Which shape has four equal side lengths? (2 points) a a quadrilateral with one small square in each of the four corners, and single arrows going in the same direction for one pair of the opposite sides and double arrows for the other pair of opposite sides b a quadrilateral with double arrows going in the same direction for one pair of the opposite sides c a quadrilateral with sides of different lengths d a quadrilateral with a short line on each side

Answers

Answer 1

Answer:

D. a quadrilateral with a short line on each side

Explanation:

This question is describing a SQUARE, which is a quadrilateral with four sides equal. A square has four angles as well, which are of equal sizes as well i.e. 90% each.

A quadrilateral with one small square in each of the four corners showing that each angle is a right angle (90°). In a square, same line are on each side showing that any side with the short line has the same length, hence, all sides have an equal length.

Answer 2

Answer:D

Explanation:


Related Questions

Give two similarities between the way that a fungus feeds, and the way that you feed.

Answers

Answer:

Human's and fungi have similar feeding habits.

1- They are both heterotrophic (unlike plants, algae, etc. ) ... This means that both get energy by feeding on other organisms.

1- They are both heterotrophic (unlike plants, algae, etc. ) ... This means that both get energy by feeding on other organisms. 2-Humans and fungi both cannot produce their own food using photosynthesis.

Answer:

its helpful

Explanation:

it's right

this is simillarities

Give two similarities between the way that a fungus feeds, and the way that you feed.

Oil, natural gas and coal are examples of …

Answers

Answer: Fossil fuels

Explanation:

Answer:

fossil fuels

Explanation:

a geneticist found that a particular mutation had no effect on the polypeptide encoded by a gene. this mutation probably involved question 13 options: substitution of one nucleotide deletion of one nucleotide insertion of one nucleotide alteration of one nucleotide

Answers

The particular mutation which had no effect on the polypeptide encoded by a gene involves substitution of one nucleotide.

A substitution of one nucleotide in a gene can cause a change in the sequence of the encoded polypeptide, but this change may or may not affect the function of the protein. If a geneticist found that a particular mutation had no effect on the polypeptide, it is likely that the substitution resulted in a silent mutation, meaning that the change in the nucleotide sequence did not result in a change in the amino acid sequence of the encoded protein.

Silent mutations are thought to be evolutionarily neutral, as they do not affect the function of the protein. In contrast, insertions or deletions of nucleotides in a gene can disrupt the reading frame of the encoded polypeptide, often leading to a truncated or non-functional protein, while alterations of nucleotides can result in a change in the amino acid sequence of the protein, potentially affecting its function.

Learn more about silent mutations here: https://brainly.com/question/10394991

#SPJ4

What shape of bone is the pelvic bone?
A. long
B. short
C. irregular
D. flat

Answers

The pelvic bone is the hip bone witch is a triangular shape this would be considered c-irregular

Which statement is FALSE about epigenetic modifications?
a. The tails of the nucleosome octamer components can be modified with methylation
b. The tails of the nucleosome octamer components can be modified with acetylation
c. Only non-DNA components of chromatin are modified with epigenetic markers
d. Epigenetic modifications control whether a region is euchromatin or heterochromatin

Answers

The false statement about epigenetic modifications is:
c. Only non-DNA components of chromatin are modified with epigenetic markers.

Epigenetic modifications refer to changes in gene expression that do not involve changes to the underlying DNA sequence. These modifications can be inherited and can influence how genes are turned on or off in different cells or at different stages of development.

a. The tails of the nucleosome octamer components can be modified with methylation: This statement is true. Methylation of the tails of nucleosome octamer components, which are made up of histone proteins, can affect gene expression by either activating or repressing the associated genes.

b. The tails of the nucleosome octamer components can be modified with acetylation: This statement is also true. Acetylation of histone tails is another type of epigenetic modification that can influence gene expression. Acetylation generally leads to gene activation by relaxing the chromatin structure and allowing transcription factors to access the DNA.

d. Epigenetic modifications control whether a region is euchromatin or heterochromatin: This statement is true. Epigenetic modifications play a crucial role in determining whether a region of DNA is in a euchromatin state, which is more accessible for gene expression, or a heterochromatin state, which is more condensed and less accessible for gene expression.

In summary, the false statement is c. Only non-DNA components of chromatin are modified with epigenetic markers. Epigenetic modifications can occur on both DNA and non-DNA components of chromatin, such as histone proteins. These modifications can have significant impacts on gene expression and are essential for cellular development and function.

Learn more about non-DNA components here:-

https://brainly.com/question/32988546

#SPJ11

Plants that thrive in this type of climate are most likely adapted to which of these conditions

Answers

Answer:

Plants Adapting

Explanation:

Plants adapt to their environment from necessity. Plants may also adapt by growing lower and closer to the ground to shield themselves from wind and cold. Desert environments may have some of the following adaptations, these help the plant to conserve food, energy and water and still be able to reproduce effectively.

I can not fully answer your question because I do not know these conditions, did your teacher give a list?

The population density of deer in a forest is 5 deer per square kilometer. If an ecologist Lodants is studying a section of the forest that is 5 square kilometers, how many deer would he/she expect to encounter? (Show your work)​

Answers

An ecologist Lodants would expect to encounter approximately 25 deer in a section of the forest that is 5 square kilometers.

Population density of deer =  5 deer per square kilometer.therefore, Total number of deer an ecologist would encounter in 5 square kilometers = 5 × 5 i.e. 25 deer.

Population density is the number of people in a given area of land. It primarily applies to humans, yet occasionally it also does to other living things. It is a crucial geographic phrase. The amount of people who live in an area per square kilometer, or other unit of land area, is referred to as population density.

To learn more about Population density click here,

https://brainly.com/question/16894337

#SPJ4

A _____ career is dedicated to promoting human behaviors and industry decisions that are environmentally responsible.
a) Green
b) Automated
c) Emerging
d) Forensic

Answers

The correct answer to the question "A _____ career is dedicated to promoting human behaviors and industry decisions that are environmentally responsible" is option a) Green. Explanation: Green careers are the ones that are dedicated to promoting human behaviors and industry decisions that are environmentally responsible.

These careers focus on protecting the environment and improving the overall human condition. They are dedicated to solving some of the biggest environmental problems facing society today by developing new technologies, implementing new policies, and designing more sustainable products.

A few examples of green careers include renewable energy engineers, environmental consultants, and sustainability experts.

to know more about  visit :

https://brainly.com/question/21976584

#SPJ11

Answer:

green

Explanation:

a woman is type a blood and she has a child with type o blood. what blood type(s) does the father have? draw as many punnett squares as necessary to answer this question

Answers

Answer:

c

Explanation:

Which statement below is true about seasons in coniferous forests?
A) Summers are long, hot and dry.
B) Summers are warm, and many plants are able to grow and bloom.
C) Winters are long, dark, and very cold.
D) Cold winter temperatures cause all plants in the forest to wither and die.

Answers

Answer:

the answer is a

Explanation:

summers in coniferous forests from June, July, and August are the most humid months and the temperatures are at their highest  

when you lift a weight, what part of the arm is doing the most work?

Answers

When you lift a weight, Bicep muscles part of the arm is doing the most work.

The biceps or biceps brachii is a sizable muscle that is located on the front of the upper arm, between the shoulder and the elbow (Latin: musculus biceps brachii, "two-headed muscle of the arm"). The muscle's two heads emerge from the scapula and combine to form a single belly that attaches to the upper forearm.

The biceps muscle crosses the elbow and shoulder joints, although its major use is to flex and supinate the forearm at the elbow. When using a corkscrew to open a bottle, both of these motions are used: first, the biceps supinates the cork before pulling it out (flexion)

Learn more about Bicep muscles

https://brainly.com/question/20217970

#SPJ4

aseptic technique means that that you perform the preparation of media or the transfer of living microbes

Answers

Aseptic technique basically means that we are performing the transfer of the living microbes or preparing of media without introducing any contamination.

Aseptic technique is basically a method in which there are target-specific practices and also different procedures that are performed under suitably controlled conditions so that there is a reduction in the contamination which occurs from microbes. It is a key laboratory skill which is very much needed while conducting researches that are related in the field of microbiology.

Contamination is a major issue when we are culturing microorganisms. Bacterial cultures can get infected with colonies which we might not be identified and cause hinderances in our study.

To know more about aseptic technique here

https://brainly.com/question/7672380

#SPJ4

in 2002, an experiment containing s. cerevisiae was flown aboard nasa mission sts-112 with the goal of identifying gene expression changes related to microgravity. the yeast samples were grown in small cylindrical glass tubes placed in a tightly closed, temperature-controlled container. to initiate growth, media containing glucose and other basic nutrients were auto-injected into a chamber containing dormant yeast. after a pre-determined growth period, a fixative was auto-injected into the chamber to stop growth and protect the contents until the cells could be isolated back on earth.before the mission, while determining the appropriate experimental growth period, what unexpected problem did the researchers encounter when they first tested out the equipment in the laboratory by growing yeast under simulated microgravity conditions for a few hours?

Answers

The researchers encountered unexpected leakage of the fixative from the chamber during the simulated microgravity conditions, potentially affecting the integrity of the yeast samples.

The researchers came into an unanticipated problem of fixative leaking from the chamber during the simulated microgravity circumstances when testing the equipment in the lab before missions. This raised questions since it may jeopardise the yeast samples' integrity and impact how precisely changes in gene expression caused by microgravity are detected.

The fixative's efficacy in preserving sample integrity throughout the experiment was called into question by the leakage because it was designed to limit growth and safeguard the contents until the cells could be examined back on Earth.

Learn more about microgravity:

https://brainly.com/question/30490897

#SPJ4

Sarah wants to know which brand of nail polish
lasts the longest without chipping. She buys 4
types of nail polish - Essie (which she normally
uses,) Butter, OPI, and Sally Hansen. Every
Sunday for 4 weeks she paints her nails with a
different brand of polish and records how many
days she lasts before she gets her first chip. She
makes sure to use the same bottom coat and top
coat with each type of polish, and she makes sure
to do the same weekly routine each week so that
her nails aren't getting treated more roughly
different weeks.
1. Independent variable:
2. Dependent variable:
3. Hypothesis:
4. Control group:
5. Experimental group:
6. Constants:

Answers

Answer:

Independent variable: Element that influences the appearance of a controlled and evaluable result, such as the enamel that Sarah will use on her nails.

Dependent variable: Element that is influenced by the dependent variable and promotes the visualization of a result, such as the length of time that the enamels can remain on the nail without chipping.

Experimental group: Element that allows the study of the interaction of these variables and the result developed through it, such as Sarah's enamel marks.

Control group: Element where only the independent variable is applied. As the action of the dependent variable does not exist, the observed result is the same that would be perceived if the study was not taking place, such as the day when Sarah did not paint her nails.

Constant: Elements that are exactly the same throughout the experiment, such as the person who conducted it, the time the study will be carried out, the nail care routine and the lower and upper layers of the enamels used.

Answer: Independent variable is the one that is changed and controlled: the nail polish Sarah uses.

Dependent variable is the one that is studied, the result of the dependent variable: how long the nail polish lasts.

Hypothesis is the statement that has to be proved or declined during the experiment: different nail polish lasts a different period of time without chipping.

The control group is the not exposed to changes and the independent variable is part of this group: when Sarah paints her nails (4 Sundays in a row) and the type of bottom coat and top coat as well as the weekly routine.

The experimental group contains the independent variable and it is changed for the group: the type of nail polish.

The constants are Sally since she performs the experiment; the period of research, the routine and the coats.

A hypertonic solution has:
Fewer water molecules outside the cell than are inside the cell
More water molecules outside the cell than are inside the cell
The same number of water molecules inside and outside of the cell
No water inside or outside of the cell

Answers

The solution having more water molecules outside the cell than are inside the cell, i.e., option B.

What is a hypertonic solution?

A hypertonic solution have more dissolved particles (such as salt and other electrolytes) than normal cells and blood. Hypertonic solutions, for example, are used to soak wounds.

The solution having more water molecules outside the cell than are inside the cell.

Thus, the correct option is B.

For more details regarding a hypertonic solution, visit:

https://brainly.com/question/13275972

#SPJ1

Answer:

More water molecules outside the cell than are inside the cell

Explanation:

A hyportonic solution is a solution which has more dissolved particles present in itself than blood cells or normal cells

The best application is used to soak wounds

Option B

the wet bulb temperature is 10 C the Dry bulb temperature is 14 C what is the relative humidity?

Answers

The relative humidity is approximately 22.9% based on the given wet bulb temperature of 10°C and dry bulb temperature of 14°C.

Relative humidity

Wet bulb temperature: 10°C = 50°F

Dry bulb temperature: 14°C = 57.2°F

SVP at wet bulb temperature: 0.284 * \(e^(17.27 * 10 / (10 + 237.3))\)= 0.284 * \(e^(-7.09)\) = 0.284 * 0.000828 = 0.0002356 psi

SVP at dry bulb temperature: 0.284 *\(e^(17.27 * 14 / (14 + 237.3))\) = 0.284 * e^(-5.97) = 0.284 * 0.002562 = 0.0007296 psi

AVP = 0.0002356 - (0.00066 * (57.2 - 50) * 14.7) = 0.0002356 - (0.00066 * 7.2 * 14.7) = 0.0002356 - 0.0686 = 0.000167 psi

RH = (AVP / SVP at dry bulb temperature) * 100

RH = (0.000167 / 0.0007296) * 100 = 0.229 * 100 = 22.9%

Learn more about relative humidity:https://brainly.com/question/30415486

#SPJ1

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Answers

Answer:

True ...........................

Which factor is not going to affect how natural selection acts on a given group of organisms?

Answers

These are some of the factors that do not affect how natural selection acts on a given group of organisms. However, the process of natural selection depends on several factors, including genetic variation, environmental changes, and competition for resources

There are numerous factors that can affect how natural selection acts on a group of organisms. Natural selection is the process of evolution that occurs when organisms adapt to environmental changes, resulting in the survival of the fittest. It is based on the principle that only those organisms with the most advantageous traits will survive and reproduce while those with less favorable characteristics will die out over time.

The survival of a species is determined by several factors, but some may not affect how natural selection acts on a given group of organisms.

Factors that do not affect how natural selection acts on a given group of organisms may include but are not limited to:

1. Human interference: Human activities may affect the environment and the ecosystem but may not affect how natural selection acts on a given group of organisms.

2. Changes in climate: Changes in climate may affect the survival of organisms, but it does not affect how natural selection acts on a given group of organisms.

3. Genetic drift: Although genetic drift is a factor that can affect how natural selection acts on a given group of organisms, it can also lead to random changes in a population's gene pool. Therefore, it is less significant than other factors.

4. The availability of resources: The availability of resources such as food, water, and shelter can affect the survival of organisms, but it does not affect how natural selection acts on a given group of organisms.

In conclusion, these are some of the factors that do not affect how natural selection acts on a given group of organisms. However, the process of natural selection depends on several factors, including genetic variation, environmental changes, and competition for resources. This results in the survival of the fittest organisms that are best adapted to their environment.

To know more about natural visit;

brainly.com/question/30406208

#SPJ11

6. which of the following components of the neuromuscular junction would be directly affected by the toxin produced by bacterium clostridium tetani? a. the axon terminals b. the motor end plate c. the sarcoplasmic reticulum d. the synaptic cleft

Answers

Motor end plate of the neuromuscular junction would be directly affected by the toxin produced by bacterium clostridium tetani.

Clostridium tetani is a soil bacterium. It is a major causative agent for tetanus. It enters the body through wounds or necrosis. Bacteria that reside in muscles release neurotoxin called tetanospasmin. It enters the axon of the motor neuron and moves retrogressively and reaches the inhibitory neuron where it enters into the axon bulb and prevents the release of neurotransmitters called gamma amino butyric acid and glycine. Hence the inhibitory neuron cannot pass signals to the motor neuron which causes more muscle contraction since signal from the inhibitory neuron reduces muscle contraction.

To know more about neuron-

https://brainly.com/question/24217914

#SPJ4

explain what happens when a lipid ligand reaches a target cell and how the lipid ligand acts out a cellular response

Answers

when lipid ligand binds to the receptors, some conformational changes takes place which leads to responses.

This lipid ligand binding leads to signal transduction

lipid soluble hormones when diffuse through membrane they bind with receptors which is there in cytoplasm. the lipid receptor complex will now binds with gene this process is direct gene activation.

eg, steroid hormones

mrna is generated it enter cytoplasm and makes the protein.

lipid insoluble these do not bind directly to cell wall as they are insoluble therefore they bind to the secondary messenger which then bins to DNA the mrna is formed which leads to formation of proteins.

eg , peptide hormones

To know more about lipids,

https://brainly.com/question/29853349

#SPJ4

Identity
Choose the correct measuring device for gathering data from the list of tools in the drop-down menu.
a. heartbeats per minute
b. time
c. distance across the pond
d. temperature of the water
e. volume of liquid

Answers

Answer:

Thermometer

Heart monitor

Measuring cylinder

Clock

Tape measure

These are all tools to help measure data.

Explanation:

You're welcome.

Which of the following animals have adapted to live in the arctic tundra? (Select all that apply.)
walia ibex
caribou
musk ox
willow ptarmigan

Answers

Answer:

Caribou, Musk Ox, and the willow ptarmigan

Explanation:

They all can survive the tundra! Except the first one.

Answer:caribou

musk ox

willow ptarmigan

Explanation: It is in the arctic animals listed in Edge

What does the change in cardiac output mean or do for an exercising body?

Answers

Cardiac output is the amount of blood that the heart pumps per minute, and it changes during exercise to meet the demands of the body.

When we exercise, our muscles need more oxygen and nutrients to function, so the heart pumps faster and harder to deliver these vital substances to the muscles. As a result, cardiac output increases during exercise to maintain adequate blood flow.

This increase in cardiac output has several effects on the body during exercise. Firstly, it increases blood flow to the muscles, allowing them to receive more oxygen and nutrients. Secondly, it increases blood flow to the skin, helping to dissipate heat produced by the body during exercise. Thirdly, it increases blood pressure and heart rate, which can help to improve overall cardiovascular health.

Thus, the change in cardiac output during exercise is essential for the body to meet the demands of increased physical activity. Without this increase in blood flow, the body would not be able to perform physical activity efficiently, and exercise would become much more challenging.

Learn more about cardiac output here:

https://brainly.com/question/13047241

#SPJ11

describe how gene cloning can be used to make recombinant dna plasmids that can be used to transform bacteria and make useful products like insulin. include terms restriction enzymes and restriction fragments.

Answers

The recombinant DNA technology to manipulate and isolate specific DNA segments. Which combine DNA from various species or produce genes with novel functions.

Transformation and selection of bacteria are key steps in DNA cloning. DNA cloning is the process of making many copies of a specific piece of DNA, such as a gene. The copies are often made in bacteria.

In a typical cloning experiment, researchers first insert a piece of DNA, such as a gene, into a circular piece of DNA called a plasmid. This step uses restriction enzymes and DNA ligase and is called a ligation.

After a ligation, the next step is to transfer the DNA into bacteria in a process called transformation. Then, we can use antibiotic selection and DNA analysis methods to identify bacteria that contain the plasmid we’re looking for.

Hence, gene cloning is widely used in biotech industries to obtain drugs and biomolecules.

To know more about Plasmid.

https://brainly.com/question/15461017

#SPJ4

true or false: most aids-related deaths are not a direct result of hiv, but of other infections that would not normally harm a host with a healthy immune system.

Answers

AIDS (Acquired Immunodeficiency Syndrome) is a chronic disease that is caused by the HIV virus. When the immune system is severely damaged, HIV infection can lead to AIDS. AIDS patients are at a high risk of infections that do not normally affect people with healthy immune systems due to the virus's impact on the immune system. Most of the deaths caused by AIDS are a result of other infections that would not harm people with healthy immune systems. Pneumocystis carinii pneumonia, a type of fungal infection, and tuberculosis are two of the most common AIDS-related illnesses. The body's immune system is responsible for keeping us healthy. The immune system is responsible for identifying and fighting off infections, viruses, and other foreign substances that enter the body. When HIV infection progresses to AIDS, the body's immune system is severely weakened, making it difficult to fight off infections. Therefore, the majority of deaths from AIDS are caused by infections that would not typically be fatal to someone with a healthy immune system.

Hence, the statement "most AIDS-related deaths are not a direct result of HIV, but of other infections that would not normally harm a host with a healthy immune system" is True.

For more information regarding this topic, you can check the below link

https://brainly.com/question/1686219

#SPJ11

Name 2 body systems that interact to maintain
homeostasis in the human body and explain how they do

Answers

Answer:

Internal Temperatures

Similarly, the cardiovascular, integumentary (skin and associated structures), respiratory, and muscular systems work together to help the body maintain a stable internal temperature. If body temperature rises, blood vessels in the skin dilate, allowing more blood to flow near the skin's surface.

OR,

The nervous and endocrine systems exert the ultimate control over homeostasis because they coordinate the functions of the body's systems. Regulation of body temperature, blood pressure, pH, and glucose concentration are four examples of how the body maintains homeostasis.

Hope you know

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.
I. Which end of the DNA template is 5′ and which end is 3′?
II. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.

Answers

The 5′ end of the DNA template is ATTGCCAGATCATCCCAATAGAT, and the 3′ end is ATCTATTGGGATGATCTGGCAAT. The RNA transcribed from this template is 5′-UAACGGUCUAGUAGGGUUACUCA-3′.

I. To determine the 5′ and 3′ ends of the DNA template, you should note that RNA polymerase proceeds along the DNA template from the 3′ end to the 5′ end. Since the given sequence (ATTGCCAGATCATCCCAATAGAT) is the single-stranded DNA template and RNA polymerase moves from left to right, the 5′ end is on the left (ATTGCCAGATCATCCCAATAGAT) and the 3′ end is on the right (ATCTATTGGGATGATCTGGCAAT).

II. To transcribe RNA from the DNA template, RNA polymerase pairs RNA nucleotides with the DNA template nucleotides: A (adenine) pairs with U (uracil), T (thymine) pairs with A (adenine), C (cytosine) pairs with G (guanine), and G (guanine) pairs with C (cytosine). Using this base-pairing rule, the transcribed RNA sequence is 5′-UAACGGUCUAGUAGGGUUACUCA-3′.

Learn more about nucleotides here:

https://brainly.com/question/30299889

#SPJ11

If the pride is taken over by new individuals, what happens to the male?

Answers

Answer: yes he is kicked out of the pride and must wander to find a new pride to take over. And interesting fact the new male may kill the other males offspring if he chooses.

If the pride is taken over by new individuals, he is pushed out of the pride, kill pride's cub.

What are cubs ?

The young offspring of lion called as cubs and they usually require parental care.

The cubs are generally born outside the pride. At the growing stage the male lion hunts prey  and then deliver them to cubs.

The lioness protects their cubs by hiding them from all forms of animals and save their own pride to secure their cubs.

cubs transformation occur into adults and after this male lion, female lion, and adult cubs defend their territory together.

To learn more about Cubs pride, here:

https://brainly.in/question/49295690

#SPJ2

What characteristics of water causes it to display all of the properties described above?

Answers

There is information missing? What properties described above? what do you mean by that, what are the properties above?

Gene expression can occur at several points along the pathway from DNA to RNA to proteins. In one example of gene expression, the protein insulin must be trimmed to a smaller size.

How is this is an example of gene expression?

A. until the protein is trimmed, it is not useful to the cell
B until the protein is trimmed, transcription is blocked by repressor protein
C. until the protein is trimmed ribosomes are not active
D. until the protein is trimmed the shape of DNA blocks transcription

Answers

Answer:

A. until the protein is trimmed, it is not useful to the cell

The trimming of protein insulin to a smaller size represents an example of gene expression until it is trimmed, it is not useful to the cell. Thus, the correct option for this question is A.

What is gene expression?

Gene expression may be characterized as a type of biological process through which a gene gets turned on in a cell in order to make RNA and ultimately proteins. With the help of this process, information from a gene is used in the synthesis of a functional gene product that enables it to produce end products.

The process of gene expression consists of two major steps: transcription and translation. During the process of transcription, the information stored in a gene's DNA is passed to a similar molecule called RNA in the cell nucleus.

While the process of translation involves the mechanism through which RNA is converted into amino acids through which functional proteins are constructed.

Therefore, the trimming of protein insulin to a smaller size represents an example of gene expression until it is trimmed, it is not useful to the cell. Thus, the correct option for this question is A.

To learn more about Gene expression, refer to the link:

https://brainly.com/question/10343483

#SPJ2

Other Questions
he type of account and normal balance of Petty Cash is a(n) O a. expense, debit o b. asset, debit c. revenue, credit O d. liability, credit You are an IT administrator for your company. you have been tasked with the assignment of installing 300 copies of Windows 10. You need to finish this task as quickly and efficiently as possible.Which of the following booth methods would be the BEST methods for installing Windows under these circumstances? Read the following abstract and answer the question below:H9N2 influenza viruses have been circulating worldwide in multiple avian species and repeatedly infecting mammals, including pigs and humans, posing a significant threat to public health. The coexistence of H9N2 and pandemic influenza H1N1/2009 viruses in pigs and humans provides an opportunity for these viruses to reassort. To evaluate the potential public risk of the reassortant viruses derived from these viruses, we used reverse genetics to generate 127 H9 reassortants derived from an avian H9N2 and a pandemic H1N1 virus, and evaluated their compatibility, replication ability, and virulence in mice. These hybrid viruses showed high genetic compatibility and more than half replicated to a high titer in vitro. In vivo studies of 73 of 127 reassortants revealed that all viruses were able to infect mice without prior adaptation and 8 reassortants exhibited higher pathogenicity than both parental viruses. All reassortants with higher virulence than parental viruses contained the PA gene from the 2009 pandemic virus, revealing the important role of the PA gene from the H1N1/2009 virus in generating a reassortant virus with high public health risk. Analyses of the polymerase activity of the 16 ribonucleoprotein combinations in vitro suggested that the PA of H1N1/2009 origin also enhanced polymerase activity. Our results indicate that some avian H9-pandemic reassortants could emerge with a potentially higher threat for humans and also highlight the importance of monitoring the H9-pandemic reassortant viruses that may arise, especially those that possess the PA gene of H1N1/2009 origin.If you were an epidemiologist, based on this information, what novel combination of influenza viruses would you be most concerned about?a.H9N2 that incorporates an H1N1 PA segment.b.H9N2 that incorporates an H1N1 PB1 segment.c.H1N1 that incorporates an H9N2 PB1 segment.d.H1N1 that incorporates H9N2 PA segmentRead the abstract below and answer the following question:Link of a ubiquitous human coronavirus to dromedary camels.The Middle East respiratory syndrome (MERS) coronavirus (CoV) is a CoV with a known zoonotic source in dromedary camels. Little is known about the origins of endemic HCoVs. Studying these viruses' evolutionary history could provide important insight into CoV emergence. In tests of MERS-CoV-infected dromedaries, we found viruses related to an HCoV, known as HCoV-229E, in 5.6% of 1,033 animals. Human- and dromedary-derived viruses are each monophyletic, suggesting ecological isolation. One gene of dromedary viruses exists in two versions in camels, full length and deleted, whereas only the deleted version exists in humans. The deletion increased in size over a succession starting from camelid viruses via old human viruses to contemporary human viruses. Live isolates of dromedary 229E viruses were obtained and studied to assess human infection risks. The viruses used the human entry receptor aminopeptidase N and replicated in human hepatoma cells, suggesting a principal ability to cause human infections. However, inefficient replication in several mucosa-derived cell lines and airway epithelial cultures suggested lack of adaptation to the human host. Dromedary viruses were as sensitive to the human type I interferon response as HCoV-229E. Antibodies in human sera neutralized dromedary-derived viruses, suggesting population immunity against dromedary viruses. Although no current epidemic risk seems to emanate from these viruses, evolutionary inference suggests that the endemic human virus HCoV-229E may constitute a descendant of camelid-associated viruses. HCoV-229E evolution provides a scenario for MERS-CoV emergence.Why are the dromedary coronaviruses not a current threat to humans?a.HCoV viruses are only in 5.6% of animalsb.Dromedary coronaviruses are only found in the Middle East.c.Inefficient replication in cell lines suggests they are not adapted to humans.d.Only one deleted version exists in humans. Pls help me out!!! Which one to choose vino suffers from schizophrenia. so far, his hallucinations have not responded to antipsychotic medication. his doctor might recommend: A 20 kg mass is connected by a 100 meter cable to a 1000 kg car that is at rest, with its brakes off, about 100 meters from the edge of the cliff. The weight is then hung over a pulley at the edge of the cliff and released. a. What is the acceleration of the car toward the cliff? b. How long will it take the car to reach the cliff? c. How fast will the car be traveling the moment it goes over the cliff? the amish have neither the resources nor the desire to use prison as a sanction against members of their community who violate the rules. what sanction do they use instead? group of answer choices monetary fines are used for most norm violations. meidung, or shunning, is used, a process whereby no one within the community will associate or even talk with a rule breaker for a set period of time. offenders are flogged or put in stocks to be publicly humiliated for a short period of time. the offender is sentenced to a prison that is run by the amish.. The product life cycle presents challenges. Which of the following is LEAST likely torequire a company to adapt its marketing strategies?A) developments in technologyB) decreased manufacturing costsC) competitionD) changing tastes of consumersE) aging of products Find the slope of the line below . Enter your answer as a fraction or decimal. Use a slash mark ( / ) as the fraction bar if necessary you want to increase the relevance of a search ad so it's more meaningful to potential customers and provides value-added information to their searches. what two actions might improve the relevance of your ad? (choose two.) Write the equation in slope-intercept form for the line that has slope 8 andy-intercept of 2. How does the flapper represent a change from traditional to modern values Find m_DBG.(6x + 7)(8x 27) A mechanic exerts a force of 55 N on a 0.015 m2 hydraulic piston to lift a small automobile. The piston the automobile sits on has an area of 2.4 m2. What is the weight of the automobile? ABC, if m CAD = 29, what is m&CAB?D Assuming that x, y, and z are integer variables, which of the following three logical expressions are equivalent to each other, that is, have equal values for all possible values of x, y, and z?1) (x == y && x != z) || (x != y && x == z)2) (x == y || x == z) && (x != y || x != z)3) (x == y) != (x == z)A. None of the threeB. I and II onlyC. II and III onlyD. I and III onlyE. I, II, and III A person pushes a box across a horizontal surface at a constant speed of 0.5 meter per second The box hasa mass of 40 kilograms, and the coefficient of sliding friction is 0.25. The power supplied to the box by theperson isa. 0.2 Wc. 50 Wb. 5Wd. 100 W Which of the following is NOT a trend in body growth for children in middle and late childhood?a. Muscle mass increases and baby fat decreases.b. Head and waist circumference decrease in relation to body height.c. Weight increases are mainly due to increases in the skeletal and muscular systems.d. They triple their strength capacity. menopause accure in which age group PLEASE ANSWER IM TIMED Use the graph above to write down an equation and fill out the table. Identify the charge for each hour of work and the one-time fee