Which powers are not specifically detailed in the u. S. Constitution but inferred as necessary to achieve the objectives of government?.

Answers

Answer 1

Although they are not specifically mentioned, implied powers are considered to be necessary for the national government's goals to be met.   the country has inherent authority as a direct result of its existence.

Although the Constitution doesn't explicitly mention implied powers, the elastic (or "necessary and proper") clause can be used to infer them (Article I, Section 8). Political authority granted to the United States government that isn't expressly defined in the Constitution is known as implied power. Due to precedents established by other authorities, it is assumed that these will be granted. Any given governmental body can't function without these implicit capabilities. Furthermore, even though it isn't explicitly stated or suggested, The idea of implied powers was developed by Hamilton's interpretation of Article 1, Section 8 of the U.S. Constitution. According to Hamilton, a government's sovereign obligations include the right to employ all means required to achieve its goals. The "elastic" or implied powers clause enables Congress to enact laws that it deems "necessary and proper" for the accomplishment of its listed duties. This crucial clause serves as the foundation for numerous congressional powers that have developed over time.

Learn more about implied powers here:

brainly.com/question/29691012

#SPJ4


Related Questions

Which of these is a "hidden cost" of inventory? Select an answer: item cost insurance expense obsolescence cost storage cost

Answers

Answer:

obsolescence cost

Explanation:

In simple words, A hidden cost can be understood as a cost incurred by a business or operation which is not readily evident while gazing at the business in progress.

Whenever an object in stock gets outdated before it has been delivered or utilised, it incurs obsolescence expenses. The cost of obsolescence includes the work and materials used to create the original product, as well as the expense of removal (e.g., identifying, transporting and disposing obsolete inventory)

What happened after Louisiana settlers realized they could not rely on France for support?

Answers

Answer: they establish farms to increase food supply

Explanation: just took a quiz and got it right

A student recorded the times of three successive high tides at one location as: 9:12am 9:38am 10:04am What is the approximate time of the next high tide?

Answers

They are incriminating by 26, so the next approximate time will be 10:30am!

-If you liked this answer don’t forget to give it a heart, and maybe even brainliest :)

Both the scientific community and the public common sense community agree on the issue of climate change true or false

Answers

Answer:

False

Explanation:

The issue of climate change is heavily debated through the public, so there is no such thing as a "common sense community"

a researcher was interested in baseball results for the minnesota twins and chicago cubs when they played at home and away. the results of the research show the following: which of the following explains how this is an example of simpson's paradox? a.) overall win rates are lower for the minnesota twins than the chicago cubs. b.) win rates were higher for the chicago cubs for both home and away games, but overall win rates are higher for the minnesota twins. c.) win rates were higher for the chicago cubs overall, but lower for home games. d.) win rates were higher for away games overall but lower than home for the minnesota twins.

Answers

Simpson's paradox is win rates were higher for the Chicago Cubs for both home and away games, but overall win rates are higher for the Minnesota Twins. Here option B is the correct answer.

Simpson's paradox is a phenomenon where a trend appears in different groups of data but disappears or reverses when these groups are combined. In this example, the researcher is interested in comparing the win rates of the Minnesota Twins and the Chicago Cubs for both home and away games.

This is an example of Simpson's paradox because the trend of the Cubs having a higher win rate for both home and away games disappears when the results are combined. The overall win rates for the Twins are higher even though the Cubs have higher win rates in both home and away games.

This paradox occurs because the number of games played at home and away might be different, which can cause the overall trends to appear different from the trends in the separate groups of data.

To learn more about Simpson's paradox

https://brainly.com/question/28447378

#SPJ4

if you got shocked and that experience with shock later produced a startle response to an unrelated sound, what is the response to the sound called?

Answers

The response to the sound called wire floor the tendency to defend oneself overcomes the tendency to attack in avoidance behaviour, which is a type of behaviour used by animals exposed to unpleasant stimuli.

Avoidance behaviours include any actions people use to avoid or refocus their attention on difficult concepts, feelings, or situations. Avoiding relationships, social situations, career advancement.

New job opportunities, leisure activities, and family gatherings may be one way to show this. On the other side, an avoidance mentality is a more controlled response. It demonstrates the dog's choice to stay in a particular setting even while it isn't yet ready to fully interact (or to understand that they cannot leave the circumstance). Pressing a lever by lab rats results in a reward when there is a green light.

To know more about wire floor visit:

https://brainly.com/question/29059636

#SPJ4

which group saw an expansion of their voting rights in the early nineteenth century?

Answers

Answer:

In the early nineteenth century, political participation rose as states extended voting rights to all adult white men. During the 1820s, the Second Party system formed in the United States, pitting Jacksonian Democrats against Whigs.

A group of people all agree to paint a house together, which of the following would be considered an example of the free rider problem? One of the individuals does not to paint the house because they see that everybody else is None of the answers are correct Each individual takes turns painting the house Everybody paints the house everyday They make smaller groups of people who will paint different parts

Answers

The free rider problem refers to a situation where one or more individuals benefit from a collective effort or project without contributing their fair share.

In this case, if one individual chooses not to paint the house because they see that everybody else is doing it, it would be considered an example of the free rider problem.

This individual is benefiting from the efforts of the group without contributing their time and effort. On the other hand, if each individual takes turns painting the house or if they make smaller groups of people who will paint different parts, then they are all contributing their fair share to the project and the free rider problem is avoided.

To know more about free rider problem, refer to the link:

https://brainly.com/question/30751078#

#SPJ11

After much deliberation, you select a college to enroll yourself. After you have made your decision, you can reduce dissonance by _____ the chosen university and _____ the unchosen universities.

Answers

The presence of cogntive dissonance can make you reduce your dissonance by upgrading the chosen university and downgrading the unchosen universities.

What is the cognitive dissonance theory?

The theory of cognitive dissonance asserts that a psychological tension is created when an individual's behavior is inconsistent with his or her thoughts and beliefs.

In conclusion, the word "upgrading" and "downgrading" is correct.

Read more about cognitive dissonance

brainly.com/question/8731157

javier is a 25 year-old, unmarried man who is not really sure what he wants to do with his life. in what stage of development is javier?

Answers

Javier is in the early stages of maturity. Emerging adulthood refers to the time of growth between the ages of 18 and 29.

Why is young adulthood so crucial?

Individuals start to acquire the traits needed to become self-sufficient during this period, participate in adult, committed relationships, take on more adult tasks and responsibilities, and complete a degree of training and education that lays the groundwork for employment during the adult years.

What is the main goal of becoming an adult?

Emerging adults focus on themselves throughout this period of time as they acquire the information, skills, the self-understanding they will need for adult life, which is the transitional period between adolescents' dependency on parents and adults' long-term commitments to love and work.

To know more about emerging adulthood visit:

https://brainly.com/question/10682673

#SPJ4

Which of the following statements are false?
I. The three pillars of sustainability are ecology, environmental and economic.
II. Keynesian thinking argued that the government should take an active role in promoting trade and industry. III. The mercantilists argued that the profit motive led firms to produce, as if by an invisible hand, what was most desired in the
best possible way.
IV. Changes in technology will alter the production possibilities schedule.

Answers

The mercantilists argued that the profit motive led firms to produce, as if by an invisible hand, what was most desired in the best possible way is false. Correct option is 3.

The 16th to 18th centuries saw the rise of mercantilism, an economic ideology that emphasised building riches through commerce and protectionist measures. It placed a strong emphasis on government regulation and involvement in economic affairs, including encouraging exports and limiting imports to preserve a favourable trade balance. Mercantilism is not linked to Adam Smith's laissez-faire economics theory, which is where the idea of the "invisible hand" comes from.

The following claims are accurate:

I. The ecological, environmental, and economic pillars of sustainability are interconnected. Ecological sustainability (preserving and conserving natural ecosystems), environmental sustainability, and social sustainability are sometimes seen as three interconnected facets of sustainability.

II. The government should actively promote commerce and industry, according to Keynesian theory. John Maynard Keynes, the creator of Keynesian economics, favoured government intervention in the economy during recessionary times.

IV. The manufacturing possibility timeline will change due to technological advancements. The production possibilities schedule, which depicts the combinations of goods and services that can be produced with given resources and technology, can be affected by technological breakthroughs. Technology improvements have the ability to expand the frontier of production possibilities, enabling more productive manufacturing and possibly expanding the variety of products and services that can be produced.

To know more about mercantilists:

https://brainly.com/question/14385474

#SPJ4

if your mother gives you a kiss goodbye this is considered a second-order reality

Answers

The concept of second-order reality refers to the interpretation of our experiences through the lens of cultural and social norms. In this case, if a mother giving a kiss goodbye is considered a norm in a particular culture or society, then it would be considered a second-order reality.

However, if a mother giving a kiss goodbye is not a common practice in a certain culture or society, then it would not be considered a second-order reality.

The interpretation of experiences through the lens of cultural and social norms is important because it shapes our understanding and perception of the world around us. It also influences our behavior and interactions with others.

Therefore, understanding second-order reality can help us to be more aware and respectful of cultural differences and practices.

In summary, whether or not a mother giving a kiss goodbye is considered a second-order reality depends on the cultural and social norms of the context in which it occurs.

To know more about interpretation refer here

https://brainly.com/question/28235829#

#SPJ11

The term ____________ is used to describe forms in the natural world that most people would find recognizable even if the maker has not rendered the details with meticulous realism.

Answers

Answer:

The term representational is used to describe forms in the natural world that most people would find recognizable even if the maker has not rendered the details with meticulous realism. ... Nonobjective art is often used as a synonym for realism, and begins with objects in the visible world.

Explanation:

The term representational is used to describe forms in the natural world that most people would find recognizable even if the maker has not rendered the details with meticulous realism.

What do you understand about representational art?

Representational art refers to that art which describes artworks, particularly paintings and sculptures, that are derived from real object sources, and therefore are by definition representing something with strong visual references to the real world and it is art that is identifiable as something which already exists in life.

Most, but not all, abstract art is based on imagery from the real world. The most extreme form of abstract art is not connected to the visible world and is known as nonrepresentational. Representational art which is also called figurative art represents objects or events in the real world, usually looking easily recognizable.

For instance, a painting of a cat looks very much like a cat, it's quite obvious what the artist is depicting.

Learn more about representational, here:

https://brainly.com/question/5655237

#SPJ2

3. Explain what Carnegie, Rockefeller and Vanderbilt had in common.

Answers

Answer:

These men rose from obscurity—even poverty—to become giants. They are visionaries, and the greatest asset these men have in common is their ability to imagine the future and see how they can triumph within it. This is not a “warm fuzzies” rags-to-riches tale, however. To reach the pinnacles they see for themselves, they must be utterly ruthless, letting nothing and no one come between them and their dreams.

Explanation:

haden and bethany are an ideal couple in the neighborhood. they are highly satisfied on all dimensions of their life together and are complacent with whatever they have. they maintain a cordial relationship and resolve all their conflicts between themselves. according to the enrich analysis, haden and bethany are a .

Answers

Haden and Bethany are an ideal neighborhood match. They are very satisfied in all dimensions of their life together and are accommodating with everything around them.

They are very satisfied in all dimensions of their life together and are complacent with what they have. They maintain a cordial relationship. They maintain a cordial relationship and resolve all their conflicts with each other. They maintain a cordial relationship and resolve all their conflicts with each other. According to the ENRICH analysis, haden and bethany are a vitalized couple. homogamy is marriage or other relationship. among people with similar characteristics, socioeconomic status, and ethnicity. economists call selective mating what sociologists call homogamy. people tend to choose their partners within their own social, cultural, ethnic, or religious background.

To learn more about accommodating please click on below link.

https://brainly.com/question/28259021

#SPJ4

Which branch of government in texas generally has the most power? question 1 options: executive judicial legislative municipal

Answers

In Texas, the legislative branch of government typically holds the most influence. The legislative branch is responsible for drafting and approving laws. They have the power to veto a president's veto, declare war, and control the flow of money.

Who or what is the government?

The legislative, executive, and judicial branches of the federal government are respectively vested with authority by the U.S. Constitution in Congress, the President, and the Federal courts.

What are the government's top three priorities?

Governments regularly consider their constituents' pleasure and well-being, protect them from intrusion from the outside world, and define the standards for citizens' behaviour on a daily basis. legislation; making laws (Congress, comprised of the House of Representatives and Senate) acts as an executive to carry out legislation (president, vice president, Cabinet, most federal agencies) Assesses laws in the judiciary (Supreme Court and other courts).

To know more about government  visit-

brainly.com/question/16940043

#SPJ4

a massive amount of cultural information can be found both in books and on the internet. which aspects make books different from online information?

Answers

Books differ from online information in their tangibility, physicality, fixed content, and stability, while online information offers accessibility, immediacy, interactivity, and frequent updates.


Books offer a tangible, physical experience, which can be appealing to many readers. They allow readers to hold, feel, and flip through pages, often offering a sense of accomplishment upon completion.

Books have fixed content, meaning the information within remains unchanged unless a new edition is published. This stability can be advantageous for preserving information over time.

Online information, on the other hand, is easily accessible to a vast audience with internet access, and can be instantly updated or edited. This immediacy allows for the rapid dissemination of new information, but can also lead to a lack of stability in the content.

Online information also allows for interactivity, such as hyperlinks and multimedia elements, which can enhance understanding and engagement. However, the credibility of online sources can sometimes be questionable, making it crucial to verify the accuracy of the information presented.

To know more about hyperlinks click on below link:

https://brainly.com/question/23413848#

#SPJ11

If someone accuses a judge of having "run amok" or "subverting the laws," he or she is probably accusing the judge of what?
a. improper sentencing
b. campaign finance fraud
c. being an activist judge
d. changing the constitution

Answers

If someone accuses a judge of having "run amok" or "subverting the laws," they are probably accusing the judge of (C) being an activist judge. The term "activist judge" is often used to describe a judge who is perceived to be interpreting the law in a way that goes beyond the intended role of a judge and actively shaping or influencing legal outcomes based on personal beliefs or ideologies.

Accusing a judge of "running amok" or "subverting the laws" suggests that the judge is departing from established legal principles and using their position to advance a particular agenda rather than strictly adhering to the law.

This accusation implies that the judge is not impartially applying the law but is instead making decisions based on personal biases or political motivations. It suggests that the judge may be prioritizing their own opinions and beliefs over the objective interpretation of the law. Accusing a judge of being an activist judge can be seen as a critique of their approach to judicial decision-making and their willingness to go beyond the traditional role of a judge to actively shape legal outcomes.

While improper sentencing, campaign finance fraud, and changing the constitution can also be serious accusations against a judge, accusing them of "running amok" or "subverting the laws" specifically points to the perception that the judge is engaging in judicial activism, using their position to pursue a particular agenda rather than upholding the integrity of the legal system.

To know more about judge visit :

https://brainly.com/question/16726610

#SPJ11

according to the activation-synthesis hypothesis, neural stimulation from which part of the brain is responsible for the random signals that lead to dreams? hippocampus thalamus frontal lobe pons occipital lobe

Answers

According to the activation-synthesis hypothesis, neural stimulation from which part of the brain is responsible for the random signals that lead to dreams is Thalamus.

The activation-synthesis hypothesis is a neurobiological theory of dreams. It was proposed by J. Allan Hobson and Robert McClarley in 1977, and it states that dreaming is a result of the brain's internal signals being interpreted as sensory input while the brain is in a state of rapid eye movement (REM) sleep.

Neural stimulation from the thalamus is responsible for the random signals that lead to dreams. The thalamus is the part of the brain that processes sensory information and sends it to the cortex. During REM sleep, the thalamus is active and sends random signals to the cortex, which then interprets these signals as sensory input. The activation-synthesis hypothesis proposes that these random signals are then interpreted by the brain as a dream.

In other words, dreams are the result of the brain's attempt to make sense of the neural activity that occurs during REM sleep. Therefore, according to this hypothesis, the thalamus is responsible for generating the random signals that lead to dreams.

To know more about Thalamus
https://brainly.com/question/5124816
#SPJ11

Which of the following statements best describes the spread of Islam during the Arab conquests?

A.
Islam spread only within the lands conquered by Arabs.

B.
Everyone in conquered lands was forced to convert to Islam.

C.
Few non-Arabs ever converted to Islam.

D.
Islam spread inside and outside the new Arab Muslim empire.

Answers

The spread of Islam during the Arab conquests can best be described as D. Islam spread inside and outside the new Arab Muslim empire.

How did Islam spread ?

During the Arab conquests of the 7th and 8th centuries, Islamic armies rapidly expanded the territory of the new Arab Muslim empire, which stretched from Spain to India.

While many of the conquered peoples eventually converted to Islam, they were not forced to do so, and many remained practicing Christians, Jews, Zoroastrians, and others. In fact, Islamic law explicitly forbids forced conversion, and throughout history, many people have converted to Islam voluntarily.

Find out more on Arab conquests at https://brainly.com/question/28843840

#SPJ1

What happened to the first civilization developed in Mesopotamia?

Answers

Answer:

Babylonian culture is considered to have ended under Persian rule, following a slow decline of use in cuneiform and other cultural hallmarks. By the time Alexander the Great conquered the Persian Empire in 331 B.C., most of the great cities of Mesopotamia no longer existed and the culture had been long overtaken.

Explanation:

a basketball has a volume of 5600cm³. find its radius​

Answers

Answer:

Given:-

Volume of a basketball=\(\sf 5600cm^3 \)

To find:-

Radius

Solution:-We know basketball is a sphere We know that in a sphere

\({\boxed {\sf Volume=\dfrac {4}{3}\pi r^3 }}\)

Substitute the values

\(\qquad{:}\longrightarrow\)\(\sf \dfrac {4}{3}\times \dfrac {22}{7}\times r^3=5600 \)

Simplify

\(\qquad{:}\longrightarrow\)\(\sf \dfrac {88}{21}r^3=5600 \)

\(\qquad{:}\longrightarrow\)\(\sf r^3=5600\times \dfrac {21}{88}\)

\(\qquad{:}\longrightarrow\)\(\sf r^3=\dfrac {5600×21}{88}\)

\(\qquad{:}\longrightarrow\)\(\sf r^3=\dfrac{117600}{88}\)

\(\qquad{:}\longrightarrow\)\(\sf r^3=1336.36 \)

\(\qquad{:}\longrightarrow\)\(\sf r=\sqrt [3]{1336.33}\)

\(\qquad{:}\longrightarrow\)\(\sf r=11.01 \)

\(\qquad{:}\longrightarrow\)\(\sf r=11cm (Approx)\)

\(\therefore\sf radius \:of \;basketball\:is\:11cm.\)

Suppose that in an economy the structural unemployment rate is 2.2 percent, the natural unemployment rate is LO6 MO4 percent, and the cyclical unemployment rate is 2 percent. The frictional unemployment rate is _________ percent and the actual unemployment rate (in this economy) is ___________ percent.

Answers

Answer: 3.1%; 7.3%

Explanation:

Suppose that in an economy the structural unemployment rate is 2.2 percent, the natural unemployment rate is 5.3 percent, and the cyclical unemployment rate is 2 percent. The frictional unemployment rate is 3.1 percent and the actual unemployment rate (in this economy) is 7.3 percent.

1. Natural Unemployment rate = Structural Unemployment + Frictional Unemployment

5.3% = 2.2% + Frictional Unemployment

Frictional Unemployment = 5.3% - 2.2%

= 3.1%

2. Actual Unemployment = Cyclical Unemployment + Natural Unemployment

= 2% + 5.3%

= 7.3%

What was the strategy of the USSR to spread communism to the rest of the world?

Answers

Answer: During World War II, the United States and the Soviet Union fought together as allies against the Axis powers. However, the relationship between the two nations was a tense one. Americans had long been wary of Soviet communism and concerned about Russian leader Joseph Stalin’s tyrannical rule of his own country. For their part, the Soviets resented the Americans’ decades-long refusal to treat the USSR as a legitimate part of the international community as well as their delayed entry into World War II, which resulted in the deaths of tens of millions of Russians. After the war ended, these grievances ripened into an overwhelming sense of mutual distrust and enmity. Postwar Soviet expansionism in Eastern Europe fueled many Americans’ fears of a Russian plan to control the world. Meanwhile, the USSR came to resent what they perceived as American officials’ bellicose rhetoric, arms buildup and interventionist approach to international relations. In such a hostile atmosphere, no single party was entirely to blame for the Cold War; in fact, some historians believe it was inevitable. By the time World War II ended, most American officials agreed that the best defense against the Soviet threat was a strategy called “containment.” In his famous “Long Telegram,” the diplomat George Kennan (1904-2005) explained the policy: The Soviet Union, he wrote, was “a political force committed fanatically to the belief that with the U.S. there can be no permanent modus vivendi [agreement between parties that disagree].” As a result, America’s only choice was the “long-term, patient but firm and vigilant containment of Russian expansive tendencies.” “It must be the policy of the United States,” he declared before Congress in 1947, “to support free peoples who are resisting attempted subjugation…by outside pressures.” This way of thinking would shape American foreign policy for the next four decades.

Explanation: hopes this helps

Do you agree that pre-modern people are "close to nature" and caused little environmental damage? Why or why not? Discuss the contribution of pre-modern people in the evolution of environmental management.

Answers

While pre-modern people had a deep connection with nature and practiced sustainable environmental management, it would be inaccurate to assume that they caused little environmental damage. Their close relationship with the environment allowed them to develop practices that minimized negative impacts, but they were not entirely immune to causing ecological changes. However, their contributions in the evolution of environmental management lie in their knowledge, practices, and philosophies that emphasized the importance of ecological balance, sustainable resource use, and conservation.

Pre-modern people, due to their reliance on the natural world for survival, developed a keen understanding of the environment and its interconnectedness. They adopted practices such as rotational farming, selective harvesting, and controlled burning to maintain the health of ecosystems and ensure long-term resource availability. These practices demonstrated their awareness of the need for sustainable resource management. However, it is important to acknowledge that pre-modern societies were not without their environmental impacts. Population growth, expansion of settlements, and certain resource-intensive activities could still lead to localized environmental degradation.

The true significance of pre-modern people's contribution lies in their philosophies and cultural values that emphasized the interconnectedness and reverence for nature. They recognized the importance of maintaining ecological balance and passed down this wisdom through generations. In the evolution of environmental management, these perspectives have been integrated with modern scientific knowledge and techniques to develop holistic and sustainable approaches.

The lessons learned from pre-modern people's practices continue to inform contemporary environmental management strategies, highlighting the value of their contributions. It is crucial to draw upon their wisdom and combine it with scientific advancements to address the complex environmental challenges we face today.

To know more about Pre-modern people :

brainly.com/question/33585879

#SPJ11


Select the correct answer.
In what way were President Abraham Lincoln's and President Andrew Johnson's Reconstruction plans similar?
A.
Both reserved seats in the Congress for former Confederate war leaders.
B.
Both granted voting rights to the newly freed slaves.
c.
Both refused to grant amnesty to rich plantation owners from the South.
D.
Both required Southerners to support the Thirteenth Amendment to abolish slavery.

Answers

Answer:

the answer is D

Explanation:

Answer:

D.  Both required Southerners to support the Thirteenth Amendment to abolish slavery.

Explanation:

What was one indication that Loyalists and Patriots had different points of view about independence during the American
Revolution?
OA. Patriots attempted to execute anybody that remained loyal to the British king.
OB. Loyalists chose to establish separate colonies in areas belonging to Great Britain.
OC. Many Patriots attempted to have the majority of Loyalists exiled to Great Britain.
OD. Many Loyalists chose to leave the United States to settle in British possessions.

Answers

Answer:d

Explanation:

Many Loyalists chose to leave the United States to settle in British possessions. This indicates that Loyalists did not support the idea of American independence and were willing to remain loyal to the British crown. Thus, option D is correct.

What were Loyalists?

Loyalists were American colonists who remained loyal to the British crown during the American Revolution. They opposed the idea of American independence and continued to support the British government.

Loyalists were diverse in their background, social status, and political beliefs, but they generally feared the potential chaos and instability that could result from a break with Britain. During the war, Loyalists faced persecution, confiscation of property, and other forms of punishment from Patriots who viewed them as traitors.

Many Loyalists eventually fled the colonies to seek refuge in other British possessions, such as Canada or the Caribbean. After the war, Loyalists who remained in the United States faced challenges in rebuilding their lives and reconciling with their former opponents.

Learn more about Loyalists here:

https://brainly.com/question/14256898

#SPJ2

“Faustulus had suspected from day one that the twins were royalty. . . . Numitor also discerned the truth.”
As used in the passage, what does the word "discerned" mean?

rejected
misunderstood
recognized
denied

Answers

The word "discerned" in the passage mostly means "recognized". The Option C is correct.

What does the word "discerned" mean in the passage?

In the passage, both Faustulus and Numitor were able to recognize that the twins were royalty, so, the word "discerned" implies that Numitor was able to perceive the truth about the twins' identity despite any doubts or uncertainties.

So, this suggests that he used his insight or judgment to arrive at this conclusion. This word choice helps to convey the idea that recognizing the truth was not a straightforward process but required careful observation and analysis.

Read more about discerned

brainly.com/question/1585363

#SPJ1

Which statements are true regarding a traditional individual retirement account? Choose three answers. Employers create them and match employee contributions. People can contribute to the account until retirement age. People can withdraw money penalty-free at any time. Contributions to the account are limited each year. Contributions reduce taxable income.

Answers

The true statement about this account is that people can contribute to the account until retirement age.

The Traditional individual retirement accounts is one which allow contribution to the account where investments grow tax-deferred until withdrawal during retirement period.

This type of retirement accounts is popular because they are not taxed until retirement.

Hence, the true statement about this account is that people can contribute to the account until retirement age.

Therefore, the Option B is correct.

Read more about Traditional IRAs

brainly.com/question/1637877

Answer:

1. People can contribute to the account until retirement age. 2. Contributions to the account are limited each year. 3. Contributions reduce taxable income. Answers: B, D, E

Explanation:

It can't be "People can withdraw money penalty-free at any time." because withdrawing too early from a IRA with result in 10% early withdrawal penalty.

Event based prospective memories are NOT cued by which of the following? opioid levels People Specific events Objects

Answers

The answer to the given question is that the event based prospective memories are NOT cued by opioid levels.

Opioid is a type of drug that is known to affect the memory system. However, the event-based prospective memory is a part of the prospective memory system that is not affected by the opioid levels.What are the Event-based prospective memories?Event-based prospective memory is a type of memory system that helps the brain to remember and perform actions based on the occurrence of a specific event. This type of memory system is based on the need to remember an action at the time of the occurrence of a specific event.In other words, it is an action that we remember to perform when a specific event happens. This type of memory system is a part of the prospective memory system.What is the prospective memory system?The prospective memory system is a type of memory system that helps the brain to remember and perform actions in the future. It is the opposite of the retrospective memory system, which is responsible for remembering events that happened in the past.The prospective memory system is a part of the memory system that helps the brain to remember and perform actions that are planned for the future. The event-based prospective memory system is a type of memory system that helps the brain to remember and perform actions based on the occurrence of a specific event.What is an opioid?Opioid is a type of drug that is known to affect the memory system. It is a type of drug that is used to treat pain. Opioid is a type of painkiller that works by blocking pain signals from reaching the brain. It is a powerful drug that is known to have side effects like memory loss.Therefore, the given statement is true that event-based prospective memories are not cued by opioid levels

To know more about memories visit.;

brainly.com/question/28198875

#SPJ11

Other Questions
how does drama arts relate to veterinarians True or False Christianity only really spread through the Roman Empire. What is the measure of line AD The points (p, -2) and (6, 8) fall on a line with a slope of -10. What is the value of p?Thank you! water flows into the source end of a sieve tube because _____. Something is wrong with my dogHes not a catcan anyone help me please. 70% of the shoes in the UK are made abroad. if you survey 120 people about the shoes they are wearing, how many do we expect to have UK-made shoes? What is the slope of the line?3(y - 1) = 2r + 2 Drag the tiles to the correct boxes to complete the pairs.Match the individuals with the correct descriptions.TilesJacobo ArbenzPairsFulgencio BatistaFidel Castrocommunist leader of Cuba from 1959 onwardSocialist leader of Guatemala in the 1950sSoviet premier during the Cuban Missile Crisisanti-communist leader who ruled Cuba from 1952 to 1959Nikita Khrushchev1000 Question 1 with 5 blanks La fiesta de disfraces - Hola, Adrin. (1) You answeredvasvasIncorrect or extra word (ir) a la fiesta de disfraces ayer? - No, (2) You answeredestoyestoyIncorrect or extra word (estar) muy enfermo. Y t, Pablo? - S, yo s (3) You answeredvoyvoyIncorrect or extra word (ir). - Y (4) You answeredvasvasIncorrect or extra word (estar) mucho tiempo? - No, no mucho. Yo (5) You answeredtengotengoIncorrect or extra word (tener) que irme pronto para cuidar a mi hermana pequea. please help! precalculus (concavity and graphing) A local department store can sell 100 gaming systems at a price of $180 each. Researchshows that for each $18 price increase, the store will sell 4 fewer systems, and vice versa.a. Find a linear price equation for the gaming system. That is, express the price, p, as afunction of the quantity, q. (2 points)b. Use your answer from (a) to find the revenue equation. c. Use your knowledge of quadratic functions to find the price and quantity sold that will maximize revenue. A seat on a Ferris wheel is level with the center of the wheel. The diameter of the wheel is 200 feet. Suppose thewheel rotates 60, causing the height of the seat to decrease. How much closer to the ground is the seat after therotation?O 50 feetO 50 feetO 100 feetO 100v3 feetMark this and returnSave and ExitNextSubmit Find the x-intercept and the y-intercept of the graph of the equation. 2x + 3y = 18 what is 5-3-424-22+422453214 After you install windows xp mode and windows virtual pc, their shortcuts display on the windows 7 ________. Jorges mom invested $8,000 dollars into a savings account for him to use to start a business once he graduated from college. If the account accrues interest continuously at a rate of 3.75%, how much money will be in the account in 30 years? Help would be much appreciated! :) Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG Hindus believe that all of their gods are part of a universal spirit called *1.Siva2.Vishnu3.Brahman4.Atman