'; System.out.print("The int is "); System.out.println(oneint); System.out.print("The double is "); System.out.println(onDouble); System.out.print("The char is "); System.out.println(oneChar); }}de-bug the code If a = 5 and an5an-1 then find the value of a4. What is the domain of the function? PLEASE I NEED HELP FAST MFAIZ Holdings Inc. is a retailer of kitchen accessories and hardware. The company is estimating its cash requirement for upcoming months. The firms history and predictions of sales in 2021 and 2022 are as follows:Additional information:(i) The company is adopting an old sales policy whereby 55 percent of sales on cash basis. Another 30 percent is to be collected in 1 month after the sales while the remaining 15 percent is to be collected within 2 months after the sales.(ii) The company purchases 60 percent of materials two months before the anticipated sales.(iii) Payment of purchases are 40 percent, which is paid in 1 month following the purchases, and the remaining is to be paid in the next 2 months after purchases.(iv) The company has estimated RM3,000 monthly for their fixed operating cost.(v) The monthly wages and salaries are 10 percent of the monthly sales.(vi) Rental of premises is RM5,000 per month respectively.(vii) EPF contributions RM12,000 for February and March 2022.(viii) The companys initial cash balance for the month of January is RM12,000 and the company has a policy of maintaining a minimum cash requirement of RM15,000.Based on the information provided, prepare a cash budget for the first quarter of the 2022. Can someone explain 3(x+4)-1=7 as part of her company's swot analysis, valerie is assessing the company's internal environment, including Did Prohibition work Why or why not? The Book of Dragons Chapter III The Deliverers of Their Country, an excerpt By E. Nesbit How would you summarize the events in the story so far? Be sure to use details from the text to support your answer. A runner runs 4777 ft in 7.27 minutes. What is the runners average speed in miles per hour? krystal has learned that she has a carcinoma that is best treated by a radical surgery that involves removal of her right eye and cheekbone, which would be quite disfiguring. however, if she doesn't undergo surgery, her chances of survival are quite poor. krystal is experiencing LEAST TO GREATEST PLSSS