The brachial plexus provides motor and sensory innervation to the upper limb. It is a network of nerves that originates from the spinal cord in the neck region (C5-T1) and supplies the muscles and skin of the upper limb.
The brachial plexus is formed by the ventral rami of the spinal nerves and is divided into five main branches: the musculocutaneous nerve, axillary nerve, radial nerve, median nerve, and ulnar nerve. These nerves innervate the muscles that control movement of the shoulder, arm, forearm, and hand, as well as provide sensory information from the skin of the upper limb.
To know more about musculocutaneous nerve
brainly.com/question/7496424
#SPJ4
use uterus and vagina in the same sentece
The main regulatory protein of secondary hemostasis and inhibitor of serine protease is:_________
Answer:
Antithrombin
Explanation:
Antibiotic resistance genes in bacteria can be transferred by ______ gene transfer.
Horizontal
Antibiotic resistance genes in bacteria can be transferred by horizontal gene transfer.
What is horizontal gene transfer?The dissemination of antibiotic resistance genes among bacteria (aside from those that are passed from parent to child) is a result of horizontal gene transfer (HGT), which also promotes the evolution of pathogens.How do genes for antibiotic resistance function?Once a bacteria has acquired a resistance gene and incorporated it into its DNA, the bacterium can dominate other bacteria and convey the resistance gene to all of its offspring. Bacteria reproduce quickly, which amplifies resistance.What three kinds of horizontal gene transfer do bacteria engage in?Bacteria can transfer genes horizontally through transformation, transduction, and conjugation. Conjugation is the most prevalent method of horizontal gene transfer among bacteria, particularly from one donor bacterial species to another.Give an example for horizontal gene transfer?In multicellular organisms, horizontal gene transfer can happen in a number of different ways. For instance, in plants, HGT can function naturally through host-parasite interactions. By serving as a vector, the parasite spreads mitochondrial DNA between two different plant species.To learn more about antibiotic resistance visit:
https://brainly.com/question/21476329
#SPJ4
Why is astrology referred to as a pseudoscience?
Answer:
Astrology has not demonstrated its effectiveness in controlled studies and has no scientific validity, and is thus regarded as pseudoscience.
Explanation:
How do catalysts affect a chemical reaction?
Answer:
Compounds that increase the rate of a reaction are catalysts. By reducing the energy of the rate-limiting transition state, catalysts accelerate reactions. Catalysts do not influence a reaction's equilibrium state.
Catalysts generally affect a chemical reaction by increasing its reaction rate by lowering the activation energy of the reaction. Catalysts are widely used to enhance the rate of any chemical reaction without changing the product.
What are Catalysts?A Catalyst may be defined as a substance that overall changes the rate of reaction without being consumed in a reaction.
The catalysts are widely used when the rate of a given chemical reaction is not considerably altered by changing various conditions such as temperature, concentration, pH, etc., of the reactants.
Such new substances are brought which are not directly involved in the reaction and are mixed. And they finally made alterations in the given chemical reaction. Such new substances are known as a catalyst.
The process by which a catalyst changes the reaction rate without being involved in it is known as catalysis.
Therefore, catalysts generally affect a chemical reaction by increasing its reaction rate. Catalysts are widely used to enhance the rate of any chemical reaction without changing the product.
To learn more about Catalysts, refer to the link:
https://brainly.com/question/12507566
#SPJ5
Giving brainiest 5stars and tys and a follow ty
*if one strand of DNA molecule reads ATCCGACCAGCTA, what will its complementary strand look like?
Please help me this is a final and im having a panic attack.
Answer:
TAGGCTGGTCGAT, or B.
Explanation:
A -> T
G -> C
5->3
HELP GIVING POINTS WILL GIVE LOTS OF POINTS
Answer:
1. Interphase
2. Chromatin
3. Chromosomes
4. The equatorial plane
5. Anaphase
6. Cytokinesis
7. nucleolus
8. Interphase
9. The centromere of each pair of sister chromatids
10. Prophase
How is ocean and space exploration similar?
I give out brainlist
When Mendel first crossed a purebred tall pea plant with a purebred short pea plant he called these two plants the parental (P) generation.
True
or
False
Answer:
true
Explanation:
they were the original plants
A company has an inventory of 1,400 assorted parts for a line of missiles that has been discontinued. The inventory cost is $74,000. The parts can be either (a) remachined at total additional costs of $27,500 and then sold for $34,000 or (b) sold as scrap for $5,500. Which action is more profitable? Show your calculations.
The following are the calculations to solve the problem that involves a company that has an inventory of 1,400 assorted parts for a line of missiles that has been discontinued. The inventory cost is $74,000.
The parts can be either (a) remained at a total additional cost of $27,500 and then sold for $34,000 or (b) sold as scrap for $5,500.
Let us solve the problem in the following steps:
Step 1: Calculate the Profitability of Option A - re-machining
Solution:
Total Cost of Remachining= $74,000 + $27,500 = $101,500
Profit from Selling= $34,000*1400 = $47,600,000
Profitability= Profit from Selling - Total Cost of Remachining= $47,600,000 - $101,500= $47,498,500 Step
2: Calculate the Profitability of Option B - Selling as Scrap
Solution:
Profitability of Selling as Scrap = $5,500*1,400= $7,700,000 Comparing the two options, Option A is more profitable than Option B as shown below: Option A: $47,498,500Option B: $7,700,000.
Therefore, the company should go for Option A and machine the parts for a profitable business venture.
To learn more about inventory here
https://brainly.com/question/31146932
#SPJ11
HELO ME PLEASE IM BEING TIMED
Scientific law provides descriptions. O True O False
Answer:
true
Explanation:
Answer:
its true
Explanation:
Scientific theories explain why something happens, but scientific law describes what happens.
what type of bonds hold the nitrogenous bases together in dna
Answer:
Glycosidic bondExplanation:
The glycosidic bond in DNA is the nitrogen-carbon coupling in between the 9′ nitrogen of purine bases (Adenine/Guanine) or the 1′ nitrogen of pyrimidine bases (Cytosine/Thymine) as well as the 1′ carbon of the deoxyribose sugar group. The synthesis of nucleoside arises from the binding of the nitrogenous base to the deoxyribose sugar via N-glycosidic linkage.
In which region of the nephron is a steep osmotic gradient created?Hint 1.This segment acts as a countercurrent exchanger.ANSWER:a. Loop of Henle.b. Collecting duct.c. Proximal tubule.d. Distal tubule.
Option A is correct. Water and salts can be restored to the body thanks to the pronounced osmotic gradient produced by the Loop of Henle.
The nephrons of a human excretory system use a countercurrent multiplier, also known as a countercurrent mechanism, to concentrate urine inside the kidneys. The nephrons that are involved in the production of concentrated urine run alongside vasa recta from the renal cortex to the medulla. The term "countercurrent" refers to the fluid flowing in opposing directions in the adjacent descending and ascending loops. system of countercurrent multipliers The formation of concentrated urine inside the collecting ducts of a nephrons is caused by an active process taking place in the kidney's Henle loops.
Learn more about “ Loop of Henle ” visit here;
https://brainly.com/question/13148548
#SPJ4
Think about how sunlight provides the energy neccssary to all living organisms on Earth. Think also about how the Sun's gravity holds the Earth and the other planets securely in their orbits. Write at least a panigraph.
Sunlight is a fundamental force that sustains life on Earth, providing the energy necessary for all living organisms to thrive. Its radiance illuminates our world, driving photosynthesis and enabling the growth of plants that form the foundation of various ecosystems.
From the towering trees of dense forests to the delicate blooms in meadows, sunlight fuels the intricate web of life, as organisms harness its energy to carry out vital biological processes.
Beyond its role as an energy source, the Sun's gravitational pull plays a crucial role in maintaining the stability and harmony of our solar system. The immense gravitational force exerted by the Sun holds Earth and the other planets securely in their orbits, preventing them from spiraling off into space. This celestial dance orchestrated by gravity ensures the precise positioning of celestial bodies, allowing for the rhythmic cycles of days, seasons, and years that shape our planet's environment.
The intricate interplay between sunlight and gravitational forces showcases the remarkable interconnectedness and balance that exists in the cosmos. The Sun's radiant energy powers the vibrant tapestry of life on Earth, while its gravitational embrace maintains order within our planetary system. Together, they shape our understanding of the universe and remind us of the awe-inspiring forces that shape our existence.
learn more about Sunlight here
https://brainly.com/question/27183506
#SPJ11
original DNA: TACTTTAATCCCAAATTTACT
DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?
Answer:
substitution mutation
Explanation:
The original DNA sequence is: TACTTTAATCCCAAATTTACT
The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT
The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA
The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser
This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.
chief cells synthesize and secrete enzymes, primarily inactive ______, into the lumen of the stomach.
Chief cells synthesize and secrete enzymes, primarily inactive pepsinogen, into the lumen of the stomach.
Chief cells are a sort of specialized cell found in the interior of the lining of the stomach, especially the interior of the gastric organs found interior the fundus and body areas.
These cells are attempted and genuine for discharging a grouping of chemicals and other substances that offer assistance to break down nourishment interior the stomach.
Within the improvement of pepsinogen, chief cells as well transmit other chemicals such as gastric lipase, which is included inside the retention of fats, and renin, which makes a separation to arrange depleted proteins in infant child children.
By and huge, the overflowing of these chemicals by chief cells may be a crucial separation of the stomach-related course of activity, making a separation to break down food and remove supplements that can be ingested and utilized by the body.
to know more about chief cells refer to this :
https://brainly.in/question/15587593
#SPJ4
Light energy is converted into chemical energy or food in the?
A. folds of the mitochondria of plant and animal cells
B. nuclei of plant and animal cells
C. ribosomes of animal cells
D. chloroplasts of plant cells
E. both a and c
PLSS HELP ASAP!!
Describe how photosynthesis transforms energy from sunlight to chemical energy?
Answer:
Most life on Earth depends on photosynthesis.The process is carried out by plants, algae, and some types of bacteria, which capture energy from sunlight to produce oxygen (O2) and chemical energy stored in glucose (a sugar). Herbivores then obtain this energy by eating plants, and carnivores obtain it by eating herbivores.
Explanation:
is pluto a planet if not why
Pluto is a dwarf planet because it did not meet the three criteria the IAU uses to define a full-sized planet.
Name some of the sites occupied by early farmers from the Neolithic culture
Some sites are:
Mesopatamia, and Epipalaeolithic,
Assume that diflerent groups of couples use a particular method of gender selection and each couple gives birth to one baby. This method is designed to incease the likethood that each baty wil be a girl, but assume that the method has no effect, so the probabilfy of a git is 0.5. Assume that the grougs consict of 42 couples, Complete parts (a) through (c) below. a. Find the mean and the standard deviation for the numbers of girs in groups of 42 bethes The value of the mean is μ= (Type an integer or a decimal Do foc round) The value of the standard deviation is σ= (Round to one decimal place as needed) b. Use the range rule of trumb to thd the values separaspy sesuse that are significantly iow or significantly high. Wesues of girs of fewor are significantiy tow (Fiound to one decimal place as needed.) Values of gifis of greater are significanty high. RRound to one decinal place as needed ) the resut tigrifcarey high, becalse 33 gits is gits A result of 39 gris would sugoest that the method
A. The mean is μ=21; the standard deviation is σ=3.2
B. Values of 14.5 girls or fewer are significantly low.
Values of 27.5 girls or greater are significantly high.
C. The result is significantly high, because 39 girls is greater than 27.5 girls. A result of 39 girls would suggest that the method is effective.
How do we solve for the standard deviation in the method of gender selection?a) The mean and standard deviation for the numbers of girls in groups of 42 births:
μ = np = 42 × 0.5 = 21.
σ = √(np×(1-p)) = √(42×0.5 × 0.5) = 3.24.
b) The range rule of thumb (also known as the empirical rule) states that for a normal distribution, nearly all of the data falls within three standard deviations of the mean. The range is then given by μ±2σ.
Significantly low: μ - 2σ = 21 - 2×3.24 = 14.5.
Significantly high: μ + 2σ = 21 + 2×3.24 = 27.5.
c) A result of 39 girls is significantly high, as it is greater than the upper range value of 27.5.
The result is significantly high, because 39 girls is greater than 27.5 girls. A result of 39 girls would suggest that the method is effective.
Find more exercises on solving for standard deviation ;
https://brainly.com/question/12402189
#SPJ1
What is white light?
A. The type of light that is found in x-rays.
B. The type of light given off by the sun and light bulbs.
C. The type of light that is used in microwave ovens.
D. The type of light that makes up radio waves.
Some anaerobic prokaryotes use other terminal electron acceptors other than O2. Using standard reduction potentials listed in Table 14-4 and assuming 100% efficiency, how much ATP could be synthesized by the oxidation of 1 molecule of NADH by the following? Show calculations.
Nitrate (NO3-)
Elemental Sulfur (S)
How does this compare to the oxidation of NADH by ½ O2?
The oxidation of 1 molecule of NADH by nitrate (NO3-) would yield approximately 4.3 ATP molecules per NADH molecule due to its reduction potential at 0.54 V.
The standard reduction potential of elemental sulfur (S) is at 0.04 V and therefore in the oxidation of 1 NADH molecule, it would synthesize around 1.2 ATP molecules per NADH molecule. The oxidation of NADH by ½ O2 molecule yields approximately 2.5 ATP molecules per NADH molecule due to the reduction potential of oxygen at 0.82 V.
The amount of ATP molecules generated from each of the terminal electron acceptors in NADH oxidation show the significant influence that the reduction potentials of the different terminal electron acceptors have on the amount of ATP the bacteria can synthesize.
know more about oxidation here
https://brainly.com/question/13182308#
#SPJ11
Explain how a changed gene could result in the "black urine" trait in an infant with the genetic disease. Include the following information in your explanation:
⚫how a DNA alteration affects the protein produced by an infant with the genetic disorder. ⚫ how it is possible for two normal parents to produce an infant with the genetic disorder. ⚫ one type of DNA alteration that could result in the genetic disorder.
DNA provides the instructions for the formation of proteins, which are the building blocks of our bodies. When there is a DNA alteration or mutation, the instructions for building a protein may be changed, which can affect the final protein product.
What is a protein ?A protein is a large, complex molecule made up of chains of smaller molecules called amino acids. Proteins are found in every cell of every living organism and play a vital role in a wide range of biological processes.
Enzymes: catalyze chemical reactions in the body
Structural components: provide support and shape to cells and tissues
Hormones: regulate various bodily functions and processes
Transporters: move molecules and substances throughout the body
Antibodies: help defend against foreign invaders such as viruses and bacteria
Energy sources: can be broken down to release energy for cellular processes
Changes in the amino acid sequence, caused by genetic mutations or other factors, can alter the function of a protein and lead
To know more about protein visit :
https://brainly.com/question/29776206
#SPJ1
The chemical elements are made up of atoms. True False
Answer:
This statement is true. All chemical elements are made up of atoms because atoms can cause chemical reactions when chemical bonds are broken, also why certain chemicals exist.
3. If a mutation occurs on a segment of DNA that codes
for an enzyme, what is most likely to happen to the
enzyme?
A amino acid that is synthesized changes as a result, which may alter the structure of an enzyme's active site.
What is an easy way to define enzyme?A biological catalyst called an enzyme is usually always a protein. It promotes a certain chemical reaction inside the organism. The enzyme is continuously employed during the process and is not destroyed.
What is an example of an enzyme?Several instances include: Lipases: This class of digestive enzymes aids in the breakdown of lipids in the gastrointestinal tract. Hydrolyzes: Enzymes assists in the transformation of starches to sugars inside the salivary. The salivary enzyme maltose breaks down the sugar malted grains into glucose.
To know more about Enzyme visit:
https://brainly.com/question/14953274
#SPJ1
reading part:
When cells were first discovered, no one knew how
cells formed or where they came from. Some people
incorrectly thought that cells came from nonliving
matter. Now we know that one cells splits to form two
new, identical cells. Only when a sperm and embryo
combine to form a new cell, the embryo, is there an
exception to this rule. This is the last idea in the cell
theory, that all cells come from other cells.
Q: Where do new cells come from?
Answer:
i am not sure but I think
Explanation:
the body makes new cells from the old ones and if this isn't right I am so sorry
Here is an image of the mitochondria. Mitochondria numbers can differ between cell types based on the function of the cell. Which of these cells would contain the highest number of mitochondria? A) skin cell B) lung cell C) muscle cell D) red blood cell.
The cell organelle that produces most of the energy for cell functioning and growth is mitochondria. Mitochondria is a double membrane organelle that varies in number in cells.
The highest number of mitochondria is found in:
Option C) Muscle cells
The function of mitochondria can be explained as:
Muscle cells and tissues are bodily organizations that constantly and frequently move so to provide energy for the actions the muscle cells have the highest number of mitochondria.The skin and lungs cells vary in mitochondrial quantity and may contain hundreds or thousands. Some amount of cell requires more amount of energy as compared to others so the number of mitochondria in those cells will be more.The blood cell of mammals lack mitochondria in their structure.Therefore, muscle cells have the highest number of mitochondria.
To learn more about mitochondria follow the link:
https://brainly.com/question/1621719
Carbohydrates act as "ID cards"
for cells. Where are they located?
A.the exterior of cell walls
B.inside of the nucleus
C.attached to the rough ER
D.embedded in the cell membrane
\(\Huge{\boxed{\mathfrak\pink{\fcolorbox{pink}{p}{Solution}}}}\)
A. The Exterior of Cell Walls