Which nerve cell process receives incoming signals and transmits them to the cell body?.

Answers

Answer 1

According to the research, the correct option is dendrites. Dendrites nerve cells receive incoming signals and transmit them to the cell body.

What are dendrites?

There are several outputs in the form of small and thin threads that participate in different synapse connections, receiving incoming signals to take it to the new soma and continue the cycle in each nerve structure.

In this sense, these short nerve structures function as extensions of the neuronal body and have the function of receiving the information generated during the synapse.

Therefore, we can conclude that according to the research, the correct option is dendrites. Dendrites nerve cells receive incoming signals and transmit them to the cell body.

Learn more about dendrites here: https://brainly.com/question/11364230

#SPJ1


Related Questions

fitting the very long dna strands from a chromosome into the limited space of the nucleus is achieved by coiling the dna around beads of histones with repeating subunits. these dna-wrapped histones are called:

Answers

Fitting the very long DNA strands from a chromosome into the limited space of the nucleus is achieved by coiling the DNA around beads of histones with repeating subunits. these DNA-wrapped histones are nucleosomes.

A nucleosome is a basic unit of DNA packaging in eukaryotes. It consists of a segment of DNA wound around the histone proteins. This structure is often compared to beads on a string. Nucleosomes form the fundamental repeating units of chromatin, higher-order structures of DNA and proteins that make up chromosomes. The nucleosome core particle, defined as the DNA-histone octamer, is the basic unit of chromatin.

Learn more about DNA at : https://brainly.com/question/264225

#SPJ4

Which of the following must pyruvic acid be converted into before the Krebs cycle can proceed?
a. glucose
b. NADH
c. citric acid
d. acetyl COA

Answers

Answer:

Your answer would be d. acetyl COA

Explanation:

I hope this helped!

Please help!! I really need help!!1

Please help!! I really need help!!1

Answers

Ok on the first question I have no clue but on the second question of going to be the last answer white with a few grey

Answer:

A and C

Explanation:

A on Q:1

C on Q:2

in avery, macleod and mccarty's experiment, what enzyme was present in the mixture of r & s strains, that when injected into the mice did not result in death?

Answers

In Avery, MacLeod, and McCarty's experiment, the enzyme present in the mixture of R and S strains that did not result in the death of mice was DNase. This enzyme breaks down DNA, preventing transformation.

Avery, MacLeod, and McCarty conducted their experiment to determine the substance responsible for transforming nonvirulent bacteria (R strain) into virulent bacteria (S strain). They treated the mixture of R and S strains with different enzymes, including protease (which breaks down proteins), RNase (which breaks down RNA), and DNase (which breaks down DNA). When the mixture was treated with DNase, the transformation process was halted, and the mice remained alive. This indicated that DNA was the primary substance responsible for the transformation.

This groundbreaking experiment provided strong evidence that DNA, not proteins or RNA, is the genetic material responsible for the inheritance of traits. The DNase enzyme played a crucial role in this discovery, as its presence in the mixture of R and S strains prevented the transmission of virulent traits and demonstrated the importance of DNA in the process of transformation.

Know more about DNA here;

https://brainly.com/question/30993611


#SPJ11

Where does the second phase Cellular Respiration occur (in the animal cell)?

Answers

The second phase of cellular respiration in an animal cell occurs is called the krebs cycle because it takes place in the matrix. ( I know this is correct because I just had an assignment in my biology class and asked the same question and I got it right) !

Are the body systems interchangeable

Answers

Answer:

they are not inchachables

who developed a theory of evolution identical to darwin’s?

Answers

Answer:

Alfred Wallace

Explanation:

During which years did the wolf population outnumber the moose population?

A. 1959-1968

B. 1976-1983

C. The wolf population has never outnumbered the moose population in this graph.

D. 1969-1974

During which years did the wolf population outnumber the moose population?A. 1959-1968B. 1976-1983C.

Answers

I think it’s letter B

Inside a seed the new sporophyte is a(n)

A. Embryo.

B. Cotyledon.

C. Pollen.

D. Endosperm

Answers

Inside a seed, the new sporophyte is an embryo. An embryo is a fertilized egg that has developed into a multicellular organism but is not yet able to survive on its own outside the seed.

The embryo is the seed's primary growth stage. The embryo is encased in the endosperm or cotyledon, which offers nutrition to the plant until it has grown enough to develop roots and leaves.The two primary groups of plants are angiosperms and gymnosperms. Angiosperms have seeds that are enclosed inside an ovary. The ovary matures into a fruit after the fertilization of the egg. On the other hand, Gymnosperms have seeds that are not enclosed in a fruit, for instance, the conifers. Instead, they are carried in cones.

To know more about embryo visit:

https://brainly.com/question/1673695

#SPJ11

The resource that may limit consumerism the most during the next day century

Answers

The resource that may limit consumerism the most during the next century is water.

Water is an essential resource for life on Earth, and it is becoming increasingly scarce due to overuse and pollution. As the global population continues to grow, the demand for water will also increase, particularly in areas where water is already limited. In addition, climate change is causing more frequent and severe droughts, further exacerbating water scarcity.

Consumerism, which is the culture of excessive consumption of goods and services, requires significant amounts of water for production and distribution. The manufacturing of products, such as clothing, electronics, and food, requires water, and the transportation of goods over long distances also uses significant amounts of water.

As water becomes scarcer, the cost of producing and transporting goods will increase, and consumers may be forced to reconsider their purchasing habits.

Thus, water scarcity is likely to be a limiting factor on consumerism in the future, as people will need to prioritize the use of water for basic needs such as drinking, sanitation, and food production.

To know more about consumerism, refer here:

https://brainly.com/question/911984#

#SPJ11

1. Determine hormones with external and internal secretion.
2. The nervous system and the hormonal system control the sending of messages to different organs of the body, describe the difference between them.
3. Explain the role of thyroxine in the metabolic processes of our body.
4. Describe the role of insulin in regulating blood sugar. What are the effects of adrenaline in the body?
5. Distinguish the role of testosterone and estrogen in human sexual development.​

Answers

Answer:

yeah

Explanation:

Thyroxine is the main hormone secreted into the bloodstream by the thyroid gland. It plays vital roles in digestion, heart and muscle function, brain development and maintenance of bones.

Alternative names for thyroxine

T4; tetraiodothyronine; thyroxin

What is thyroxine?

Thyroxine is the main hormone secreted into the bloodstream by the thyroid gland. It is the inactive form and most of it is converted to an active form called triiodothyronine by organs such as the liver and kidneys. Thyroid hormones play vital roles in regulating the body’s metabolic rate, heart and digestive functions, muscle control, brain development and maintenance of bones.

How is thyroxine controlled?

The production and release of thyroid hormones, thyroxine and triiodothyronine, is controlled by a feedback loop system that involves the hypothalamus in the brain and the pituitary and thyroid glands. The hypothalamus secretes thyrotropin-releasing hormone which, in turn, stimulates the pituitary gland to produce thyroid stimulating hormone. This hormone stimulates the production of the thyroid hormones, thyroxine and triiodothyronine, by the thyroid gland.

This hormone production system is regulated by a feedback loop so that when the levels of the thyroid hormones (thyroxine and triiodothyronine) increase, they prevent the release of both thyrotropin-releasing hormone and thyroid stimulating hormone. This system allows the body to maintain a constant level of thyroid hormones in the body.

What happens if I have too much thyroxine?

The release of too much thyroxine in the bloodstream is known as thyrotoxicosis. This may be caused by overactivity of the thyroid gland (hyperthyroidism), as in Graves' disease, inflammation of the thyroid or a benign tumour. Thyrotoxicosis can be recognised by a goitre, which is a swelling of the neck due to enlargement of the thyroid gland. Other symptoms of thyrotoxicosis include intolerance to heat, weight loss, increased appetite, increased bowel movements, irregular menstrual cycle, rapid or irregular heartbeat, palpitations, tiredness, irritability, tremor, hair

The sodium-potassium pump regulates the amount of sodium and potassium inside of cells, particularly nerve and muscle cells. In this process, an ATP is burned, causing three sodium ions to be pumped out and exchanged for two potassium ions, which are pumped in by a membrane protein. Both ions go against their concentration gradients.


The sodium-potassium pump is an example of

a. phagocytosis.
b. passive transport.
c. active transport.
d. facilitated diffusion.

Answers

Answer:

Active Transport because it needs ATP

how a mutation in DNA can lead to the symptoms of piebaldism?

Answers

Answer:

skin that lack pigmentation.

Explanation:

The KIT gene mutations responsible for piebaldism lead to a nonfunctional KIT protein. The loss of KIT signaling is thought to disrupt the growth and division (proliferation) and movement (migration) of melanocytes during development, resulting in patches of skin that lack pigmentation.

A “flight or fight” response occurs when the body perceives a type of threat. The hormone known as adrenaline is released which will affect a variety of body systems. Which system needs to increase its activity in order for the muscular system to respond to the perceived threat?

A)Endocrine
B)Integumentary
C)Excretory
D)Digestive

Answers

Answer:

It is the Endocrine System.

Explanation:

The Endocrine System controls and regulates almost all the hormones in your body.

Integumentary System = Skin Tissues

Excretory System = Release of Waste out of the Body

Digestive System = Breakdown of Food

What is the direct effect of oxygen to sea otters?

Answers

It would be challenging to duplicate the precise circumstances of the chemical release elsewhere.

How does temperature affect sea otters directly?

Sea otters decrease heat loss by floating on their backs with their feet out of the water when the water is too chilly. The sea otter extends its feet out underwater to increase its surface area while it is seeking to shed heat. Sea otters frequently extend their feet out or tuck them up to conserve body heat.

River otters take oxygen from the air, just like other animals do. In the event that they are submerged, they surface to breathe. In the winter, when the water is frozen into ice, they create holes so they may rise to the surface to breathe.

learn more about Sea otters refer

https://brainly.com/question/1995171

#SPJ13

when sexual hormone production increases, bone growth a. accelerates rapidly; b. increases, but only in thickness; c. increases slowly; d. is not affected.

Answers

When sexual hormone production increases, bone growth accelerates rapidly.

What are sexual hormones?

Sex hormones are steroid hormones that interact with vertebrate steroid hormone receptors. They are also known as sex steroids, gonadocorticoids, and gonadal steroids. Androgens, estrogens, and progestogens are among the sex hormones . Their effects are mediated by both fast nongenomic mechanisms through membrane-associated receptors and signaling cascades as well as by slow genomic mechanisms through nuclear receptors. Although they serve significant sex-related roles, the polypeptide hormones luteinizing hormone, follicle-stimulating hormone, and gonadotropin-releasing hormone—all of which are connected to the gonadotropin axis—are typically not regarded as sex hormones.

Hence, sexual hormone production increases, bone growth accelerates rapidly.

To learn more about sex hormones click on the link

https://brainly.com/question/24876347

#SPJ4

What is not a component of eukaryotic transcriptional regulation? group of answer choices

Answers

A) Chromatin structure

B) Cis-acting DNA sequences

C) Nucleosome remodeling

D) Ribosomal binding affinity to mRNA

E) Transcription factor binding to enhancer element

Choice D Ribosomal binding affinity to mRNA is not a mechanism for controlling transcription. The remaining possibilities are all various transcriptional regulatory systems.

because transcription comes after ribosome binding. As a result, transcription is not regulated by the ribosome's affinity for mRNA. However, it is a translational rule. In eukaryotes, the ribosome binds to the Shine-Dalgarno sequence. Only affinities matter here. The synthesis of proteins varies depending on the affinities. However, it plays no part in the level of transcriptional regulation.

Changes in chromatin structure control how genes are transcribed. Because phosphate groups have a negative charge, DNA is negatively charged. Because these proteins include positively charged amino acids like arginine and lysine, histones are positive charge proteins. Thus, positive and negative charges will attract and create the structure of the chromatin. The positive charge on the histones is thus neutralized by changes including acetylation, methylation, phosphorylation, and ubiquitination on the histone tail, which causes the DNA in this area to unravel so that Polymerase can quickly bind and transcription to start. Transcription is inhibited by some modifications. As a result, transcription can be regulated by chromatin structure.

Cis-DNA acting elements are those that share a regulatory sequence with the gene, putting them close to the promoter where they can control transcription. These elements are recognized by transcription factors, who work with the polymerase to control transcription.

An further method of controlling transcription is the nucleosomal remodeling complex. The nucleosome can be removed from the promoter sequence in an ATP-dependent manner by remodeling complexes like SWI/SFI. It will enable polymerase to access it. As a result, it is also a method for controlling transcription.

Either a cis- or trans-acting enhancer element. Enhancers are often located thousands of base pairs before the promoter sequence. They create a loop to engage with polymerase or transcriptional factors. These enhancer elements generate loops that control transcription and are identified by certain factors.

Learn more on DNA here:

https://brainly.com/question/15491284

#SPJ4

"If a scientist isolates genes for Hepatitus B antigens from a Hepatitus virus, then inserts them into a bacterial plasmid and replicates the bacteria in a fermenter, what product will be collected?"A. Transgenic bacterial plasmidsB. Hepatitus B frusesC. Hepatitus B vaccineD. Hepatitus resistant bacteria

Answers

If a scientist isolates genes for Hepatitus B antigens from a Hepatitus virus, then inserts them into a bacterial plasmid and replicates the bacteria in a fermenter, the product collected will be transgenic bacterial plasmids, inside the bacteria, in order to proove if the transgenic plasmid actually gives the bacteria resistance to the virus, it has to be grown in an infected medium.

The correct answer is option A.

if 60% of a number is 90 what is the number ​

Answers

Answer:

150

Explanation:

60%=60/100=0.6

0.6x=90

x=90/0.6=150

Hope this helps!

Why are liver cells a example of slow rate division

Answers

liver cell will divide slowly if the part of the liver remove cells, liver cells continues until to divide until the liver reaches its former size

In a presentation about measuring mass, one of your classmates states, "Two objects of the same size will always have the same mass.” Is this statement correct? Why or why not?

Answers

Answer: The statement is not correct.

Reason:

If two objects have the same mass, their respective densities determine their volumes.

By definition,

density = mass/volume.

or volume = mass/density.

Therefore if two objects have the same mass, the mode dense object (with higher density) will occupy less volume than the other object.

what gift did dr paricia get her mother

Answers

she got her flowers and chocolates

1. Original DNA: CATATACGCATCTGATTACGTGATTCT CTATA GTATATGCGTAGACTAATGCACTAAGAGATAT

Show the DNA after it has been separated by helicase.

Top Strand:

Bottom Strand: ​

Answers

Explanation:

gtatatgcgtagactaatgcactaagagatatcatatacgcatctgattacgtgattctctata

Based on your answer to question 1, what do you think could be done to reduce levels of carbon dioxide in the atmosphere? What could people change that would reduce the burning of fossil fuels? WILL MARK BRAINLIEST

Answers

By using fossil fuels, which releases additional carbon dioxide into the atmosphere as in form of gases such as carbon dioxide (CO₂), we are altering the carbon cycle.

What do you mean by carbon dioxide?

One carbon atom is covalently doubly linked with two oxygen atoms in each of the molecules that make up carbon dioxide. It exists in the gas state at room temperature. Carbon dioxide acts as a greenhouse gas in the atmosphere since it absorbs infrared light rays despite being transparent in the visible. Numerous health impacts from CO₂ exposure might be experienced. These symptoms can include a coma, hypoxia, convulsions, sweating, a tingling or pins-and-needles sensation, headaches, disorientation, restless, a tingling or pins-and-needles feeling, and difficulty breathing.

Where does carbon dioxide come from?

The majority of animals, which exhaust in the form of a waste product, are naturally sources of carbon dioxide. The main source of carbon dioxide emissions from human activity is energy generation, which includes coal burning, oil, or natural gas. In milliequivalents per liter (mEq/L) either millimoles per liter (mmol/L), the typical range is 23 to 29. The typical value ranges may vary a little bit between labs. The fossil fuel burning like coal, natural gas, and oil is responsible for 87 percent among all human-produced emissions of carbon dioxide. The burning of fossil fuels is the main human emission source of carbon dioxide.

To know more about Carbon Dioxide visit:

https://brainly.com/question/9630194

#SPJ1

Describe the biotic and abiotic components of an urban ecosystem with suitable examples. How can this ecosystem be affected both by the internal and external factors? within 500 words

Answers

Abiotic components refer to the physical elements of the environment, such as soil, water, light, and gas, whereas biotic components refer to the living elements, such as plants, animals, fungus, and bacteria.

When they begin interacting with one another, biotic and abiotic rudiments of an ecosystem come applicable. For case, biotic factors like shops serve as food for other living effects. The soil is an abiotic element that supports factory growth by supplying nutrients and other necessary constituents.

Abiotic factors like soil, nutrients,etc. are formed with the aid of biotic factors, which depend on abiotic factors for their life. Abiotic rudiments can differ from one ecosystem and position to another.

They substantially serve as life sympathizers. They control the number, variety, and rate of population increase of biotic rudiments in an ecosystem. therefore, they're appertained to as limiting factors.

To know more about biotic and abiotic components:

https://brainly.com/question/29766418

#SPJ4

Colorblindness and hemophilia are
examples of sex related traits. The__
is the carrier.

Answers

Answer:

Colorblindness and hemophilia are sex-linked traits. The carrier is typically the female, as males only have one X chromosome and are more likely to express the trait if they inherit the recessive allele. Females have two X chromosomes and can be carriers of the trait if they inherit one copy of the recessive allele, but they may not express the trait unless they inherit two copies of the recessive allele. Therefore, while both males and females can inherit sex-linked traits, females are more likely to be carriers of these traits.

Explanation:

What vocational area is the FFA built around? List or identify National officers from california and their year of service.

Answers

Answer:

1. The National FFA Organization is built around Agricultural education.

2. The National Officers from California from 1928 -2020 are:

Arthur Ketterlin 1928-29Lex Murray 1937-38Joseph E. Giacomini 1941-42Robert Bowman President 1943-44Eugene E. Starkey 1945-46Robert L. Smith 1950-51Jerry Diefenderfer 1962-63Joe Martinez 1968-69Dan Dooley 1970-71Peter Giacomini 1974-75Phil Benson 1979-80Jan Eberly President 1982-83Michael Gayaldo 1984-85Louie Brown 1991-92Kevin White Secretary 1992-93Travis D. Hagen Secretary 1994-95James Garner 1998-99Angela Browning 2000-01Dane White President 2001-02Tim Hammerich President 2002-03Beau Williamson President 2006-07Nessie Early Secretary 2008-09Levy Randolph President 2009-10Lindsey Anderson 2012-13Breanna Holbert President 2017-18Luke O’Leary  President 2018-19

The National FFA Organization, is built around the vocational areas of agriculture and leadership

The National officers from California are:

Breanna Holbert; Year of service, 2017 - 18

Luke O'Leary; Year of service, 2018 - 19

David Lopez: Year of service, 2020-21

The reason the above description and list are correct is as follows:

The National Future Farmers Association (FFA) Organization, is a student organization that develops the potential and talent development of those students that have an interest in leadership and agriculture, by providing opportunities for hands-on experiences

National officers from California are;

Breanna Holbert: National FFA President, 2017-18;

Luke O'Leary: National FFA President, 2018-19

David Lopez: Western Region Vice President, 2020-21

Learn more about the National FFA Organization here:

https://brainly.com/question/19403058

even in the presence of a properly signaling tnf receptor signaling pathway that involves fadd and tradd, breast cancer cells do not undergo apoptosis in response to tnf-alpha

Answers

In breast cancer cells, apoptosis may not occur in response to TNF-alpha despite a functional signaling pathway. This resistance can be attributed to multiple factors.


TNF-alpha, a cytokine, typically triggers apoptosis via the TNF receptor signaling pathway involving FADD and TRADD proteins.  Firstly, breast cancer cells often overexpress anti-apoptotic proteins such as Bcl-2 and IAPs, which inhibit the activation of caspases, key executioners of apoptosis. Secondly, these cells may have increased activation of pro-survival signaling pathways, like NF-κB, which counteract the apoptotic signals and promote cell survival. Additionally, mutations or altered expression of key components in the TNF receptor signaling pathway can also impair the apoptosis process. Lastly, breast cancer cells can develop drug resistance, reducing the effectiveness of TNF-alpha as a treatment.

Learn more about TNF-alpha here:

https://brainly.com/question/20461029

#SPJ11

The images show fossils of a modern bird and two extinct organisms( a Tyrannosaurus rex and archaeopteryx). Based on the structure of the three organisms, it can be concluded that blank . The archaeopteryx and have wings, while dinosaurs have limbs. So, it can be concluded that blank.

Answers

Answer:

Many individuals consider that Archaeopteryx would have been the first bird, however, many paleontologists are against it. The findings of many fossils of Archaeopteryx have revealed that though the creature exhibited wings, the majority of its characteristics were of reptile, like the existence of full teeth set. Apart from this, the wings formation of the creature demonstrated that it was not completely capable of flying.  

No matter what, the presence of wings makes them closely associated with the modern time birds. Thus, it can be concluded that Archaeopteryx could be considered as an intermediate between the reptiles and the birds and is a precursor to the modern-day birds' evolution.  

Ocean currents are
examples of
A. Conduction
B. Convection
C. Radiation

Answers

ocean currents are convection
Other Questions
If property that is located in a state becomes the subject matter of a lawsuit, the power of a court in that state to resolve disputes concerning the property is called: Which household item uses radiation in a beneficial way?-conventiopol ovensO smoke detectorsO electric air filters-computers and TV sets Vinny decides to sue allison. To begin the suit, vinny must file a complaint. A complaint should contain. One day in Colorado it was -13.4 degrees and then the temperature dropped another 5.67 degrees overnight. What was the final temperature? The _____ group on the Table Tools Layout tab contains buttons for inserting and deleting cells in a table.Select one:a. Rows & Columns b. Cell Sizec. Datad. Table PLEASE FASTWhich statements best compare the two texts? Check all that apply.A) Both the article and the play use specific people to develop the topic.B) Both the article and the play address discrimination against multiple races.C) Both the article and the play focus on the topic of racial housing discrimination.D) The article cites statistics, while the play creates a character to develop the topic.E) The article does not specify a location, but the play uses a setting to create a location.texts-Overall, black prospective renters were presented with 11 percent fewer rentals than whites, Hispanics about 12 percent fewer rentals, and Asians about 10 percent fewer rentals.Discrimination in Housing against Nonwhites Persists Quietly, U.S. Study Finds,Shaila Dewan[LINDNER:] I want you to believe me when I tell you that race prejudice simply doesn't enter into it. It is a matter of the people of Clybourne Park believing, rightly or wrongly, as I say, that for the happiness of all concerned that our Negro families are happier when they live in their own communities.A Raisin in the Sun,Lorraine Hansberry Corporation X is a multi-business US conglomerate contemplating international expansion. Company X has several different businesses, and it is trying to decide which of them should be internationalized first, and which ones could wait or may not have internationalization potential. Which of the following of Corporation X's businesses would you say has the SMALLEST globalization potential, aimed at conquering new customers in foreign markets:a) Division D, a manufacturer of preservatives for food manufacturers and medium restaurant chainsb) Division A, selling semiconductor components used in microcomputer manufacturingc) X Division C, a chemical company selling anti-corrosives to paint manufacturersd0 Division B, focused on a chain of restaurants and fast food take-outs Requires urgent answer please,only answer if you are 100% confident you are correct.4. Use the method of Lagrange multipliers to find the positive values of x and y which maximise 2.c y + 3 + 2 subject to the constraint x+y= 6. y +1 Arrange the functions in ascending order, starting with the function that eventually has the least value and ending with the function that eventually has the greatest value 3x+8 4^x 4^x+3 x^2 3x x^2+6 Help me please need answer fast describe how the interaction of matter and light affects what you see when you look at a window a lake and a tree MUST BE 4 sentences A competitive firm has a short-run total cost curve STC (q)= 0.1q^2 +10q +40a. Identify SVC and SFC.b. Find and plot the SAC and SAVC curves.c. For this function, the SMC curve is given by SMC (q)= 0.2q +10. ________ is defined as information containing patterns, relationships, and trends.A) Process miningB) Business process managementC) Business intelligenceD) Spatial intelligence Find the median given the following information. 100 random samples are taken from a large population. A particular characteristic of sampled items was measured. The results were as follows: 45 measurements were between 0.8569 and 0.900. 0.901 was observed once 0.902 was observed three times 0.903 was observed twice 0.904 was observed four times 45 measurements were between 0.905 and 0.958 The smallest value was 0.859 and the largest value was 0.958. The sum of all 100 measurements was 91.170. Except those noted, no measurements occurred more than twice. AMOUNT PER $1.00 INVESTED AT 6%COMPOUNDED DAILYDayAmount Day Amount Day Amount10 1.0016570 1.011571301.0216020 1.0032980 1.013231401.0232830 1.0049490 1.014901501.0249640 1.006601001.016571601.0266550 1.008251101.018251701.0283460 1.009911201.019921801.03002You opened a savings account with a deposit of $3,800 at a 6% interest rate compounded daily. What theamount in the account after 140 days if you made no other deposits or withdrawals?$3888 46 A fixed 0.15 kg solid-disk pulley with a radius of 0.065 m is acted on by a net torque of 5.2 m N. What is the angular acceleration of the pulley? any person planning to begin a fitness program should first have a medical exam. any person planning to begin a fitness program should first have a medical exam. true false The following data show the height, in inches, of 11 different garden gnomes: 2 9 1 23 3 7 10 2 10 9 7 after removing the outlier, what does the mean absolute deviation of this data set represent? when an application is open, its windows taskbar button has a What is most likely the authors purpose for writing this article?