This table shows the motion of a snail along a wall over time. The speed of the snail can be calculated by dividing the distance traveled by the elapsed time. Distance and Time Traveled Elapsed time (min) Distance traveled (m) 1 2 3 4 0 1.07 1,83 1.83 2.90 Based on these data, what happened between 2 minutes and 3 minutes? A. The snail stopped moving. B. The snail decreased its speed. OC. The snail increased its speed. D. The snail changed direction.
As per the formula to calculate the speed, it is calculated by the distance and time. The point where the distance is almost same shows the snail stopped moving.
What type of quantity is speed ?It is a scalar quantity. The relationship between speed and distance can be expressed by the equation:
Speed = Distance/Time
In another terms , speed is rate at which any object moves through the space, and is totally calculated by just dividing the distance that is covered by the time taken to almost cover the distance.
The greater the distance traveled in a given amount of time, the faster the speed of the object, while a smaller distance traveled in the same amount of time would result in a slower speed.
Therefore, speed of any object is almost directly proportional to the distance traveled and is inversely proportional to time taken to travel distance. The snail is constant as it is not changing any distance.
Learn more about speed at :
https://brainly.com/question/28224010
#SPJ1
the figure below represents an overview of the different entry pathways to cellular respiration when different macromolecules are digested for energy production. why are none of the digestive products entering the electron transport chain directly?
None of the digestive products enter the electron transport chain directly as only electrons carried by reduced electron carrier molecules like NADH are accepted by the electron transport chain.
The system's electron donor is NADH. By providing electrons to NADH dehydrogenase, it starts the electron transport cycle (blue). NADH dehydrogenase receives two electrons from NADH. The complex additionally moves two protons into the intermembrane space at the same time from the mitochondria's matrix region.
What is the mechanism of the electron chain?
The ETC is made up of a group of proteins that are affixed to the inner mitochondrial membrane and organic molecules that allow electrons to pass through and release energy through a series of redox processes. The protein ATP-synthase uses chemiosmosis to create a significant amount of ATP using the energy released to create a proton gradient.
To know more electron transport system, click on https://brainly.com/question/12838824
#SPJ4
what are some examples of mesophytes xerophytes
Answer:
Plants adapted to dry, hot and arid climates are considered xerophytes. Examples include the entire yucca family, acacia trees, and mesquite trees.
Since mesophytes prefer moist, well drained soils, most crops are mesophytes. Some examples are corn (maize), cucurbits, privet, lilac, goldenrod, clover, and oxeye daisy.
What about cellulose makes it ideal for structural support?
Answer:The answer would be D!
Explanation:
A hydrogen bond is one of the strongest molecular bonds. :)
cancer is a disease in which cells?
A. grow and divide on controllably.
B. die before they can mature
C. start producing DNA.
D. die during Mitosis
A grow and divide uncontrollably.
Answer:
A
Explanation:
cancer cells divide uncontrollably
phylogenies represent how different species or groups of organisms may be related through evolutionary time.
DNA-DNA hybridisation is used to check the similarity in organisms.
What is evolution?
Evolution is defined as change in the characteristics that acquired heritableyand of population exposed to generations which are successive. There are several stages of evolution through which an organism pass to achieve the evolution and these are mutation, after that genetic recombination, reproduction isolation, and natural selection.
The neck of the giraffe is the best example of evolution as the time change the length of the neck of the giraffe becomes long because due to height of tree they strech their neck and due to practice over a long time the evolution takes place and their neck become long in length. Evolution is a time taking or long process.
Therefore, DNA-DNA hybridisation is used to check the similarity in organisms.
Learn more about evolution here:
https://brainly.com/question/13492988
#SPJ1
A point mutation that changes a codon specifying an amino acid into a stop codon is called a-
A. missense mutation
B. nonsense mutation
C. frameshift mutation
D. silent mutation
“Some viruses are programmed to reproduce by identifying bacteria, killing them, and assembling new viruses.viruses do not eat the bacteria and do not grow after they are made. Viruses are not alive. Explain two reasons why.”
I need help on this I am confused
Answer:
I don't see the last image after the snake. Anyway, I would say C because the Snake would eat more Toads, so Snake population would increase.
vvv. a small lump on the inner surface of the eyelid caused by an inflammatory reaction of material trapped inside an oil-secreting gland is called a/an
during a stay in the hospital, an accident victim develops symptoms of bacteremia. a blood sample shows the presence of gram-positive cocci in pairs. lab tests determine that the bacteria are non-hemolytic and bile salt tolerant. the bacteremia is likely due to: group of answer choices mycoplasma. enterococcus. listeria. streptococcus. staphylococcus.
The blood sample shows infection of Enterococcus
Enterococcus is one of the common pathogens that are known to cause Hospital Acquired Infections (HAI). Enterococcus are opportunistic bacteria that become pathogenic when they colonize niches where they are not normally found. Of recent, they have become major cause of nosocomial infections, especially of the bloodstream, urinary tract and surgical sites.
In the routine microbiology laboratory, Enterococcus are characterized by their morphologic appearance as Gram-positive cocci, non-hemolytic and are distinguished from the non-group D streptococci by their ability to survive in the presence of 40% bile salt.
Learn more about Entrococcus at : brainly.com/question/18617538?referrer=searchResults
#SPJ4
In a newspaper editorial, a writer states that research on human embryonic stem cells is valuable and worthwhile. Which describes the most common argument against the writer's statement?A.In a scientific argument, some physicians argue that stem cells are not likely to be part of any beneficial application or medical treatment.B.In an economic argument, some experts argue that the benefits of stem cells are not worth the high cost of developing and implementing the research.C.In a scientific argument, some researchers argue that the goals of stem cell research would be easier to achieve by other means.D.In an ethical argument, some people argue that human embryonic cells should be protected.E.In a philosophical argument, some people argue that stem cell therapy would change the personality or identity of the person receiving it.
In my experience the answer would be:
"In an ethical argument, some people argue that human embryonic cells should be protected."
Because as with abortion, the general idea is that stem cells or embryos have life and must be protected. Therefore, there are many people against stem cell therapies. However, in the scientific community, stem cells are not considered conscious organisms.
During which stage of the cell cycle is the increase in nucleic acid polymers most apparent?
Answer:
The correct answer is - S or synthesis phase.
Explanation:
S phase or synthesis phase of the interphase is the phase of cell division which takes 5 to 6 hours to complete. In this phase the RNA content increases while DNA replication and synthesis takes place to provide enough genetic matter and polymer to complete the cell division.
Duplication or replication of the DNA increases the amount of nucleic acid for the successful division of the cell. S phase is the phase that prepares the parent cell for cell division.
Select the statement that is true.
1.) Sexual reproduction requires a single parent.
2.)Asexual reproduction is a simpler process than sexual reproduction
3.) Asexual reproduction occurs when two gametes fuse.
4.)Sexual reproduction produces more o
offspring than asexual reproduction.
Answer:
2) Asexual reproduction is a simpler process than sexual reproduction.
Asexual reproduction is a simpler process than sexual reproduction is a true statement.
What is Asexual reproduction?Asexual reproduction refers to a form of reproduction that excludes the joining of gametes or sex cells. Asexual reproduction does not require the mating of male and female gametes, as sexual reproduction does, in order to produce children.
The creature may reproduce even in the absence of a mate, producing young that are typically clones of their parents. Binary fission, budding, vegetative reproduction, spore formation (sporogenesis), fragmentation, parthenogenesis, and apomixis are the several asexual reproduction processes.
Asexual reproduction is a process used by bacteria, archaea, many plants, fungi, and certain mammals.
Therefore, Asexual reproduction is a simpler process than sexual reproduction is a true statement.
To learn more about Asexual reproduction, refer to the link:
https://brainly.com/question/4100787
#SPJ2
Explain the process of protein synthesis be sure to include the following terms ribosome and mRNA TRNA codon and peptide bonds
Protein synthesis, also known as translation, is the process by which cells produce proteins from the genetic information stored in DNA. It involves several key components, including ribosomes, mRNA (messenger RNA), tRNA (transfer RNA), codons, and peptide bonds.
Let's go through the process step by step:
Transcription: In the nucleus of a cell, the DNA sequence encoding a specific protein is transcribed into mRNA. This process involves an enzyme called RNA polymerase that reads the DNA template and synthesizes a complementary mRNA strand.
The mRNA molecule is created using the base pairing rules, where adenine (A) pairs with uracil (U) instead of thymine (T) found in DNA, cytosine (C) pairs with guanine (G), and vice versa.
mRNA Processing: Once the mRNA molecule is synthesized, it undergoes several modifications to prepare it for translation. These modifications include the removal of non-coding regions called introns and the addition of a protective cap (5' cap) at one end and a poly-A tail at the other end. These modifications help stabilize the mRNA molecule and facilitate its export from the nucleus to the cytoplasm, where protein synthesis occurs.
Translation Initiation: The processed mRNA molecule travels from the nucleus to the cytoplasm and attaches to a ribosome, which serves as the site for protein synthesis. The ribosome scans the mRNA until it encounters a specific sequence called the start codon (usually AUG), which signals the beginning of translation. The start codon codes for the amino acid methionine, which initiates the protein synthesis process.
tRNA and Codons: Transfer RNA (tRNA) molecules play a crucial role in protein synthesis. Each tRNA molecule carries a specific amino acid and has an anticodon sequence that is complementary to the codon sequence on the mRNA. Codons are three-nucleotide sequences on the mRNA that specify a particular amino acid. The ribosome reads the mRNA codons in a sequential manner, and each codon recruits a complementary tRNA molecule with the corresponding amino acid.
Elongation: During the elongation phase, the ribosome moves along the mRNA molecule, sequentially matching tRNA anticodons with mRNA codons.
for similar questions on Protein synthesis
https://brainly.com/question/13022587
#SPJ8
What is the correct numerical sequence for unlocking "DNA Structure?"
Answer:
3'TGACGACTACAACTTAATCT
Explanation:
Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.
Give four functions of the mouth in the digestive process
Answer:
receive food by ingestionbreak it into small particles by masticationmix it with salivamoistens foodAnswer:
The four functions of the mouth in the digestive process is given below:
Explanation:
1. Digestive process starts from mouth.
2. It moistens food so it move more easily through esophagus into stomach.
3. Mouth produces saliva which has an enzyme that begins to break down starches in food.
4. Mouth chews food and digestion involves breaking down the food into simpler nutrients that can be used by cells.
if something has a high kinetic energy, what would the temperature and
motion of molecules most likely be?
A. high temperature, slow motion of molecules
B. low temperature, fast motion of molecules
C. high temperature, fast motion of molecules
D. low temperature , slow motion of molecules
What are two things that interfere with an enzyme’s ability to speed up a reaction?
The two things which interfere with an enzyme's ability to speed up a chemical reaction are the temperature and pH condition.
What is Enzyme activity?The enzyme activity refers to the number of moles of the product which are formed per unit of time. The enzyme activity and the concentration of the enzyme can help in determining the specific activity of the enzyme in a reaction. The specific activity is the ratio of the enzyme activity to the concentration of enzyme.
Several factors which affect the rate at which enzymatic reactions proceed include temperature, pH, enzyme concentration, substrate concentration, and the presence of inhibitor molecules or activators.
Learn more about Enzyme activity here:
https://brainly.com/question/11563662
#SPJ1
Both plant and animal cells contain -
A. mitochondria, cell membrane, and chloroplasts.
B. a cell membrane, cytoplasm, and nucleus.
C a cell membrane, cell wall, and nucleus.
D. mitochondria, a cell wall, and chloroplasts.
Both plant and animal cells contain a cell membrane, cytoplasm and nucleus because animal cell does not contain cell wall and plant cell have cell wall but both of the cell contain cell membrane, cytoplam and nucleus.Thus option B is correct.
What is the difference between plant and animal cell?Plant cell consist cell wall but in animal cell, cell wall is absent. Nucleus is present in both of the cell. animal cell does not contain cell wall and plant cell have cell wall but both of the cell contain cell membrane, cytoplam and nucleus.
The main function of vacuoles present in plant cell as it help in storage of waste materials in a plant cell and maintain a proper pressure in a plant cell.
Both plant and animal cells contain a cell membrane, cytoplasm and nucleus because animal cell does not cotain cell wall and plant cell have cell wall but both of the cell contain cell membrane, cytoplam and nucleus.Thus option B is correct.
There are various differences are found in plant and animal cell. The very first difference is shape of the cell, plant cell is square or rectangular in shape but animal shape is irregular in shape.
Plant cell consist cell wall but in animal cell, cell wall is absent. Nucleus is present in both of the cell.
The main function of vacuoles present in plant cell as it help in storage of waste materials in a plant cell and maintain a proper pressure in a plant cell.
Learn more about plant and animal cell here:
https://brainly.com/question/637711
#SPJ6
100 POINTS! PLEASE HELP
Answer:
A: solvent properties
B: melting and boiling points
C: surface tension
D: heat of vaporization
E:density
Explanation: I am pretty sure about most of these Dis the only questionable one please tell me if I am wrong. sorry if I am wrong.
Answer:
A: solvent properties
B: melting and boiling points
C: surface tension
D: heat of vaporization
E:density
Explanation:
griculture: Mastery Test
After many years of research Isabella presented her report in a scientific conference. Arrange the steps of her scientific work till she
presented her report.
She read and reviewed all the previous
articles about increasing the nutritional
value of potatoes
Control groups experimental design
method was used
Isabella wanted to improve the nutritional
value of potatoes
She collected the relevant and required
data
She constructed a hypothesis about a
particular method
She presented her report
She submitted her proposal to her
universily, stating the purpose and time
required for the project
She reached a conclusion about her
project
0
局
Answer:
1. Isabella wanted
2.She read and reviewed
3.She constructed a hypothesis
4.She submitted her proposal
5.Control groups
6.She collected
7.She reached a conclusion
8.she presented
Explanation:
I got it right
Which term refers to the water that flows on the ground's surface? *
Answer:
swamps
Explanation:
TAC GGA TCA TTC GAT GCT GAA ATT ->. TAC GGA TCA CGA TGC TGA AAT T; mutation type
Answer: base deletion
Explanation: i’m not too sure but i believe it’s base deletion
what characterizes retention hyperkeratosis? a. benign lesions were frequently seen in oiler areas of the face b. dark welts on the face and eyes c. dead skin cells building up from not shedding d. small epidermal cyst that appears as firm white papules
The characteristic of retention hyperkeratosis is c. dead skin cells building up from not shedding.
A frequent benign skin disorder known as retention hyperkeratosis is characterised by abnormalities in normal desquamation and is linked to inadequate hygiene. This results in the body's filth and dead cells not being flushed out and is linked to acne. It is a condition where the surface of the skin exhibits an abnormal retention or accumulation of dead skin cells.
This happens when the skin's normal shedding process is interfered with, which causes an accumulation of keratinized cells. Dead skin cells that have collected over time can cause plaques or regions of skin that are rough, thick, and scaly. It frequently arises in locations that are subject to pressure or friction, such as the soles of the feet, the palms, or areas that are repeatedly rubbed.
Read more about hyperkeratosis on:
https://brainly.com/question/30019132
#SPJ4
write an open letter addressed to drivers and motorists. Make an appeal to them to follow speed limits and explain to them the comsequences.of not following such.
Which part of the water cycle affects humidity by increasing
water vapor in the air?
HELPPP MEEE PLSSSS
List the top four basic needs that you think must be met during a prolonged emergency
when normal activities are severely affected?
The four basic neccessities in emergency period are;
FoodWaterShealterClothingWhat is an emergency?The term emergency refers to any period in which there is scarcity of basic resources such as during war.
In such times there are four basic neccessities that one must think about and they are;
FoodWaterShealterClothingLearn more about basic neccessities:https://brainly.com/question/6963889?
#SPJ1
Adam writes the following hypothesis, "Grasshoppers prefer plants with higher levels
of sugar content". His hypothesis was not supported by his data but he wants to find
out if other insects prefer plants with higher levels of sugar in them. Why is his
original hypothesis still valuable?
It involves the study of insects
It was disproven
It is clearly written
It can lead to further investigations
Are there any parts of the human body that get oxygen directly from the air and not from the blood?
Answer:
The cornea in the eye.
Explanation:
The cornea is the only part of a human body that has no blood supply; it gets oxygen directly through the air. The cornea is a transparent tissue, allowing for light to pass through. If it had blood vessels there, that would be an issue - for that tissue! And the cornea receives its oxygen directly from the air. When contact lenses were first used, people were instructed to take out their contacts when they go to sleep - because wearing them at night would reduce the oxygen intake to the eyes. Then they began manufacturing contact lenses that allowed for the lenses to “breathe” permitting people to wear them day and night.