Answer: D. Marshes are areas of shallow water, while bogs are deeper areas.
Explanation: On Edge!!
The statement that explains one difference between marshes and bogs is : ( D ) Marshes are areas of shallow water while bogs are deeper areas
What are Marshes and Bogs ?Marshes are areas of land/ground covered by water for a long period of time. They are similar to swamps but are treeless and only inhabited by herbaceous plants such as grasses and reeds. While
Bogs are areas that are often covered with water and are too soft that they cannot support a load placed on it, hence they are deeper areas when compared to Marshes.
Hence we can conclude that The statement that explains one difference between marshes and bogs is Marshes are areas of shallow water while bogs are deeper areas
Learn more about Marshes and Bogs: https://brainly.com/question/5020273
Which of the following is most likely to occur when a soldier stands at attention-very still, with legs and spine straight? a) Increased venus return b) Increased blood flow to the brain ) c) Increased storage of blood in the veins of the feet and legs d) Decreased pressure in the capillaries of the feet
When a soldier stands at attention, very still, with legs and spine straight, the most likely occurrence is the storage of blood in the veins of the feet and legs so the correct answer is option (c).
Standing at attention is the position of a soldier standing at an established place while maintaining a fixed, upstanding, and erect posture. It entails standing upright with the heels together, feet at a 45-degree angle, and arms straight down at the sides, with thumbs resting along the seams of the trousers. When a soldier stands at attention, there is increased storage of blood in the veins of the feet and legs. This is due to the fact that the blood is no longer flowing freely. The venous return would be lowered. When a person is standing, the veins are used to return blood to the heart, which means the blood flows against gravity.
When standing at attention, the venous return would be lowered since the veins are compressed when standing at attention. This is why soldiers are advised to move around, bend their knees, and change their stance when they are standing at attention for an extended period of time.Increased blood flow to the brain would result in movement. The soldier must remain still while standing at attention. Also, decreased pressure in the capillaries of the feet is not a result of standing at attention because the veins of the feet are compressed when standing at attention.
As a result, blood flow to the feet is reduced, and blood remains stored in the veins of the feet and legs.
know more about storage of blood click here:
https://brainly.com/question/30876242
#SPJ11
Which of the following is not a symptom of desertification?
A) decrease in salt content of the soil
B) lowering of the water table
C) reduced surface water
D) increased soil erosion
E) loss of native vegetation
Answer:
A
Explanation:
Effects of salts on plants As soils become more saline, plants become unable to
Why is earth interior layered??
Answer:
The inner core is solid, the outer core is liquid, and the mantle is solid/plastic. This is due to the relative melting points of the different layers (nickel–iron core, silicate crust and mantle) and the increase in temperature and pressure as depth increases.
Explanation:
Which of the following is the most likely effect of the mutation at nucleotide position 7 in the GULO gene of humans? A. The mutation results in the deletion of the GULO gene, so no polypeptide can be translated.
B. The deletion of the single nucleotide causes a frame shift, changing the primary structure downstream of the mutation and resulting in a nonfunctional protein.
C. The point mutation causes a substitution of the amino acid isoleucine (lle)for histidine (His) at position 7, resulting in a protein with higher than normal activity.
D The substitution of a single nucleotide in the GULO coding region results in a stop codon. This results in a smaller nonfunctional protein.
Answer:
D.
The substitution of a single nucleotide in the GULO coding region results in a stop codon. This results in a smaller nonfunctional protein
The substitution of a single nucleotide in the GULO coding region results in a stop codon. This results in a smaller nonfunctional protein.
What are GULO genes?With the use of modern genomics, it is possible to examine damaged metabolic pathways by screening the DNA of a wide range of organisms. The abundance of data has shown that the genetic entropy in human and other genomes is widespread.
Humans, apes, guinea pigs, bats, mice, rats, pigs, and passerine birds all have deletions in the GULO (L-gulonolactone oxidase) gene that result in loss of the vitamin C pathway.
According to recent studies and the data presented here, various GULO exon deletions in humans, chimpanzees, and gorillas all happened separately in each taxon and are connected to areas that contain a wide range of transposable element fragments.
Therefore, The substitution of a single nucleotide in the GULO coding region results in a stop codon. This results in a smaller nonfunctional protein.
To learn more about GULO genes, refer to the link:
https://brainly.com/question/30023861
#SPJ6
If the map distance between genes A and B is 30 is map units, and the map distance
between genes C and D is 10 map units, between which pair of genes would you expec
to find a greater recombination frequency?
If the map distance between genes A and B is 30 is map units, and the map distance between genes C and D is 10 map units then between A nad B it is expected to find a greater recombination frequency.
What is meant by recombination?Recombination is the process by which genetic material from two different parental sources is combined to form offspring with unique combinations of genes. In cells, this occurs during meiosis, leading to the formation of genetically diverse offspring from the genetic information of the parent cells.
What is the significance of DNA mapping?DNA mapping refers to the process of determining the relative locations of specific DNA sequences within a genome. This can be done using various techniques, including restriction fragment length polymorphism, pulsed-field gel electrophoresis, and high-throughput sequencing methods.
To know more about DNA, click here:
https://brainly.com/question/264225
#SPJ4
partial credit given. Go outside and collect a small amount of soil in the containers supplied. You will probably be more successful if you select soil from a vegetated area. Use your soil to prepare a wet mount following the directions you were given in class. Try to use 2 mm' of soil. To help you visualize this, draw two "3d" boxes, each representing a cubic millimeter, actual size, here: Use your microscope to examine the entire area under your coverslip. Count all the nematodes you see. how many cubic mm are in I cm ? How many nematodes were in your mm' of soil? What is your calculated number of nematodes per cubic mm? Based on your data, how many nematodes would you calculate there to be in a cubic centimeter of soil? How many would you calculate there to be in a cubic meter of soil?
There are 1,000 cubic millimeters (mm³) in 1 cubic centimeter (cm³). This is because 1 cm is equal to 10 mm, and when you calculate the volume of a cube, you raise the length of each side to the power of 3.
To determine the number of nematodes in your mm² of soil, you need to count them under the microscope. Let's say you counted 10 nematodes in your mm².
To calculate the number of nematodes per cubic millimeter (mm³) of soil, you need to know the depth of the soil you examined. If you used 2 mm of soil, the calculation would be: (Number of nematodes in mm²) / (Volume of soil in mm³) = 10 nematodes / (2 mm x 1 mm x 1 mm) = 10 nematodes / 2 mm³ = 5 nematodes per mm³.
To calculate the number of nematodes in a cubic centimeter (cm³) of soil, you would use the same ratio of nematodes per mm³. Since there are 1,000 mm³ in 1 cm³, the calculation would be: (Number of nematodes per mm³) x (1,000 mm³) = 5 nematodes/mm³ x 1,000 mm³ = 5,000 nematodes per cm³.
To calculate the number of nematodes in a cubic meter (m³) of soil, you would again use the same ratio. Since there are 1,000,000 cm³ in 1 m³, the calculation would be: (Number of nematodes per cm³) x (1,000,000 cm³) = 5,000 nematodes/cm³ x 1,000,000 cm³ = 5,000,000,000 nematodes per m³.
learn more about nematodes here:
https://brainly.com/question/9575693
#SPJ11
Hereditary assignment: Sex linked traits. Must show punnet square, and provide explanation of genotype and phenotype percentages/ratios.
First of all, we need to do the Punnet square to determine what will be the offspring genotype:
As we can see on the Punnet square, we have 4 different possible genotypes for the offspring, and in this case in particular, each genotype corresponds to a specific phenotype too, because this characteristic is linked to a sex chromosome.
We then have half the offspring blind, but half of it are women (25% out of the total offspring) and a half are men.
Also, we have the other half of the offspring not blind, with half of it being women and the other half being men.
In living things, cells must be in a _____________________ solution where water leaves and enters the cell at _________________________________________.
Answer:
isotonic; the same rate
Explanation:
Cell Theory as as commonly known gives the best definition for cells. All organisms that ever existed are made up of one or more cells. The theory state that the cell is a basic unit, that is of all living things, and that all cells come from cells that have existed.
For cell that is in an isotonic solution,no net flow of water into or out of the cell will be experienced, the volume of the cell is at a state of stability. When the level or concentration of solute in and out of the cell is at the same pace or level, the the cell membrane does not allow solutes to cross, leading to the solution being isotonic to the cell.
The number of fatty acids chains present in a molecule of a
phospholipid is _
The molecule of phospholipid contains two fatty acid molecules linked to -OH groups and a nitrogen-containing base bound to the phosphate group.
Phospholipids are a class of lipids whose molecule has a hydrophilic head containing a phosphate group and two hydrophobic tails derived from fatty acids, joined by an alcohol residue.
Thus, it has a strongly non-polar and hydrophobic tail consisting of fatty acid chains and a polar and hydrophilic head comprising a negatively charged phosphate group and a positively charged base. Because of this dual solubility, the phospholipids are called AMPHIPHATIC lipids.
learn more about phospholipids at -
brainly.com/question/12148124
A pair of mice are bred several times, generating the following data table. What are the most likely genotypes of the parents?
Answer:
Ff and ff
Explanation:
Adenine always pairs with
.
Cytosine always pairs with
.
Answer:
Thymine
Guanine
Killing pathogens and then using them to provide the body with active immunity is called ______. This is often done in young children.
When the immune system treats otherwise harmless substances, such as pollen, as if they were invaders, a/n ______ can occur.
HIV is a virus that attacks ______ in the body, weakening the immune system.
Polio used to be fairly common and devastating. Thanks to widespread vaccination against polio, the disease is now considered _______, no longer infecting nearly as many people as it once did.
Arthritis is an example of a/n _______, where part of a person’s body is identified as foreign and attacked by the person’s immune system.
Respond to the following based on your reading.
Colonization is largely blamed for bringing smallpox to the Americas. Why was this disease so devastating to Native Americans? Why can we now travel to different parts of the world and avoid contracting analogous diseases?
Answer:
Killing pathogens and then using them to provide the body with active immunity is called IMMUNIZATION . This is often done in young children.
When the immune system treats otherwise harmless substances, such as pollen, as if they were invaders, a/n ALLERGY can occur.
HIV is a virus that attacks WHITE BLOOD CELLS in the body, weakening the immune system.
Polio used to be fairly common and devastating. Thanks to widespread vaccination against polio, the disease is now considered ABSENT, no longer infecting nearly as many people as it once did.
Arthritis is an example of a/n AUTOIMMUNE DISORDER where part of a person’s body is identified as foreign and attacked by the person’s immune system.
Immunization helps involves the injection of dead pathogens into the bloodstream. This helps in the release of antibodies which helps in protecting the body against further attacks in the future.
Allergy happens as a result of the body system treating and attacking harmless substances.
This is because the ships which brought immigrants into the country had someone who had small pox on board which spread and many got infected and killed due to lack of vaccine and treatment.
Immunization helps people to travel without having to worry about diseases.
Answer:
vaccination
allergic reaction
t-cells
eradicated
autoimmune disease
Europeans had been exposed to the virus that causes smallpox for many generations, allowing them to acquire immunity to the virus. Native Americans were not exposed to smallpox or similar viruses before, so they had no immunity to the virus. In modern times, before traveling abroad, a person often receives vaccinations or other medications to avoid contracting the diseases specific to that region of the world.
Explanation:
The most common predator of the Northern Pike fish is humans, who enjoy the sport of catching this fast swimmer along with consuming their catch. These fish seek areas of dense vegetation or shallow water that is covered and stays cool. A certain lake with a large pike population becomes isolated due to development that eliminates the road leading to the lake. After several years what explains the population changes seen in the graph?
Answer:
C
Explanation:
Put the following events of bacterial transcription in chronological order 1. Sigma is released 2. Sigma binds to RNA polymerase, 3. Sigma binds to the promoter region. 4. The double helix of DNA is unwound, breaking hydrogen bonds between complementary strands. 5. Transcription begins. A3.1,2,5, 4 B 2.3, 1, 4,5 C 3.2. 14 C.5 2.3, 4.5.1
Transcription is the process by which DNA is used to create RNA molecules, and it is the first step in gene expression. Sigma factor helps the RNA polymerase enzyme bind to the promoter region and initiate transcription.
The correct chronological order of bacterial transcription events is Sigma binds to the promoter region (3), Sigma binds to RNA polymerase (2), the double helix of DNA is unwound, breaking hydrogen bonds between complementary strands (4), and transcription begins (5). Thus, the correct option is option A (3,2,5,4,1) and the answer is as follows:
Bacterial transcription is the process of producing RNA from a DNA template in prokaryotic cells. It is done in the following steps:Binding of sigma factor to the promoter region is the first step of bacterial transcription. It allows RNA polymerase to recognize the promoter region of the DNA molecule that must be transcribed.Next, sigma factor binds to RNA polymerase to create the RNA polymerase holoenzyme. This allows for a better binding and transcription process.Once the RNA polymerase holoenzyme has bound to the promoter region, the double helix of DNA is unwound, breaking hydrogen bonds between complementary strands. This makes the DNA molecule more accessible for transcription.
The template strand is then used to synthesize the RNA molecule.Finally, the process of transcription begins. RNA polymerase moves along the DNA template strand in a 5' to 3' direction, synthesizing RNA molecules that are complementary to the template strand. As RNA polymerase reaches the end of the gene, it releases the RNA transcript and detaches from the DNA molecule.The sigma factor is then released to start the process of transcription for the next gene.
learn more about Transcription here
https://brainly.com/question/1048150
#SPJ11
Why do your legs hurt after running for a while
A. Too much oxygen
B. A buildup of lactic acid
C. Too many mitochondria
D. A buildup of ATP
Answer: A buildup of lactic acid
Explanation: Lactic acid is produced in your muscles and accumulates during strenuous exercise. It can result in achy, sore muscles. Lactic acid buildup caused by exercise is usually temporary and does not cause much concern, but it can interfere with your workouts by causing discomfort.
During intense exercise, the body's primary energy source is glucose, which is broken down through a process called glycolysis to produce ATP (adenosine triphosphate), the molecule that provides energy to the muscles.
The correct option is D
As the body breaks down glucose rapidly for energy, there might be times when oxygen supply cannot meet the demands of the muscles, particularly during strenuous exercise. In such cases, glycolysis partially breaks down glucose without the presence of sufficient oxygen, leading to the production of lactic acid as a byproduct.
The buildup of lactic acid in the muscles can cause that familiar burning or painful sensation in your legs during or after running. This phenomenon is known as "lactic acidosis" and is often associated with muscle fatigue and discomfort.
As the body recovers after exercise, lactic acid is gradually cleared from the muscles and converted back into glucose and used for energy or removed from the body through other metabolic processes.
Hence ,D is the correct option
To learn more about ATP
brainly.com/question/174043
#SPJ3
What is a convection current?
Answer:
A convection current is basically where heat rises and cold sinks
Explanation:
When heat is added to something, it expands and rises. This leaves a lower pressure region behind and the surrounding cold rushes in. The cold then is heated and finally the head rises to the top. Then it is cooled. Then repeat :)
what is the correct pairing of neurotransmitters in the parasympathetic division of the autonomic nervous system?
The correct pairing of neurotransmitters in the parasympathetic division of the autonomic nervous system is that both release ACH.
What is ACH?
Acetylcholine inside the autonomic nervous system. The neurotransmitter in preganglionic sympathetic and parasympathetic neurons of the autonomic nervous system is called acetylcholine (ACh).
The heart, lungs, upper gastrointestinal tract, and sweat glands all have muscarinic acetylcholine receptors on their peripheral nerve systems.
The central and peripheral nervous systems depend on acetylcholine, a sort of chemical messenger or neurotransmitter, to function properly. It aids in learning, memory, and attention as well as the control of muscular motion and autonomic bodily processes.
To know more about ACH you may visit the link:
https://brainly.com/question/29213863
#SPJ4
For most adults over age 40, the reminiscence bump describes enhanced memory for ________.
Question options:
a) childhood and adolescence.
b) adolescence and young adulthood.
c) young adulthood and middle age.
d) childhood and middle age.
For most adults over age 40, the reminiscence bump describes enhanced memory for adolescence and young adulthood.
What is a reminiscence bump?
A "reminiscence bump" is a concept used to describe a phenomenon in which individuals tend to recall more memories from their adolescence and early adulthood years compared to the other periods of their lives.
It is a cognitive phenomenon that occurs due to the idea that events that happen in adolescence and young adulthood are often very memorable.
The idea of a reminiscence bump is based on the fact that the human brain continues to develop and change throughout the different stages of life, with each period of development associated with unique cognitive and social changes.
Thus, the memories formed in adolescence and the early adulthood years may be more vivid and enduring than those from other periods of life.
For most adults over age 40, the reminiscence bump describes enhanced memory for adolescence and young adulthood.
They tend to recall more memories from this period of their lives compared to the other periods of their lives.
Therefore, option (b) adolescence and young adulthood—is the correct option.
To know more about the reminiscence bump https://brainly.com/question/28192231
#SPJ11
A student has to perform an experiment on the effect of heat on a particular chemical which can be seen in the form of a color change. Which
section of his lab report will include the color change in that chemical?
A. Title
B.Conclusions
C. Results
Vespula flavoplisa and vusplisa,explain how the appearance suggests that those two are closely related than callicera rufa
Answer:
I don't know
Ask to other
what is it called if an ecosystem is changed by rising water temperature? Is it a physical, biological, or chemical change?
Consider the following sequence and explain what effect the mutation has on the protein that is translated.
UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type)
UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)
A) Complete change in amino acid sequence after the mutation
B) Single amino acid change
C) Prematurely stops the translation of the protein
D) No effect
The effect of the given mutation (UCUAUGUUUCACUGAGGGAAACCCUAACCC) on the protein translated is that there is a single amino acid change.
The genetic sequence provided is known as RNA that can be translated into protein. If the genetic sequence changes, it will change the resulting protein since the proteins are created from the sequence of the amino acids. In this case, the genetic sequence is changed from U to G on the 13th nucleotide in the sequence. This change causes the amino acid that is coded for by that triplet codon to be replaced with a different amino acid. Therefore, the single amino acid will be changed due to this mutation.
Thus, option B is correct. There is a single amino acid change in the protein that is translated.
Learn more about mutation on:
https://brainly.com/question/17031191
#SPJ11
A human cell has 46 chromosomes. The cell begins mitosis and divides into two new daughter cells. How many chromosomes does each new cell contain?
The new cells has two groups of 46 chromosomes, each with their own nuclear membrane.
What gene allows organisms to live in hot environments? help please.
Answer:
Explanation:
All living things can be classified into three main groups called domains; these include the Archaea, the Bacteria, and the Eukarya.
Prokaryotes arose during the Precambrian Period 3.5 to 3.8 billion years ago.
Prokaryotic organisms can live in every type of environment on Earth, from very hot, to very cold, to super haline, to very acidic.
The domains Bacteria and Archaea are the ones containing prokaryotic organisms.
The Archaea are prokaryotes that inhabit extreme environments, such as inside of volcanoes, while Bacteria are more common organisms, such as E. coli.
prokaryote: an organism whose cell (or cells) are characterized by the absence of a nucleus or any other membrane-bound organelles
domain: in the three-domain system, the highest rank in the classification of organisms, above kingdom: Bacteria, Archaea, and Eukarya
archaea: a taxonomic domain of single-celled organisms lacking nuclei, formerly called archaebacteria, but now known to differ fundamentally from bacteria
a protein in a microbe’s membrane helps it survive extreme environments
Within harsh environments like hot springs, volcanic craters and deep-sea hydrothermal vents – uninhabitable by most life forms – microscopic organisms are thriving. How? It’s all in how they wrap themselves.
hope this helps i know its long lol
The first organisms on Earth were most like today's
O Autotrophs anaerobic
O Eukaryotes
O Protista
O Heterotrophs aerobic
Answer:
O Autotrophs anaerobic
hope it will help you
Which of the following best describes an atom?
Protons, neutrons, and electrons all grouped together in the center.
O
A core of negatively and positively charged particles surrounded by neutral particles...
A.core of positive and neutral particles surrounded by negative particles.
A core of electrons and neutrons surrounded by protons
Explanation:
A.core of positive and neutral particles surrounded by negative particles.
Answer:1st one
Explanation:
Its protons,neutrons,and electrons all grouped togrther in the center. O
Suppose you were interested in studying teen SU. Which sociological theoretical perspective or perspectives (from the module one chapters) would you use? Explain your answer as to why you would use them and how you would use them.
To study teen SU, I would use both the Functionalist and Conflict perspectives.
What constitutes these perspectives?The Functionalist perspective emphasizes the ways in which social institutions, such as families and schools, help to maintain social stability and order. In the context of studying teen SU, I would use this perspective to examine the functions that teen SU serves in society and how it contributes to maintaining the status quo.
The Conflict perspective emphasizes power struggles and the ways in which dominant groups in society maintain their power over subordinate groups. In the context of studying teen SU, I would use this perspective to examine how power dynamics between teens and adults play out in the context of SU.
Using both of these perspectives would provide a comprehensive and nuanced understanding of teen SU, including its social functions and the power dynamics at play.
Learn more on perspectives here: https://brainly.com/question/16003840
#SPJ1
a device that is held in your hand to transmit and recieve verbal communication is called
Answer:
radio maybe?? could also be cellphone lol
Explanation:
Draw a picture or write a sentence using these words to show how they are related.
DNA, Trait, Alleles, Protein, Genes
Answer:
DNA
Explanation:
PLEASE GIVE ME A HEART
if a particular mammalian species contained 500 v cassettes, 2 d cassettes, and 10 j cassettes of the heavy chain, how many different heavy chains of a given isotype could be produced? choose one: a. 512 b. 20,000 c. 10,000 d. 1,024
10,000 different heavy chains of a given isotype could be produced
Antibodies, commonly known as immunoglobulins (Ig), are big, Y-shaped glycoproteins generated as a main immunological defense by B-cells. Antibodies bind to certain molecules of a disease known as antigens.
The antibody base is made up of constant domains (C), which together constitute the fragment crystallizable area (Fc). This area is vital for the antibody's function during an immunological response.
Antibodies (immunoglobulins (Ig)) are divided into numerous isotypes or classes in immunology.
The overall class or isotype of an antibody is defined by the kind of heavy chain. There are five forms of mammalian Immunoglobulin heavy chains, which are indicated by Greek letters. These chains can be found in IgA, IgD, IgE, IgG, and IgM antibodies.
For more information on Immunoglobulins, visit :
https://brainly.com/question/28329158
#SPJ4