Which ONE of the following statements is correct? Select one: Select one: a. The Binary-Weighted-Input Digital to Analogue Converter (DAC) uses a resistor network. The values of the input resistors ar

Answers

Answer 1

The Binary-Weighted-Input Digital to Analogue Converter (DAC) uses a resistor network. The values of the input resistors are not equal to one another. It is a high-speed DAC with low power dissipation and a simple architecture. The binary-weighted DAC has an R-2R ladder architecture, where each bit corresponds to a weighted resistor in the R-2R network.

In a binary-weighted DAC, the resistor values are not equal but follow a binary-weighted pattern. The most significant bit (MSB) has the largest value resistor, and the least significant bit (LSB) has the smallest value resistor. The advantage of this is that the R-2R network's overall resistance decreases as the number of bits increases. In summary, the correct statement is that the Binary-Weighted-Input Digital to Analogue Converter (DAC) uses a resistor network, and the values of the input resistors are not equal to one another.

To know more about architecture, visit:

https://brainly.com/question/20505931

#SPJ11


Related Questions

Does each box at the fruit stand contain a different fruit?



In [164]:



# Set all_different to "Yes" if each box contains a different fruit or to "No" if multiple boxes contain the same



fruit all_different = "No" all_different



Out[164]: 'No' In [165]: _




= ok.grade('q6_3')





~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Running tests

Answers

Answer:

yes

Explanation:

The value of the variable all_different is: all_different = No

Complete question

Does each box at the fruit stand contain a different fruit? Set all_different to True if each box contains a different fruit or to False if multiple boxes contain the same fruit.

Hint: You don't have to write code to calculate the True/False value for all_different. Just look at the inventory table and assign all_different to either True or False according to what you can see from the table in answering the question.

box ID  fruit name     count

53686   kiwi             45

57181   strawberry     123

25274   apple            20

48800   orange          35

26187   strawberry     255

57930   grape          517

52357   strawberry     102

43566   peach       40

all_different = ...

How to determine the true statement?

From the hint given, we can see that writing a code is not necessary.

All we need to do is to scan through the table.

From the given table, we can see that there are several fruits on the table.

These include peach, kiwi, grape, strawberry, etc.

Since the fruits are different, then the value of the variable all_different is:

all_different = No

Read more about boolean variables at:

https://brainly.com/question/18089222

#SPJ2

Need the answer ASAP PLZ!!!! I’ll mark brainliest if it’s correct

Select the correct answer.
Suzanne, a project manager, wants to change the style and font of the text in the document. What documentation standards should Suzanne
follow?

OA
interchange standards
ОВ.
identification standards
OC.
update standards
OD
process standards
OE.
presentation standards

Answers

Answer:

update standards

i think this is correct

don't be afraid to correct me if im wrong

Explanation:

mrk me brainliest

A message being sent over a communications network is assigned by a router to one of three paths (path 1 , path 2 , path 3 ). The nature of the network is such that 50% of all messages are routed to path 1,30% are routed to path 2 , and 20% are routed to path 3 . If routed to path 1 , then the message has a 75% chance of reaching its destination immediately. Otherwise, the message experiences a five-second delay and returns to the router. If routed to path 2 , then the message has a 60% chance of reaching its destination immediately. Otherwise, the message experiences a ten-second delay and returns to the router. If routed to path 3 , then the message has a 40% chance of reaching its destination immediately. Otherwise, the message experiences a twenty-second delay and returns to the router. Note that the router cannot distinguish between new messages and messages that have returned from an unsuccessful attempt. Let X denote the time until the message reaches its destination. (a) Compute the expected value of X. (b) Compute the variance of X

Answers

a) The expected value of X is the weighted sum of the expected values of X conditioned on the three possible paths. Let P(1), P(2), and P(3) denote the probabilities that a message is assigned to paths 1, 2, and 3, respectively

Then we have:

P(1) = 0.50P(2)

= 0.30P(3)

= 0.20

For path 1, the message has a 75% chance of reaching its destination immediately and a 25% chance of experiencing a 5-second delay and returning to the router

. Thus,E(X|path 1)

= 0.75(0) + 0.25(5)

= 1.25For path 2, the message has a 60% chance of reaching its destination immediately and a 40% chance of experiencing a 10-second delay and returning to the router.

Thus,E(X|path 2) = 0.60(0) + 0.40(10)

= 4.00For path 3, the message has a 40% chance of reaching its destination immediately and a 60% chance of experiencing a 20-second delay and returning to the router.

Thus,E(X|path 3) = 0.40(0) + 0.60(20)

= 12.00Therefore,E(X)

= P(1)E(X|path 1) + P(2)E(X|path 2) + P(3)E(X|path 3)

= (0.50)(1.25) + (0.30)(4.00) + (0.20)(12.00)

≈ 3.90b) The variance of X can be computed using the law of total variance,

which states that

(X) = E(Var(X|Y)) + Var(E(X|Y)),

where Y is a random variable denoting the path assigned to the message.

Then,E(X|path 1) = 1.25 and Var(X|path 1)

= (0.75)(0 - 1.25)2 + (0.25)(5 - 1.25)

To know more about paths visit:

https://brainly.com/question/32757457

#SPJ11

select what's true about database all that applya group of related characters in a database.a group of related characters in a database.represents a characteristic of someone or something.represents a characteristic of someone or something.primary key is a field designation.primary key is a field designation.a field is a row in a table.a field is a row in a table.

Answers

A database is a collection of related data that is managed and organized for easy accessibility and modification. It is a set of related data stored in an organized manner. This organized data helps in the easy retrieval of data whenever it is required.

Here are some of the true things about the database that one should know:

Group of related characters in a database: A database contains tables that include rows and columns of data. Rows are referred to as records and columns are referred to as fields. A group of related characters in a database refers to a field that represents a particular characteristic of someone or something.

Primary Key is a field designation: The Primary Key is a column or a set of columns that uniquely identifies each row in a table. It is used to create a link between two tables in a relational database. Primary Key is a field designation, and it is used to maintain the data integrity of the table.

A field is a column in a table: A field is a column in a table that represents a characteristic of someone or something. A field contains data that is related to a particular record. In other words, a field is a row in a table that contains a specific type of data that is related to that record.

Represents a characteristic of someone or something: A field represents a characteristic of someone or something, and it is used to store data related to that characteristic. It can be the name of a person, their address, their age, etc.In conclusion, these are the true things about the database that everyone should know.

Learn more about Database here:

https://brainly.com/question/30883187

#SPJ11

When your operating system is running, you interact with software such as a game or a word processor application.

Other applications known as _____ processes run behind the scenes, with no interaction with you, performing essential tasks such as retrieving email and checking your internet connection.

Answers

Answer:

Other applications known as background processes run behind the scenes, with no interaction with you, performing essential tasks such as retrieving email and checking your internet connection.

These processes are typically invisible to the user, and run automatically in the background without requiring any input or interaction.

background processes are an essential part of modern operating systems, and play a vital role in keeping your computer running smoothly and efficiently.

Answer: I think it is background processes

Explanation: Hope this was helpful

business analysts integrate the work of the programmers, testers, and users.

Answers

Business analysts play a critical role in ensuring the successful completion of software development projects by integrating the work of programmers, testers, and users.

They ensure that all parties involved collaborate effectively, understand each other's requirements, and work towards a common goal, resulting in a successful project outcome.

They act as a liaison between the technical teams and the business stakeholders, helping to identify and translate business needs into technical requirements. By understanding the needs and perspectives of both the business and technical sides, business analysts can effectively communicate and coordinate the efforts of programmers, testers, and users to ensure the project meets the business goals and objectives.

Learn more about stakeholders here:

brainly.com/question/30241824?

#SPJ11

Jack is using a document that has multiple references to his company as Company ABC, LLC. He would like to change these values to CompanyABC, LLC. What is the easiest way to do this?

Answers

Answer:

C. Press CTRL to access the Find and Replace dialog box.

Explanation:

yuh yuhuhu edge 2020 gang gang

Answer this question immediately. This is a Technology and livelihood education (TLE) subject​

Answer this question immediately. This is a Technology and livelihood education (TLE) subject

Answers

I believe some kind of stretch warp could be a very reliable idea. Stretch wrap is a thin, stretchable plastic film that is used to lock and secure cased goods onto a pallet. As the stretch film is wrapped around the pallet, tension is applied, enabling the film to extend its length by up to 300%. This tension then creates a constrictive force around the load, allowing it to be held in place. If it were to rain there would be no water damage due to the wrap. This would ultimately be one of your best choices.

Consider a client and a Web server directly connected by one link of rate R. Suppose the client wants to retrieve an object whose size is exactly equal to 15 S, where S is the maximum segment size (MSS). Denote the round-trip time between client and server as RTT (assumed to be constant).

Answers

The total time it takes for the client to retrieve the object over the given link, considering the round-trip time and the link rate is RTT + (15 S / R), were,  S represents the maximum segment size (MSS),  The round-trip time between the client and server is denoted as RTT and is assumed to be constant.

To calculate the time it takes for the client to retrieve the entire object, we need to consider the factors of link rate, round-trip time, and the size of the object.

The time it takes to transmit a segment over the link is given by the formula:

Transmission time = Segment size / Link rate

Since the object size is 15 S, the number of segments required to transmit the entire object would be:

Number of segments = Object size / Segment size = 15 S / S = 15

Considering the round-trip time (RTT), we need to account for the time it takes for the client to send a request and receive a response. This includes the time for the request to travel from the client to the server (RTT/2) and the time for the response to travel back from the server to the client (RTT/2).

Therefore, the total time to retrieve the object can be calculated as:

Total time = RTT/2 + Transmission time + RTT/2

Plugging in the values, we get:

Total time = RTT/2 + (15 S / R) + RTT/2

Simplifying further, we have:

Total time = RTT + (15 S / R)

This equation represents the total time it takes for the client to retrieve the object over the given link, considering the round-trip time and the link rate.

To learn more about server: https://brainly.com/question/29490350

#SPJ11

Which concept allows the computer to repeat a group of steps in an

algorithm?

OA. Iteration

OB. Storage

OC. Sequencing

OD. Selection

Answers

OD. Selection concept allows the computer to repeat a group of steps in an algorithm .

What is algorithm
An algorithm is a set of instructions that can be used to solve a problem or accomplish a task. It is a step-by-step process that takes an input and produces an output. Algorithms are used in many areas including mathematics, computer science, and data science. To be effective, an algorithm must be well-defined and complete, meaning that all instructions must be clearly stated and complete. It should be efficient, meaning that it uses the minimum amount of resources and time to accomplish a task; and it should be accurate, meaning that it produces the correct result. Algorithms are also often tested for their correctness and performance.

To know more about algorithm
https://brainly.com/question/22984934
#SPJ4

Answer: A. Iteration

Explanation:

Which concept allows the computer to repeat a group of steps in analgorithm?OA. IterationOB. StorageOC.

Drag each tile to the correct box.
Classify the benefits and drawbacks of doing business on the internet.
cheaper to set up and run a business
access to a large amount of customer
information
difficult to verify the quality of products
BENEFITS
risk of cyberattacks
attracts investments from a larger number of
sources
can drive small enterprises out of business
DRAWBACK

Drag each tile to the correct box.Classify the benefits and drawbacks of doing business on the internet.cheaper

Answers

Answer:

Explanation:

Benefits

Cheaper to set up and run a business.

Access to a large amount of customer information

Attracts investments from a larger number of sources.

Drawbacks

Can drive small enterprises out of business.

Risk of Cyberattacks

difficult to verify the quality of products

What is output by the following code segment? int x = 11; int y = 11; if (x != y ) { System.out.print("one"); } else if (x > y) { System.out.print("two"); } else if (y = x) { System.out.print("four"); } else { System.out.print("five"); }

Answers

The output will be four because y and x are equal and that satisfies the condition for the else if statement that prints out four.

Engine blocks have water chambers that help heat up the engine when it gets too cold.


False

True

Answers

False because it can’t be true

Answer:True

Explanation:

How do graphic designers showcase their work?
Graphic designers create(Blank)
to showcase their work.


THIS IS A BIG TEST IM BEHIND AND CANNOT FAIL PLZ

Answers

Answer:

Platforms!

Explanation:

Answer:

portfolios

Explanation:

A portfolio is a collection of work done by a graphic designer. Graphic designers use them to display their work to their clients.

frame relay connections identify virtual circuits by ___________________________________ numbers.

Answers

Frame Relay connections identify virtual circuits by Data Link Connection Identifiers (DLCI) numbers.

Frame Relay is a data communication protocol that is used to connect networks and subnetworks together. This protocol is primarily used to connect LANs (Local Area Networks) and WANs (Wide Area Networks).Frame Relay is a packet-switched protocol that is based on PVCs (Permanent Virtual Circuits) and SVCs (Switched Virtual Circuits). When data is transmitted over a Frame Relay network, it is encapsulated in frames and sent over a virtual circuit.

The virtual circuit is identified by a DLCI (Data Link Connection Identifier) number, which is assigned to each virtual circuit by the service provider.When a device sends data over a Frame Relay network, the data is first encapsulated in a Frame Relay frame. The frame contains the source and destination addresses of the devices that are communicating, as well as the DLCI number of the virtual circuit over which the data is being transmitted. The Frame Relay network uses the DLCI number to forward the data to the correct destination device. When the data reaches the destination device, it is decapsulated from the Frame Relay frame, and the original data is extracted.

Learn more about networks :

https://brainly.com/question/31228211

#SPJ11

Which area of government regulations do the Fair Credit and Reporting Act
(FCRA) and the Gramm-Leach-Bliley Act (GLB) relate to?
A. Advertising
B. Health and safety
C. Privacy and security
D. Employment and labor

Answers

Answer:   C. Privacy and security

Explanation:  100% correct

How is a sequential control structure read?

Answers

Answer:

"Sequence control structure” refers to the line-by-line execution by which statements are executed sequentially, in the same order in which they appear in the program. They might, for example, carry out a series of read or write operations, arithmetic operations, or assignments to variables.

Explanation:

The sequence control structure is the default or overriding structure. The sequence structure indicates instructions are to be executed one statement at a time in the order they occur from top to bottom unless a different control structure dictates otherwise.

most users enter information into a database through the use of a ________.

Answers

Most users enter information into a database through the use of a form.

A form is a graphical user interface that permits a user to communicate with a computer program by filling out a series of dialog boxes.

A form usually includes checkboxes, radio buttons, lists, drop-down menus, text boxes, and other types of input fields.

The form of a web page is used to collect data from the user's computer and submit it to a web server.

The forms are used to communicate with a database because they allow users to input data into the database.

A database can be used to store, retrieve, and analyze data.

It is widely used in the modern world for storing and retrieving data.

To enter data into a database, users must first create a form that specifies the fields that must be filled out.

Know more about database here:

https://brainly.com/question/518894

#SPJ11

Complete the statement below using the correct term.
Website managers use
every day​

Answers

Answer:

computers

Explanation:

Answer: Computers, Internet and Printers

Reason: Because they use computers, Internet and Printers to do office things.

Please help!!!! 100 points!!

Please help!!!! 100 points!!

Answers

Answer:

I DONT GET IT

Explanation:

I was also looking for an answer for the same question lo

a devops engineer wants to implement an automated response that will occur if aws trusted advisor detects an iam access key in a public source code repository. the automated response must delete the exposed access key and must notify the security team. which solution will meet these requirements?

Answers

A DevOps engineer can implement an automated response to delete an exposed IAM access key and notify the security team by using AWS Lambda and Amazon Simple Notification Service (SNS).

AWS Lambda is a serverless computing service that can run code in response to events, and Amazon SNS is a messaging service that can send notifications to subscribers.

The solution would involve the following steps:

1. Create an AWS Lambda function that will delete the exposed IAM access key and send a notification to the security team using Amazon SNS.2. Create an Amazon SNS topic and subscribe the security team's email addresses to the topic.3. Configure AWS Trusted Advisor to trigger the Lambda function if it detects an IAM access key in a public source code repository.

This solution will meet the requirements of deleting the exposed access key and notifying the security team automatically if AWS Trusted Advisor detects an IAM access key in a public source code repository.

Learn more about DevOps engineer:

https://brainly.com/question/30825877

#SPJ11

X= [12,67,89,34,56,90,67]

Write a python program to bring the following output by using the given X.

Output:

[12,67,89,34,100,56,90,67]

Answers

Answer:

X = [12, 67, 89, 34, 56, 90, 67]

for i in range (len(X)):

   if (X[i] == 34):

       print(X[i])

       print("100")

   else:

       print(X[i])

Explanation:

Kind of a ugly hack because I'm not all too familiar with python, but it gets the job done :^)

Which hexadecimal number is equivalent to the decimal number 11?

Answers

1011, hope that helps.

identify and briefly explain any four characteristics of a good bi solution.

Answers

A good BI solution should have the following four characteristics.

A good BI solution should be able to easily integrate with a compan.y's existing infrastructure, such as databases, applications, and other tools, ensuring a seamless flow of data and minimizing the need for extensive modifications.

The BI solution should have a user-friendly interface that enables users to easily understand and interact with the system. This ensures that employees can quickly access and analyze data, making informed decisions based on accurate information.

To know more about BI solution visit:-

https://brainly.com/question/30429680

#SPJ11

What makes a technology appropriate? Is it appropriate if it does what it was designed to do? Take a knife for example: A knife can be used to slice food, but it can also be used to stab and kill a person. So is a knife an appropriate technology? Discuss (Remember to support your answer with citations and references)

Answers

The appropriateness of a technology cannot be solely determined by whether it accomplishes its intended purpose.

Other factors, such as the context of use, societal impact, and ethical considerations, need to be taken into account. While a knife can be used for both constructive and destructive purposes, its appropriateness as a technology depends on responsible and ethical use.

The appropriateness of a technology encompasses a broader perspective than just its functional capabilities. It involves evaluating the potential benefits and risks associated with its use in a particular context. A technology's appropriateness is influenced by various factors, including its impact on society, environment, and human well-being. Ethical considerations, such as ensuring the technology respects fundamental human rights and promotes fairness, also play a crucial role in determining appropriateness.

In the case of a knife, its appropriateness as a technology depends on how it is used. While it is designed for slicing and cutting food, it can also be misused for harmful purposes. However, the responsibility lies with the user, not the technology itself. It is important to note that the potential for misuse exists with many technologies, but that does not necessarily render them inappropriate. Society must emphasize responsible use, education, and enforce legal frameworks to mitigate potential harm.

In conclusion, the appropriateness of a technology cannot be solely based on its intended purpose but should consider broader factors such as societal impact and ethical considerations. While a knife can be used for both constructive and destructive purposes, responsible use and adherence to ethical principles are crucial in determining its appropriateness as a technology. By focusing on responsible use, society can harness the benefits of technologies while mitigating potential risks.

Learn more about technology here:
https://brainly.com/question/9171028

#SPJ11

jorge has asked you to explain to him how a touch pen can work with his android tablet. which of the following are true statements about touch pens? (choose all that apply.) a. a touch pen might use a bluetooth connection to write on a tablet. b. a touch pen is made of material that can touch the screen without damaging it. c. a touch pen might need charging. d. a touch pen does not use a wi-fi connection.

Answers

A touch pen might use a bluetooth connection to write on a tablet. This statement is true about touch pens. Therefore, the correct option is option A.

Thus was born the touch screen pen, best known as the stylus. Today, resistive touch screens are thought of as archaic technologies - inferior to their capacitive sister screens. With this shift, the very existence of the stylus has teetered in limbo. A touch pen might use a bluetooth connection to write on a tablet. This statement is true about touch pens.

Therefore, the correct option is option A.

To learn more about touch pen, here:

https://brainly.com/question/30328196

#SPJ4

What digital security measure can you use to catch and delete bad software?
help

Anti-virus
Encryption
Firewall
Password

Answers

Hey there :)

As per question, the best way is Encryption.

You may feel this as wrong answer but as per the latest scrutiny, I'll explain:-

Option: Antivirus (NO)

This is safe and does the job to some extent. But none has ever found with clear proof of the best antivirus. Everyone of those antivruses has some pros and cons.

Some of them does the job of protection but with them, they also give us some threats !

Option: Firewall (No)

Firewall also helps to catch and delete malicious softwares to 79%, but it doesnt give you the maximum security from data breaches.

Option: Password (Obviously NO)

Passwords may help in personal accounts and bank, but they are useless in online world. Nothing can be protected fully by passwords. Also, password is the easiest way for cyber criminals to attack.

So, answer is "Encryption"

For ul elements nested within the nav element, set the list-style-type to none and set the line-height to 2em.

For all hypertext links in the document, set the font-color to ivory and set the text-decoration to none.
(CSS)

Answers

Using the knowledge in computational language in html it is possible to write a code that For ul elements nested within the nav element, set the list-style-type to none and set the line-height to 2em.

Writting the code:

<!doctype html>

<html lang="en">

<head>

  <!--

  <meta charset="utf-8">

  <title>Coding Challenge 2-2</title>

</head>

<body>

  <header>

     <h1>Sports Talk</h1>

  </header>

  <nav>

     <h1>Top Ten Sports Websites</h1>

     <ul>

   

     </ul>

  </nav>

  <article>

     <h1>Jenkins on Ice</h1>

     <p>Retired NBA star Dennis Jenkins announced today that he has signed

        a contract with Long Sleep to have his body frozen before death, to

        be revived only when medical science has discovered a cure to the

        aging process.</p>

        always-entertaining Jenkins, 'I just want to return once they can give

        me back my eternal youth.' [sic] Perhaps Jenkins is also hoping medical

        science can cure his free-throw shooting - 47% and falling during his

        last year in the league.</p>

     <p>A reader tells us that Jenkins may not be aware that part of the

        least-valuable asset.</p>

  </article>

</body>

</html>

See more about html at brainly.com/question/15093505

#SPJ1

For ul elements nested within the nav element, set the list-style-type to none and set the line-height
For ul elements nested within the nav element, set the list-style-type to none and set the line-height

please help! ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎ ‎

please help!

Answers

I think the answer the the question is C

ASAP

The Fleischer Studio produced two animated feature films. The financial success of both films was negatively impacted by what event?

- The Great Depression

- World War I

- World War II

- the popularity of television

The first to answer correctly gets a crown and 5 stars. Please help.

Answers

Answer:

The Great Depression and The popularity of television  and the event was The Great Animation Strike  

Explanation:

Other Questions
Equivalent fractions 1/3 A proper fraction never has the same value as a mixed number? true of false? Savannah and her roommates ate 1 2/5 pints of ice cream on Friday night and 2 1/2 pints of ice cream on Saturday night. How many pints did they eat in all? Simplify your answer and write it as a fraction or as a whole or mixed number. The following classification scheme typically is used in the preparation of a balance sheet:a.Current assetsf.Current liabilitiesb.Investments and fundsg.Long-term liabilitiesc.Property, plant, and equipmenth.Contributed capitald.Intangible assetsi.Retained earningse.Other assetsUsing the letters above and the format below, indicate the balance sheet category in which an entity typically would place each of the following items. Indicate a contra account by placing your answer in parentheses.1._____Long-term receivables2._____Accumulated amortization3._____Current maturities of long-term debt4_____Notes payable (short term)5._____Accrued payroll taxes6._____Leasehold improvements7._____Retained earnings appropriated for plant expans8._____Machinery9._____Donated capital10._____Short-term investments11._____Deferred tax liability(long term)12._____Allowance for uncollectible accounts13._____Premium on bonds payable14. _____Supplies inventory15._____Additional paid-incapital16._____Work-in-process inventory17._____Notes receivable (short-term)18._____Copyrights19._____Unearned revenue(long-term)20._____Inventory -1 (r-3) 3(r + 5) On the refrigerator, MATHCOUNTS is spelled out with 10 magnets, one letter per magnet. Two vowels and three consonants fall off and are put away in a bag. If the Ts are indistinguishable, how many distinct possible collections of letters could be put in the bag? Isaac has a points card for a movie theater. He receives 65 rewards points just for signing up. He earns 12. 5 points for each visit to the movie theater. He needs at least 210 points for a free movie ticket. Write and solve an inequality which can be used to determine xx, the number of visits Isaac can make to earn his first free movie ticket 6. The expected life of a calculator varies inversely with the amount of times a studentdrops it. If the expected life of a calculator is 625 days and has been dropped 8 times,what is the expected life of a calculator dropped 20 times? Which of the following best compares gymnosperms and angiosperms? A Both contain xylem and phloem, but gymnosperms produce spores and angiosperms produce either cones or flowers and fruit.B Both reproduce sexually, but gymnosperms contain only xylem and angiosperms contain xylem and phloem.C Both contain xylem and phloem, but gymnosperms reproduce asexually and angiosperms reproduce sexually.D Both reproduce sexually, but gymnosperms produce pollen cones and seed cones and angiosperms produce flowers or fruit. on may 31, money corporation's cash account showed a balance of $15,000 before the bank reconciliation was prepared. after examining the may bank statement and items included with it, the company's accountant found the following items: checks outstanding $ 2,050 deposits outstanding 2,000 non-sufficient funds check 200 service fees 65 error: money corporation wrote a check for $80 but recorded it incorrectly for $800. what is the amount of cash that should be reported in the company's balance sheet as of may 31? multiple choice $15,185. $15,735. $14,975. $15,455. Greg deposits $500 into an account that pays simple interest at a rate of % 3 per year. How much interest will he be paid in the first 6 years? HELPPPPP PLEASEEEEE IMM BEGGING round 6.7 to the nearest whole number. This federal agency presided over all elements of war production from the distribution of raw materials to the prices of manufactured goods. Which occurs during cytokinesis? 1.A beam of light has a wavelength of 600 nm in air. What is the frequency of the light (c = 3x108 m/s)? Show solution. (A) 5x1014 Hz (B) 2x1014 Hz (C) 3x1014 Hz (D) 6x1014 Hz (E) 8x1014 Hz 2. A light beam traveling in air with a wavelength of 500.0 nm falls on a glass block. What is the wavelength of the light beam in glass (nglass = 1.500)? Show solution. (A) 500.0 nm (B) 400.0 nm (C) 666.7 nm (D) 333.3 nm (E) 900.0 nm Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. Blue Plate Construction organized in December and recorded the following transactions during its first month of operations:Dec. 2 Purchased materials on account for $400,000.Dec. 3 Used direct materials costing $100,000 on job no. 100.Dec. 9 Used direct materials costing $150,000 on job no. 101.Dec. 15 Used direct materials costing $30,000 on job no. 102.Dec. 28Applied the following direct labor costs to jobs: job no. 100, $9,000; job no. 101, $11,000; job no. 102, $5,000.Dec. 28 Applied manufacturing overhead to all jobs at a rate of 300% of direct labor dollars.Dec. 29 Completed and transferred job no. 100 and job no. 101 to the finished goods warehouse.Dec. 30 Sold job no. 100 on account for $200,000.Dec. 31 Recorded and paid actual December manufacturing overhead costs of $78,000, cash.Dec. 31 Closed the Manufacturing Overhead account directly to Cost of Goods Sold.a.Prepare journal entries for each of the above transactions. (If no entry is required for a transaction/event, select "No journal entry required" in the first account field.) 1, 3, 5, 6, 7, and 8 PLEASE ANSWER THE QUESTION WITH A ANSWER NOT A BLANKI ALREADY HAVE 2 AND 4!! chapter 22 drugs used to treat hypertension