Which of the following is NOT an example of active transport?
a: endocytosis
b: facilitated diffusion
c: exocytosis
d: sodium potassium pump

Answers

Answer 1

Answer:

The answer is B.

Explanation:

Because Facilitated Diffusion is a type of passive transport.

Answer 2

Answer: the answer is B

it is because it is a passive transport

Explanation:


Related Questions

What is a disease that is spread by mosquitoes

Answers

Answer:

Their are many disease's that include:

Zika virus, dengue, and malaria. (their are many more)

Explanation:

What is a disease?

Answer - A disease is a type of disorder in human's and animal's that have a group of symptom's of bad change's.

Answer: Diseases that are spread to people by mosquitoes include Zika virus, West Nile virus, Chikungunya virus, dengue, and malaria.

sorry it sounds like i copied.

Explanation: they can also carry blood diseases and infections

what are some of the structures inside a cell that help it to live and perform its role in an organism?​

Answers

Answer:

hat are some of the structures inside a cell that help it to live and perform its role in an organism? mitochondria - makes ATP, lysome - digest bad things, nucleus - contains DNA ribosomes - synthesize proteins 2. ... Plant cells have a large central vacuoles, animal cells do not.

Explanation:

Where are the A, B and RH antigens located

Answers

Answer: The A, B, and Rh antigens are located on the surface of red blood cells.

Explanation:

pleaseeeee helpppp
Within a plant, photosynthesis is critical. It provides cells with the glucose they need for
energy. Photosynthesis is important for another reason, too. It's part of the flow of carbon
through organisms and the environment. This cycle, known as the carbon cycle, is essential
for life on Earth. It includes several processes that are occurring all the time. When plants
photosynthesize, carbon is removed from the atmosphere as carbon dioxide. When animals
and plants use cellular respiration, carbon is released into the atmosphere as carbon
dioxide. Organisms that die and are buried for millions of years turn into fossil fuels, which
are made of carbon. When humans burn those fossil fuels, carbon is released into the
atmosphere as carbon dioxide. Without enough carbon dioxide in the atmosphere, the
planet would be too cold. But too much carbon dioxide contributes to the warming of the
planet that could make it too hot to survive.
Based on the passage, what is one reason that the carbon cycle important?
A It adds carbon into the atmosphere whenever the level begins to drop too low.
B
It helps maintain a level of carbon in the atmosphere that is neither too hot nor
too cold.
с
It removes carbon from the atmosphere whenever the level begins to become
too high.
D
It releases carbon into space, preventing it from building up in Earth's
atmosphere.

Answers

The answer is C Good luck

Answer:

B

Explanation:

just did that on flocabulary

What might happen if water molecules didn't have a slight negative charge on one end and a slight positive charge on the other?

Answers

The polarity of water molecules is crucial to the formation and stability of cell membranes. Without this polarity, water would not be able to form hydrogen bonds, interact with polar molecules, or form stable cell membranes .

Water molecules are composed of two hydrogen atoms and one oxygen atom, and they have a slight negative charge on one end and a slight positive charge on the other.

This arrangement is due to the unequal sharing of electrons between the atoms, with the oxygen atom having a stronger pull on the electrons than the hydrogen atoms. This phenomenon is called polarity, and it is crucial to the unique properties of water.

First, water molecules would not be able to form hydrogen bonds with each other, which are crucial for many of water's unique properties. Hydrogen bonds occur between the positive and negative ends of different water molecules and give water its high boiling point, high surface tension, and the ability to dissolve many substances.

Furthermore, the polarity of water molecules is crucial to the formation and stability of cell membranes. The hydrophilic, or water-loving, heads of phospholipids are attracted to the polar water molecules, while the hydrophobic, or water-fearing, tails face away from the water.

In summary, the polarity of water molecules is crucial to many of its unique properties and is essential to many biological processes. Without this polarity, water would not be able to form hydrogen bonds, interact with polar molecules, or form stable cell membranes.

Know more about Water molecules here :

brainly.com/question/1313076

#SPJ11

Identify the charges of the different parts of an atom.

Answers

Answer:

The parts of an atom are protons, electrons, and neutrons. A proton is positively charged and is located in the center or nucleus of the atom. Electrons are negatively charged and are located in rings or orbits spinning around the nucleus.

Explanation:

emilythompson35464

hope this helps srry if it doesn't tho

evolutionary significance of bryophytes

Answers

The bryophytes, which include mosses, liverworts, and hornworts, have significant evolutionary significance in the plant kingdom despite their relatively small size and simple structure, they played a crucial role in the colonization of terrestrial environments and the subsequent evolution of higher plants.

Here are some key evolutionary significance of bryophytes:

Adaptation to land: Bryophytes are considered some of the earliest land plants.

They were the first plants to transition from aquatic to terrestrial habitats, paving the way for the colonization of land by other plant groups.

They developed strategies to overcome challenges such as desiccation, limited nutrients, and anchorage to the soil.

Moisture retention: Bryophytes have adaptations that enable them to retain moisture.

They possess specialized structures, such as rhizoids and mucilage, that help absorb and retain water.

This ability to retain water and survive in relatively dry environments was an important adaptation for the conquest of land.

Soil formation: Bryophytes, especially mosses, contribute to soil formation.

They can grow on bare rocks and soil, where their rhizoids aid in weathering and breaking down substrates.

Their decomposed remains also contribute organic matter to the soil, enriching its fertility.

Habitat creation: Bryophytes provide habitat and microenvironments for other organisms.

Their dense mats or cushions create shelter, moisture, and temperature buffering for a variety of organisms, including insects, small invertebrates, and microorganisms.

They contribute to the overall biodiversity and ecosystem functioning.

Reproductive strategies: Bryophytes have unique reproductive strategies. They produce spores that can disperse and colonize new habitats.

Their reproductive structures, such as gametophores and sporophytes, exhibit various adaptations that allowed for successful reproduction in terrestrial environments.

Ecological indicators: Bryophytes are sensitive to environmental changes, making them valuable ecological indicators.

Their presence, abundance, and diversity can indicate environmental conditions such as air quality, moisture levels, and habitat disturbance.

Monitoring bryophytes can provide insights into the health and integrity of ecosystems.

Overall, bryophytes played a crucial role in the evolution and colonization of land by plants.

Their adaptations, ecological roles, and evolutionary history make them important subjects of study for understanding plant evolution, ecosystem dynamics, and the colonization of terrestrial environments.

For similar questions on bryophytes

https://brainly.com/question/3108164

#SPJ8

The bryophytes, which include mosses, liverworts, and hornworts, have significant evolutionary significance in the plant kingdom despite their relatively small size and simple structure, they played a crucial role in the colonization of terrestrial environments and the subsequent evolution of higher plants.

Here are some key evolutionary significance of bryophytes:

Adaptation to land: Bryophytes are considered some of the earliest land plants.

They were the first plants to transition from aquatic to terrestrial habitats, paving the way for the colonization of land by other plant groups.

They developed strategies to overcome challenges such as desiccation, limited nutrients, and anchorage to the soil.

Moisture retention: Bryophytes have adaptations that enable them to retain moisture.

They possess specialized structures, such as rhizoids and mucilage, that help absorb and retain water.

This ability to retain water and survive in relatively dry environments was an important adaptation for the conquest of land.

Soil formation: Bryophytes, especially mosses, contribute to soil formation.

They can grow on bare rocks and soil, where their rhizoids aid in weathering and breaking down substrates.

Their decomposed remains also contribute organic matter to the soil, enriching its fertility.

Habitat creation: Bryophytes provide habitat and microenvironments for other organisms.

Their dense mats or cushions create shelter, moisture, and temperature buffering for a variety of organisms, including insects, small invertebrates, and microorganisms.

They contribute to the overall biodiversity and ecosystem functioning.

Reproductive strategies: Bryophytes have unique reproductive strategies. They produce spores that can disperse and colonize new habitats.

Their reproductive structures, such as gametophores and sporophytes, exhibit various adaptations that allowed for successful reproduction in terrestrial environments.

Ecological indicators: Bryophytes are sensitive to environmental changes, making them valuable ecological indicators.

Their presence, abundance, and diversity can indicate environmental conditions such as air quality, moisture levels, and habitat disturbance.

Monitoring bryophytes can provide insights into the health and integrity of ecosystems.

Overall, bryophytes played a crucial role in the evolution and colonization of land by plants.

Their adaptations, ecological roles, and evolutionary history make them important subjects of study for understanding plant evolution, ecosystem dynamics, and the colonization of terrestrial environments.

For similar questions on bryophytes

brainly.com/question/3108164

#SPJ8

What would most likely happen to plants if they did not have a waxy outer coating?
They would store more water in their leaves.
They would photosynthesize at a faster rate.
They would store more sugars in their leaves.
They would be harmed by insects and UV radiation.

Answers

Answer:

They would be harmed by insects and UV radiation.

Explanation:

If plants did not have a waxy outer coating, then they would be harmed by insects and UV radiation. Therefore, option D is correct.

Why do plants have a waxy outer coating (cuticle)?

Microbes are kept out by the translucent, waxy upper layer of the leaves, which also stops the plant body from losing too much water. Cuticle refers to the waxy layer on a leaf's epidermis that slows transpiration. Due to its ability to prevent water loss, it is primarily found in arid plants.

It is made of cutin, a chemically hydroxy fatty acid generated by the plant that resembles wax. The waxy substance may take the shape of flat plates or a tangle of threads.

If plants did not have a waxy outer coating, then they would be harmed by insects and UV radiation. Therefore, option D is correct.

Learn more about cuticles, here:

https://brainly.com/question/28578072

#SPJ6

Discuss the relationship between growth hormone (GH) and insulin-like
growth factor (IGF).

Answers

Answer:

Explanation:

Growth hormone (GH) and insulin-like growth factor (IGF) are two hormones that are closely related and work together to regulate growth and development in the body. GH is produced by the pituitary gland, while IGF is produced mainly by the liver and other tissues in response to GH stimulation.

When GH is released into the bloodstream, it stimulates the production of IGF-1 in the liver and other tissues. IGF-1 then acts on various tissues in the body, promoting cell growth, division, and differentiation. It also stimulates the production of cartilage and bone tissue, leading to skeletal growth.

GH and IGF-1 also play important roles in the regulation of metabolism. GH promotes the breakdown of fats and the release of fatty acids into the bloodstream, while IGF-1 enhances the uptake of glucose into cells and the production of proteins.

The relationship between GH and IGF-1 is a complex one, with feedback loops and other regulatory mechanisms involved. For example, high levels of IGF-1 can inhibit the release of GH from the pituitary gland, while low levels of IGF-1 can stimulate GH secretion.

Disruptions to the GH-IGF-1 axis can have significant impacts on growth and development. Deficiencies in GH or IGF-1 can lead to stunted growth and developmental delays, while excess GH or IGF-1 can lead to overgrowth and conditions such as acromegaly.

Overall, GH and IGF-1 work together to regulate growth and metabolism in the body, and disruptions to this complex system can have significant effects on health and development.

What is an example of nature exhibiting zero
waste?
1. Oxygen is a waste product
from plants.
2. Oxygen is a waste product
from animals
3. Animals consume oxygen in
respiration
4. Plants consume oxygen in
photosynthesis
A
1 and 3
B
1 and 4
С
2 and 3
D
2 and 4

What is an example of nature exhibiting zerowaste?1. Oxygen is a waste productfrom plants.2. Oxygen is

Answers

Answer:

idontknow

Explanation:

you are aintelligent nice qiestion

Arrange the three stages of glycolysis in the correct order. Begin with the initial phase at the top of the list.
1. Energy investment phase
2. Cleavage phase
3. Energy liberation phase

Answers

The correct order of three stages of glycolysis is energy investment phase> cleavage phase> energy liberation phase.

The initial glucose molecule undergoes a rearrangement during energy investment phase, and two phosphate groups are linked to it. Because of the phosphate groups comes from ATP, two molecules of ATP get used up.

Glycolysis, which translates to "splitting sugars," is the process through which sugars release their stored energy. A six-carbon sugar called glucose is broken into two molecules of a three-carbon sugar called pyruvate during the process of glycolysis.

This multi-step process produces two molecules of free-energy-containing ATP, two molecules of pyruvate, two molecules of high-energy, electron-carrying NADH, and two molecules of water.

To know more about glycolysis, refer:

https://brainly.com/question/28823692

#SPJ4

Can someone help me out to do this part? it's due today please help me

Thank You.

Can someone help me out to do this part? it's due today please help meThank You.

Answers

The Amino Acid Sequence (Polypeptide) for mRNA #1 is: Methionine - Serine - Cysteine - Proline - Alanine

Amino Acid Sequence (Polypeptide) for mRNA #2 is: Phenylalanine - Lysine - Aspartic Acid - Glycine - Arginine

What is the process of translation of genes?

The process by which information contained in messenger RNA (mRNA) guides the addition of amino acids during protein synthesis is known as translation.

Anticodons complementary to the mRNA sequence on tRNA molecules carry amino acids coded for by the codon of the mRNA.

Given the following mRNA sequences:

mRNA Codon Sequence #1: AUG UCU UGU CCA GCA

mRNA Codon Sequence #2: UUC AAA GAC GGU AGA

The Anticodons for mRNA #1 are:

UAC AGA ACA GGU CGU

Anticodons for mRNA #2 are:

AAG UUU CUG CCA UCU

Learn more about translation at: https://brainly.com/question/2449073

#SPJ1

Organic semiconductors are a new technology that scientists are considering for the next generation of solar
panels. Manufacturers want to produce efficient semiconductors at a low cost. Which type of organic
semiconductors would be most desired as a solar panel technology?

Answers

The specific properties of the most desired organic semiconductors for solar panel technology may evolve as advancements are made in the field.

In the context of solar panel technology, the most desired type of organic semiconductors would typically possess the following characteristics:

High Efficiency: The organic semiconductors should have a high power conversion efficiency, meaning they can efficiently convert sunlight into electricity. This is crucial for maximizing the electricity output of solar panels.

Tunable Bandgap: Organic semiconductors with a tunable bandgap would be advantageous. The bandgap determines the range of light wavelengths that can be absorbed by the material. A tunable bandgap allows for optimization to match the solar spectrum, enabling better absorption of sunlight and improved overall efficiency.

Long Operational Lifetime: The organic semiconductors should be stable and exhibit a long operational lifetime. Solar panels are expected to endure outdoor conditions for many years, so the materials used should be resistant to degradation, such as from exposure to UV radiation or moisture.

Scalability and Low Cost: Manufacturers aim to produce organic semiconductors on a large scale at a low cost. Therefore, desirable organic semiconductors should be readily synthesized using cost-effective methods and be compatible with high-volume manufacturing processes.

Environmental Friendliness: Organic semiconductors that are environmentally friendly and have low toxicity are desirable. This is aligned with the goal of sustainable and clean energy technologies.

It is important to note that the field of organic semiconductor research is still evolving, and scientists are continually working to improve the performance and characteristics of these materials.

for similar questions on semiconductors.

https://brainly.com/question/3537004

#SPJ8

Life Sciences / Project Grade 11 • You need to do research on Photosynthesis. Your research must include the following: the Meaning of Photosynthesis ● the Definition of Photosynthesis PART 2 Please look at the rubric to see how you will be assessed on the research. Research ● the Historical Perspective of Photosynthesis the Importance of Photosynthesis Page 9 of 9 NSC Report Submit YOUR report with a title page, which contains a title and your name. Your research must also contain in-text referencing; including a list of all resources used. Grid to assess your research: Criteria Reference Total • Not present Allocation of marks In text referencing: • Correct and complete (4) • Incomplete/incorrect (2) (1) Limpopo DoE / May 2023 1. the Meaning of Photosynthesis 2. the Definition of Photosynthesis Reference list: • Correct and complete (4) 8 ● Incomplete/incorrect (2) • Not present (1) Total 3. the Historical Perspective of Photosynthesis 4. the Importance of Photosynthesis 10 10 6 6 40 TOTAL PART 2: 40​

Answers

Photosynthesis is a vital biological process that occurs in plants, algae, and some bacteria.

It is the process by which organisms convert sunlight, water, and carbon dioxide into glucose (a form of chemical energy) and oxygen. The primary goal of photosynthesis is to harness solar energy and convert it into chemical energy, which sustains life on Earth.

Photosynthesis can be defined as the biochemical process by which green plants and other photosynthetic organisms use chlorophyll and other pigments to convert light energy into chemical energy. This energy is utilized to synthesize glucose, which serves as the primary energy source for the organism's metabolic activities. Photosynthesis occurs in specialized organelles called chloroplasts, primarily in the leaves of plants.

For more details regarding photosynthesis, visit:

https://brainly.com/question/29764662

#SPJ1

Which are vital signs?
O temperature, respiratory rate, and weight
O muscle mass, height, and weight
Oheart rate, temperature, and height
temperature, respiratory rate, and heart rate

Answers

The correct combination of vital signs is temperature, respiratory rate, and heart rate.

Vital signs are key measurements that provide important indicators of a person's physiological status and overall health. They help healthcare professionals assess and monitor a patient's condition. The vital signs typically include temperature, respiratory rate, heart rate, and blood pressure. Among the options provided, the correct combination of vital signs is temperature, respiratory rate, and heart rate.

Temperature is a measure of the body's internal heat. It can be measured orally, rectally, or with the help of infrared thermometers. Deviations from the normal range may indicate fever or hypothermia, which can be indicative of underlying health issues.

The respiratory rate refers to the number of breaths a person takes per minute. It provides insight into lung function and overall respiratory health. Abnormal respiratory rates may suggest respiratory distress or underlying pulmonary conditions.

Heart rate, also known as pulse rate, measures the number of times the heart beats per minute. It reflects cardiac activity and can be assessed by feeling the pulse at various points in the body. Deviations from the normal heart rate can indicate cardiovascular problems or other physiological abnormalities.

Weight, muscle mass, and height are not typically considered vital signs. They are important anthropometric measurements used for assessing overall body composition, growth, and nutritional status. While these measurements are relevant in healthcare, they are not classified as vital signs.

In summary, the vital signs include temperature, respiratory rate, and heart rate. Monitoring these parameters allows healthcare professionals to gain valuable insights into a patient's health status, identify potential issues, and make informed decisions regarding treatment and care.

Know more about the vital signs here:
https://brainly.com/question/32396897

#SPJ8

A certain gene in a chromosome has the following sequence of nucleotides:

ACC TTA GGC CCT TCA

How many nucleotides are in the gene?

Answers

Answer:

30

Explanation:

A gene is a portion of DNA, in this portion we have 15 nucleotides, but you must know that DNA is composed of two strands, so these 15 nucleotides are present on one strand and their corresponding nucleotides are present on the second strand so the total number of nucleotides equals 15x2=30.

Which of the following represents an in vivo method for cultivating viruses.

a.) HeLa cells

b.) Pure bacterial cell cultures

c.) Embryonated chicken eggs

d.) Lung cell culture

Answers

Embryonated chicken eggs represents an in vivo method for cultivating viruses. (option c)

To cultivate viruses in a living system, an in vivo method is used. Among the options provided, embryonated chicken eggs are the most commonly used method for culturing viruses in a living organism.

HeLa cells: HeLa cells (a) are human cancer cells commonly used in laboratory research, but they are not a living organism suitable for virus cultivation.

Pure bacterial cell cultures: Bacterial cell cultures (b) are often used to study bacteriophages, which are viruses that infect bacteria. However, this method involves culturing viruses in bacterial hosts and does not involve a living organism.

Embryonated chicken eggs: Embryonated chicken eggs (c) are a widely used method for virus cultivation. In this method, viruses are injected into the developing embryo, which provides an environment for viral replication. The embryos provide a controlled and nutrient-rich environment for the viruses to grow and propagate.

Lung cell culture: Lung cell culture (d) involves growing lung cells in a laboratory setting. While this method can be used to study certain viruses, it is an in vitro (outside a living organism) method rather than an in vivo method.

In conclusion, the in vivo method for cultivating viruses among the options provided is embryonated chicken eggs. This method provides a living system in which viruses can replicate and propagate. (option c)

For more such questions on cultivating viruses, click on:

https://brainly.com/question/15000588

#SPJ8

TMV Assembly Each of these statements is an experimental observation concerning the reassembly of tobacco mosaic virus (TMV) virions from TMV RNA and coat protein subunits. In each case, carefully state a reasonable conclusion that can be drawn from the experimental finding.
a. When RNA from a specific strain of TMV is mixed with coat protein from the same strain, infectious virions are formed.
b. When RNA from strain A of TMV is mixed with coat protein from strain B, the reassembled virions are infectious, giving rise to strain A virus particles in the infected tobacco cells.
c. Isolated coat protein monomers can polymerize into a virus-like helix in the absence of RNA.
d. In infected plant cells, the TMV virions that form contain only TMV RNA and never any of the various kinds of cellular RNAs present in the host cell.
e. Regardless of the ratio of RNA to coat protein in the starting mixture, the reassembled virions always contain RNA and coat protein in the ratio of three nucleotides of RNA per coat protein monomer.

Answers

Answer:

Explanation:

tobacco mossaic virus is aa RNA containing virus enclosed in aaprotein coat. in above sttaed experiment when TMV cause infection in tobacco plant is leaves get infected due to replication of virus in its cells. RNA is first converted into complementary DNA and form a double stranded nucliec acid structure. it syntheaize its protein to make new coats and to wrap the newly synthesized RNA, and make a completely infected new virus which we called virion. in any case the number of coats are equal to RNA so that to prepare new viruse. n

Which one of the following types of the tissue stores fat in the body?
A) cartilage
B) bone
C) adipose tissue
D) fibrous connective tissue

Answers

its c), adipose tissue.

Answer:

C) Adipose Tissue

Explanation:

Adipose Tissue stores fats in the body!!

when a substance changes from liquid to vapor its called:A.sublimation B.precipitation C.evaporation or D.condensation? pls help me asap!

Answers

Answer:

C. Evaporation

Explanation:

Que es la conducción en ciencias?

Answers

si hay conducta beacuse there is life and life is science

Which process is shown in the diagram?

Which process is shown in the diagram?

Answers

Answer:

"lk

Explanation:

l'j b'knm

Answer:

I believe it's A. Photosynthesis

Explanation:

I hope it helps

what is the force that moves the continents?
Conduction
Convection
Radiation
Conveyor belt

Answers

Answer:

Convection currents

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Hummingbirds are an example of a _____ because of the pollination they provide.

Answers

Answer:

The correct answer is "pollinator".

Explanation:

Insects are the first animals that come to mind when we think about pollinators, however hummingbirds are an excellent example of pollinators as well. Hummingbirds feed frequently from flowers, transferring grains of pollens from a flower to others. Some species of flowers have adapted to develop some traits to attract hummingbirds, such as certain color, shape and scent.

which two statements correctly relate RNA amino acids , and proteins

which two statements correctly relate RNA amino acids , and proteins

Answers

The two correct statements that relate RNA, amino acids, and proteins are C and D.

RNA, Amino acids, and Proteins

RNA is used to build the amino acid sequence: RNA molecules, specifically messenger RNA (mRNA), serve as templates for protein synthesis. During a process called translation, the sequence of nucleotides in mRNA is read by ribosomes, and the corresponding amino acids are assembled in a specific order to form a protein.

Long amino acid sequences fold in a specific way to form proteins: Proteins are composed of long chains of amino acids. After the amino acids are synthesized and linked together, the resulting chain folds into a three-dimensional structure, which is critical for the protein's function. This folding process is driven by various interactions between the amino acid residues in the chain, allowing the protein to adopt its specific shape and perform its specific function.

More on gene expression can be found here: https://brainly.com/question/10572806

#SPJ1

identify at least three examples of food and agriculture milestones which may have led to a significant increase in the human population.

Answers

1. The development of agriculture: The ability to grow and cultivate crops and raise livestock allowed humans to produce more food than they could gather from the wild, which provided a steady and reliable source of food and led to an increase in the human population.
2. The domestication of animals: By domesticating animals, humans were able to use them for a variety of purposes, including as a source of food, transportation, and labor. This allowed humans to expand their territories and take advantage of new resources, which likely contributed to population growth.
3. The development of food preservation techniques: Techniques such as drying, salting, and fermenting allowed humans to preserve food for longer periods of time, which reduced the risk of food shortages and allowed populations to grow and expand into new areas.
Other potential milestones include the invention of the plow and other tools that increased the efficiency of farming, the development of irrigation systems, and the discovery and use of fertilizers to improve crop yields.

Pls award brainliest!’

photosynthesis is a process that helps cycle matter through the environment

Answers

Photosynthesis is a process that helps cycle matter through the environment, the statement is correct because in plants oxygen is released and carbon dioxide is absorbed.

More on Photosynthesis

The process through which green plants and certain other organisms convert light energy into chemical energy is known as photosynthesis.

Light energy is collected and utilized by green plants during photosynthesis to convert water, carbon dioxide, and minerals into oxygen and energy-rich organic molecules.

Photosynthesis produces oxygen and glucose by combining sunlight, carbon dioxide, and water.

Learn more about Photosynthesis here:

https://brainly.com/question/19160081

#SPJ1

a) Identify this moleculea

Answers

Could you show us a picture? It would be helpful!

Algae are photosynthetic protests that act similar to plants since they can make food for themselves es. What factors must be present for algae to grow densely or in abundance?

Answers

Answer:

Carbon dioxide, water, sunlight.

Explanation:

Photosynthesis uses the energy in sunlight to drive the reactions that produce glucose. These reactions are necessary for the algae to produce food, continue to survive, and grow.

As well as sunlight, photosynthesis requires carbon dioxide and water as reactants. The reaction produces glucose and releases oxygen as a byproduct.

The algae need an adequate supply of all of these reactants to grow in abundance.

Other Questions
The variance is based on the ____a. number of variables b. correlation in the data. c. deviation about the median. d. deviation about the mean. what is the purpose of IPCRF for teachers Animals such as antelope that have eyes on the sides of their head have the advantage of a ______.a. wider field of viewb. better binocular visionc. better depth perceptiond. great perception of detail How did John P Parker influence the development of the abolitionist movement?O He wrote Uncle Tom's Cabin.O He fled to Canada and opened up a shelter for formerly enslaved people.O He helped enslaved people escape on the Underground Railroad.O He founded a newspaper and wrote stories about enslaved people. Please see attached file What are the 3 types of purchasing? What part of MLKs story about driving cross-country was hardest to believe? Why? Tim buys a book for $50.38. If he paid 3% in sales tax, then what did the book costbefore tax? sum of the arithmetic sequence 8,14,20 if there are 24 terms which of the following best describes a deliverable? a tangible or intangible output or outcome that is a unique product, service, or result but does not require production a tangible or intangible output that is any unique product, service, or capability to perform a service that is required to be produced to complete a process, phase, or project an outcome towards which work is directed none of the above What is the only non-metal that is not on the upper right side of the periodic table? The scale of the floor plan is 1 inch = 3 feet. what is the actual area of the living room? ournal entries for Special Revenue Fund transactions The Library Special Revenue Fund commenced calendar year 2019 with a cash balance of $5, no liabilities, and a restricted fund balance of $5. Prepare journal entries to record these transactions in the Library Special Revenue Fund and, where appropriate, in the General Fund. (We suggest you post opening balances and the journal entries to general ledger T-accounts.) 1. The General Fund transferred $100 cash to the Library Special Revenue Fund to help the library finance its activities for the year. 2. The library received a grant of $300 from the county. The grant must be used only for library purposes, but there is no requirement as to when it must be spent. 3. The library received $20 from fines, donations, and various fundraising events. 4. The library paid $350 for salaries and $40 to acquire books and periodicals. Charge the Expenditures-culture salaries and Expenditures-culture supplies accounts, respectively. X Note: In the Fund column, select the appropriate fund in which the journal entry is recorded (General Fund: GF or Library Special Revenue Fund: LSRF). Ref. Fund Description Debit Credit 1 LSRF *Due from Library Special Revenue Fund x 100 0 Due to General Fund 0 100 To record transfer out to Library Special Revenue Fund. GF x Cash 100 0 Transfer out to Library Special Revenue Fund 0 100 To record receipt of transfer funds. 2 LSRE Due from Library Special Revenue Fund x 300 Revenues - intergovernmental grants 0 300 GE xDue to General Fund 20 0 Revenues - miscellaneous 0 20 4 *Expenditures - culture salaries 350 0 Expenditures - culture supplies 40 Due to General Fund 0 390 0 3 < X < GE 0 Factor each. One zero has been given.f(x)=x-8+20.x - 16; 2 Complete the following statement. Use the integers that are closest to the number in themiddle. during the period, moist-skinned amphibians successfully invade the wet habitats world wide. LK LearnKeySales ProcessA sales process consists of repeatable steps that a salesperson can use to sellproducts or services. This process helps the sales team find clients, close sales,and retain customers. The seven steps are prospecting, preparation, approach,presentation, objection, closing, and follow-up. Each step is necessary to have asmooth sales process. It is important to maintain relationships with customers.The main role of customer service is to have positive interactions withcustomers. A large part of customer service focuses on negative feedback.Setting clear guidelines to respond to these situations is necessary.PurposeUpon completing this project, you will better understand the steps of a salesprocess.Steps for Completion1.In which step of the sales process would you address customerconcerns?2.In which step of the sales process would potential clients be contacted?a.ain 2 Lesson 3a.5. In which step of the sales process would potential customers be identified?a.Project fileN/AProject DeEstimated complet5 minutes3. In which step of the sales process would a customer decide to purchase a product?a.Video referenceDomain 2Topic: Sales ChannSubtopic: ElemeProcess; Role ofand Sales Strater4. In which step of the sales process would a presentation be shown to a customer?a.Objectives cover2 Marketing and Sale2.3 Identify sales c2.3.1 Identify elprocess2.3.4 Identify thservice and supstrategiesANEEntrepreneurship and Small Business V.2 P According to the ______ exception to the search warrant requirement, if an industry has a long history of well-established regulation, a warrantless search is not unreasonable. there are nine children and Kenneth preschool class three of them chose to play at the sand table based on past data is 12 preschoolers are at school today how many should you expect to play at the sand table can a sentence end with a question mark? like this : ''Did Bob eat grass?'' would that be a sentence?