Expressions that represent the product of a variable and a coefficient include:
5x - This expression represents the product of the variable x and the coefficient 5.
2y - This expression represents the product of the variable y and the coefficient 2.
-3z - This expression represents the product of the variable z and the coefficient -3.
Which expressions represent the product of a variable and a coefficient?In algebraic expressions, a variable represents an unknown quantity, while a coefficient is a constant factor that multiplies the variable. When we multiply a variable by a coefficient, we are calculating the product of the two.
For example, in the expression 5x, the variable x is multiplied by the coefficient 5, resulting in the product 5 times x. Similarly, in the expressions 2y and -3z, the variables y and z are multiplied by the coefficients 2 and -3, respectively.
Learn more about algebraic expressions
brainly.com/question/28884894
#SPJ11
I'm asking this out of personal curiosity, not for school. but it's still for educational purposes kinda, so I hope it's okay.
If a flower is wilted, but not totally dead and withered yet, is the flower dead and it's dead flower body is in the process of decomposing, or is the flower like in the flower stage of being an old person, it lived and now it's old, but not dead yet?
Here's an example of the flower stage I mean. ^-^
Photosynthesis & Cell Respiration
Topic: Cellular Respiration
The statement 'photosynthesis and cellular respiration are opposite reactions' best describes the relationship between photosynthesis and cellular respiration.
What is cellular respiration?Cellular respiration is a chemical process where foods and oxygen are used to generate ATP in aerobic conditions.Conversely, photosynthesis is a chemical process where light and carbon dioxide are used to generate chemical energy.In conclusion, the statement 'photosynthesis and cellular respiration are opposite reactions' best describes the relationship between photosynthesis and cellular respiration.The correct answer would be b. the products of cellular respiration are the same as the reactants of photosynthesis. Here are the equations for each:Photosynthesis is a series of metabolic reactions by which plants use energy from the sun and carbon dioxide to produce chemical energy, which is stored in the bonds of simple carbohydrates or sugars (e.g., glucose).Cellular respiration refers to the chemical reaction by which aerobic cells use the energy stored in the chemical bond of macronutrients (e.g., glucose) and oxygen to produce energy in the form of ATP.Photosynthesis occurs in chloroplasts of plant cells, whereas cellular respiration occurs in the cytoplasm and mitochondria (both animal and plant cells).In conclusion, the statement 'photosynthesis stores energy for cells, and cellular respiration releases' correctly describes the processes of photosynthesis and cellular respiration.Photosynthesis:
6CO2 + 6H2O + sunlight --> C6H12O6 + 6O2
OR
6 carbon dioxide + 6 water + sunlight --> glucose + 6 oxygen
Cellular respiration:
C6H12O6 + 6O2 --> 6CO2 + 6H2O + ATP
OR
glucose + 6 oxygen --> 6 carbon dioxide + 6 water + energy
Learn more about photosynthesis here:
brainly.com/question/19160081
#SPJ1
Identify one abiotic factor present in a pond ecosystem and explain how this abiotic factor would affect the frogs in a pond
Where are red and white blood cells produced in the body?
Answer:
They form in bone marrow
Which of the following is consciously controlled?
WHERE"S THE OPTION INEED A OPTION
a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis
Answer:
the zooxanthellae in a pillar coral's body are alive
PLZ HELP ME 4 MIN!!
Pedigrees and karyotypes provide the means for individuals to identify their risks of genetic disorders. What can be observed on a karyotype but not on a pedigree?
family carriers of a genetic disorder
family history of a genetic disorder
risk of a genetic disorder in offspring
a visual image of a chromosomal defect
Answer:
D) a visual image of a chromosomal defect
Explanation:
The genetic disorders, or inheritance of traits, and abnormality in the chromosome can be studied through pedigree charts and karyotyping.
The correct answer is Option D, a visual image of a chromosomal defect.
The difference between karyotype and pedigree chart can be explained as:
Pedigree charts are the diagrammatic representation of the phenotypes of a particular gene or the lineage of the ancestors. The chart is used to study the inheritance of a trait or a disease. Karyotype refers to the collection of chromosomes, in which disorders or structures of chromosomes are studied. Karyotype provides visual damage or abnormality in the structure of chromosomes.
Thus, the correct answer is Option D.
To know more about pedigree, refer to the following link:
https://brainly.com/question/9066873
I have test pleas help
Which of the following statements does not form part of the "cell theory"?
a) All living organisms are made of cells.
b) The cell is the basic functional unit of all living organisms.
c) All plants are made of cells, but only certain types of animals are.
d) All cells come from pre-existing cells.
Answer:
C, All plants are made of cells, but only certain types of animals are.
Explanation:
In biology, Cell Theory is the historic scientific theory that is now universally accepted, that all living organisms are made up of cells and that cells are the basic structural / organizational unit of all organisms, and also the basic unit of reproduction.
In this question, it asked which does NOT form part of cell theory, and the answer to that is C, since "all plants are made of cells, but only certain types of animals are" isn't true to the cell theory, because the cell theory basically says that ALL living organisms are made out of cells, and that means ALL plants and ALL animals.
Hope this helps :)
A water solution is also known as an aqueous solution.
Answer: Yes there's a solution
Explanation:
what is photo synthesis ?
Answer:
Photosynthesis is the process by which plants convert sunlight into energy.
Explanation:
1. Which of the following organisms would NOT display bilateral symmetry because of its feeding behavior?
A. a bee that collects nectar from flowers
B. a fish that follows its prey over a long distance
C. a filter feeder that eats food carried by currents
D. a crab that searches for debris on a beach
2. Perception of visual cues is essential for survival of most animals. A scientist analyzes the vision receptor molecule in invertebrates and vertebrates. The results show that the genes for opsin, the protein part of the photoreceptor, share strong homology in the regions that code for domains involved in light response. Which of the following conclusions is the MOST likely?
A. The receptor molecules will be structurally different but respond to the same light cues.
B. The receptor molecule will be similar in invertebrates and vertebrates because of convergent evolution.
C. The receptor molecules will be different because invertebrates and vertebrates perceive visual cues in different environments.
D. The receptor molecules will be similar in invertebrates and vertebrates because they appeared early in evolution.
3. A paleontologist identified two distinct species of mollusks in the fossil record of a region. In the layer below a mass extinction that devastated the region, the paleontologist observed that shells of species A was present in small numbers over a widespread area whereas species B was abundant and found in a few restricted areas. Which of the following predictions about the fossil record in the layer above the mass extinction is the MOST likely to be supported by further excavations?
A. Species A survived because of its widespread range including some areas that were not as affected by mass extinction.
B. Species A survived because the low number of individuals meant that there was less competition for resources.
C. Species B survived because it was the more abundant and more individuals survived.
D. Species B survived because the population was concentrated in a few areas and had a higher chance of survival.
4. Insects, birds, and bats can fly. Which of the following is a derived characteristic unique to birds and bats?
A. light body weight
B. modified limbs for flight
C. high metabolic rate
D. large surface of wings
C. A filter feeder that eats food carried by currents would not display bilateral symmetry due to its feeding behavior. D. Receptor molecules will be similar in invertebrates and vertebrates because they appeared early in evolution
What are the five bilaterally symmetrical organisms?Flatworms, common worms (also known as "ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates are a few examples of organisms possessing bilateral symmetry.
What kind of plant possesses bilateral symmetry?Family members of the pea and orchid are two examples of plants with bilateral symmetry. Phylum Platyhelminthes, Mollusca, Cnidaria, Arthropoda, etc. are some further examples.
To know more about vertebrates visit:-
https://brainly.com/question/988000
#SPJ1
DNA binding proteins in prokaryotes regulate gene expression by controlling transcription
true or false
Answer:
True
Explanation:
Gene expression, which involves the transcription of DNA into mRNA and the subsequent translation of mRNA into proteins, is regulated in the cell of prokaryotes i.e. it is kept under control. This regulatory process, however, is done at the TRANSCRIPTIONAL LEVEL, in prokaryotic organisms like bacteria.
DNA binding proteins called transcription factors bind to the promoter region of a gene and either facilitates/enhance the binding of RNA polymerase or inhibits its binding. The enhancers are called ACTIVATORS while the inhibitors are called REPRESSORS.
Why is potassium permanganate used in diffusion experiment?
Answer: Potassium permanganate used in diffusion experiment
Explanation: Because of the random movement of potassium permanganate particles, a dense purple solution forms in water at base of the beaker. The purple solution will slowly spread into the rest of the water throughout the beaker creating a less dense but evenly colored purple solution.
What is the correct sequence of renal tubule segments through which filtrate would flow? Multiple Choice Distal tubule, ascending timb of nephron loop, descending limb of nephron loop, proximal tubule Collecting duct proximal tubule, descending limb of nephron loop, ascending timb of nephron loop, distal tubule Proximal tubule, ascending limb of nephron loop, descending Imb of nephron loop, distal tubule Proximal tubule, descending limb of nephron loop, ascending timb of nephron loop, distal tubule
The correct sequence of renal tubule segments through which filtrate would flow is B. proximal tubule, descending limb of nephron loop, ascending limb of nephron loop, distal tubule.
The kidney consists of three primary sections: renal cortex, renal medulla, and renal pelvis, the renal tubule is a portion of the nephron that carries a filtrate away from the glomerulus. Each nephron in the kidney has a renal tubule, which is divided into four different regions. The four regions are the proximal convoluted tubule, the loop of Henle, the distal convoluted tubule, and the collecting duct. The proximal tubule is the segment of the renal tubule that immediately follows Bowman’s capsule and is responsible for most of the reabsorption of nutrients and ions from the glomerular filtrate.
The descending limb of the loop of Henle is the second segment of the renal tubule, which is responsible for reabsorbing water. The third segment of the renal tubule is the ascending limb of the loop of Henle, which is responsible for reabsorbing ions, particularly Na⁺ and Cl⁻. The final segment of the renal tubule is the distal tubule, which is responsible for reabsorbing additional ions and regulating the pH of the urine. So therefore the correct answer is B. proximal tubule, descending limb of nephron loop, ascending limb of nephron loop, distal tubule.
Learn more about loop of Henle at
https://brainly.com/question/30404547
#SPJ11
The filtrate in the renal tubule flows in the sequence: Proximal tubule, descending limb of nephron loop, ascending limb of nephron loop, and distal tubule, finally reaching the collecting duct where it gets converted into urine. These segments allow the reabsorption of water and useful substances, along with the expulsion of waste substances.
Explanation:The correct sequence of renal tubule segments in which filtrate would flow in the human body is: Proximal tubule, descending limb of nephron loop, ascending limb of nephron loop, distal tubule, and then the collecting duct. Kidney filtration starts at the Bowman's capsule which then passes it to the proximal tubule, the descending and ascending limbs of the nephron loop (Loop of Henle), followed by the distal tubule, and finally the collecting duct where it is converted into urine. The filtrate moves through these consecutive segments in order, a process which allows the body to reabsorb water and various useful substances while expelling waste substances as urine.
Learn more about Renal Tubule Segments Flow here:https://brainly.com/question/34235169
nadph is required for the killing of microorganisms that are phagocytosed by white blood cells such as macrophages and neutrophils. which of the following is not true? nadph is used to reduce oxidized glutathione, which is used in the conversion of h2o2 to water by glutathione peroxidase. nadph oxidase converts o2 to superoxide as part of the respiratory burst. the nadph-dependent respiratory burst leads to the eventual formation of hocl and hydroxyl radicals that cause cellular damage to the microorganism. during an nadph-dependent respiratory burst myeloperoxidase is used to convert h2o2 to hocl. nadph is used by inos to generate no as part of the respiratory burst.
The statement "NADPH is used by inos to generate no as part of the respiratory burst" is not true. While NADPH is involved in the respiratory burst, it is not used by inos (inducible nitric oxide synthase) to generate NO. Instead, inos uses oxygen and arginine to produce NO, which is important for killing some types of microorganisms.
Uses of NADPH:
NADPH is primarily used by the enzyme complex NADPH oxidase to generate reactive oxygen species (ROS) such as superoxide, which are involved in phagocytosis and the killing of microorganisms by macrophages and neutrophils. The NADPH-dependent respiratory burst leads to the eventual formation of HOCl and hydroxyl radicals that can cause cellular damage to the microorganism.
Myeloperoxidase is also involved in this process, as it converts H2O2 to HClO, which is a potent antimicrobial agent. However, NADPH is not used in the conversion of H2O2 to water by glutathione peroxidase. Instead, oxidized glutathione is reduced back to its active form by an enzyme called glutathione reductase, which uses NADPH as a cofactor.
To know more about phagocytosis, visit:
https://brainly.com/question/11667538
#SPJ11
What is the mRNA transcript if the complementary DNA is TCTGAG?
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Choose one sort of diversity (for example, age, gender, etc.)
and explain why it is essential as a factor in your opinion.
The type of diversity that I have chosen is ‘Gender Diversity’ and below are the reasons why it is essential as a factor in my opinion.
Gender diversity refers to the representation of both men and women in the workplace and society as a whole. It includes people of all genders, including non-binary individuals. Gender diversity has a significant impact on the workplace and society in general. As women are still underrepresented in many industries and roles, increasing gender diversity can lead to more opportunities for women and help break down gender stereotypes.
By having a gender-diverse workplace, companies can ensure compliance with these laws and avoid penalties or legal issues in the future.In conclusion, gender diversity is essential because it promotes a more inclusive environment, encourages innovation and creativity, and leads to better decision-making. By having a gender-diverse workplace, companies can improve employee satisfaction, increase profitability, reduce discrimination and biases, and ensure compliance with laws related to gender diversity.
To know more about Diversity visit:
https://brainly.com/question/32415727
#SPJ11
Which of the following situations
demonstrates a chemical change?
A. wood turning to ashes as it burn's
B. ice forming when water is placed in a freezer
C. sugar dissolving in a glass of hot
tea
D. a board becoming smooth as it is sanded
A scientist has discovered a new plant species in the Amazon rainforest she tells her fellow scientist at the Playhouse she has found for Tuesday is a cone for my side about this plan is different from an organism
Answer:
It is a seeded vascular plant.
It does not depend on insect pollination.
Explanation:
The complete question is: A scientist has discovered a new plant species in the Amazon rainforest. She tells her fellow scientists that the plant she has found produces a cone. What might they say about how this plant is different from an angiosperm? Its seeds have one or two cotyledons. Its stems' vascular bundles are scattered. It does not depend on insect pollination. It is a seeded vascular plant.
The correct option would be that the plant is a seeded vascular plant and does not depend on insect pollination.
Gymnosperms are the only group of plants that produce cones. They are one of the plant groups that have vascular tissues in the form of xylem and phloem as well as been able to produce seed in the form fo cones. Hence, they are said to be seeded vascular plants.
Gymnosperms also carry out their pollination by relying solely on wind for the transfer of their pollen grain to the female organ. In other words, they do not depend on insect for pollination.
Explain how the composition of blood changes as blood flows through the respiratory system Please identify TWO organs that interact and explain how the chemical composition of blood changes as a result. . 20 points!!!
Our total body weight accounts for about 7 to 8 % of blood. Blood is a mixture of around 55 percent plasma and 45 percent blood cells. Blood running through the veins, arteries and capillaries is called whole blood.
How does the blood change as it flows through the respiratory system?
Blood circulatory system, also called the cardiovascular system, delivers oxygen and nutrients to all the cells of the body.
The respiratory system consists of the respiratory passage and respiratory organ, that is the lungs.
Blood is carried to the lungs through the pulmonary arteries where it picks up oxygen. The blood then leaves the lungs and returns to the heart via the pulmonary vein. It then enters the left atrium. The blood then drops into the left ventricle through the mitral valve.
Transport of gases also occurs through blood.
For exchange or oxygenation, the deoxygenated blood is transported to the lungs from heart. Carbon dioxide is exchanged with oxygen as the blood flows through the respiratory system. For further circulation to various body parts, oxygenated blood is then transported to the heart.
Some amount of gases get dissolved in the blood plasma and get transported, whereas some amount of them is transported in the bound state.
So therefore, CO2 and oxygen bind with hemoglobin in RBC.
Learn more about composition of blood here: https://brainly.com/question/6504932
#SPJ1
PLS HELP ILL MARK BRAINLIEST!!
9. What are the three names commonly used to refer to the places where electrons can be
found?
10. Approximately,
manmade.
elements are found naturally on Earth. The others are
11. How does the Periodic Table organize elements? (2 answers)
12. The atomic number is
13. The atomic mass is
14. The Periodic Table is arranged in order of
The number of protons
Increases from left to right.
15. The vertical rows of the Periodic Table are called
All of the elements in a vertical row have similar characteristics.
I
Explanation:
9 The center of the atom is called the nucleus. Electrons are found in areas called shells. A shell is sometimes called an energy leve
12. 6
13. The atomic mass of an element is the average mass of the atoms of an element measured in atomic mass unit (amu, also known as daltons, D).
14.Elements are arranged from left to right and top to bottom in order of increasing atomic number.
15.The vertical columns on the periodic table are called groups or families because of their similar chemical behavior. A
10.Of these 118 elements, 94 occur naturally on Earth. Six of these occur in extreme trace quantities: technetium, atomic number 43; promethium, number 61; astatine, number 85; francium, number 87; neptunium, number 93; and plutonium, number 94.
what is blood pressure answer choices
Blood pressure is the measure of the force of blood against the walls of blood vessels. Answer choices for blood pressure are High, Low, Normal, and Abnormal.
The circulatory system is responsible for moving blood, oxygen, and nutrients to all parts of the body. The heart pumps blood through the arteries, which are the blood vessels that carry blood away from the heart to the rest of the body.
As the heart beats, it creates pressure that pushes blood through the arteries. This pressure is known as blood pressure.
To learn more about Blood pressure, visit:
https://brainly.com/question/30088024#
#SPJ11
This excerpt is taken from a speech delivered in 1775 at the Second Virginia Convention, in which Patrick Henry urged the American colonists to fight for independence from the British.
I have but one lamp by which my feet are guided, and that is the lamp of experience. I know of no way of judging the future but by the past, and judging by the past, I wish to know what there has been in the conduct of the British ministry for the last ten years to justify those hopes with which gentlemen have been pleased to comfort themselves and the House. Is it that insidious smile with which our petition has been lately received? Trust it not, sir, for it will prove a snare to your feet. Suffer not yourselves to be betrayed with a kiss, but ask yourselves how this gracious reception of our petition agrees with those warlike preparations which cover our waters and darken our land.
I ask, sir, what means this martial array, if its purpose be not to force us to submission? Can gentlemen assign any other possible motive for it? Has Great Britain any enemy, in this quarter of the world, to call for all this accumulation of navies and armies? No, sir, she has none. They are meant for us: they can be meant for no other. They are sent over to bind and rivet upon us those chains which the British ministry have been so long forging.
Let us not, I beseech you, sir, deceive ourselves. Sir, we have done everything that could be done to avert the storm which is now coming on. We have petitioned; we have debated; we have appealed; we have submitted ourselves before the throne and have begged for its intervention to arrest the tyrannical hands of the ministry and Parliament. Our petitions have been slighted; our debates have produced additional disagreements and insults; our submissions have been disregarded; and we have been spurned, with contempt, from the foot of the throne! In vain, after these things, may we indulge the fond hope of peace and reconciliation. There is no longer any room for hope. If we wish to be free—if we mean to preserve inviolate those inestimable privileges for which we have been so long contending—if we mean not basely to abandon the noble struggle in which we have been so long engaged, and which we have pledged ourselves never to abandon until the glorious object of our contest shall be obtained—we must fight! I repeat it, sir, we must fight!
3
Select the correct answer.
How does the author's use of the word "throne" inform the reader?
A.
It emphasizes the rich, time-honored traditions of the British monarchy.
B.
It implies that the British monarchy commands respect from its subjects.
C.
It represents the rigid authority that Great Britain maintains over the colonies.
D.
It suggests that Great Britain is too civilized to go to war with the colonies.
A. It emphasizes the rich, time-honored traditions of the British monarchy does the author's use of the word "throne" inform the reader.
What was Patrick Henry's speech to the Second Virginia Convention summarised as?Patrick Henry delivered this statement on March 23, 1775, in protest to intervention from the Royal Fleet that Lord Dunmore, the King's designated governor, had sent in. Mr. Henry was arguing that the Virginia colony needed to form a militia to protect its right to freedom.
In his "Speech at the Virginia Convention," Patrick Henry uses the rhetorical devices of reference and repetition to argue that the colonists should feel that fighting for their independence and rights is vital and that they should do so as soon as feasible.
learn more about Speech at the Virginia Convention
https://brainly.com/question/9475076
#SPJ1
All of the babies were in the same nursery and p.Vulgaris infections did not occur in any other unit in the hospital. P. Vulgaris was not found in the tap water. Now what will you look for
Answer:
You would look for the virus in other places
Explanation:
I need help with this practice problem Fill in the blanks
Solid fossil fuel are formed over millions of years by decay of land vegatation or plant remains. When the layers are settled and heated, coal is produced as deposits. Fossil fuels are burned to produce energy. Power plants burn coal or oil to build heat that is consequently used to make steam to drive turbines which generate electricity.
Answer - Solid fosiil fuel formed from decay of land vegetation or plant remains. Produces energy when burned.
In the most effective percussion technique of the posterior lung fields, the patient cooperates by:_____.
Answer:
folding the arms in front
Explanation:
lipid bilayers form when phospholipids are suspended in water. the edges of these sheets close upon each other and undergo self sealing to form vesicles (liposomes).
Select the statement that explain this property of bilayers
a. Lipids that form bilayers are amphipathic molecules
b. Particularly hydrophobic edges seal to exclude water
c. Lipids that form vesicles are extremely hydrophilic
d. Proteins bind lipids and catalyze are sealing process
The correct statement that explains this property of bilayers is "a. Lipids that form bilayers are amphipathic molecules".
Amphipathic molecules have both hydrophobic (water-fearing) and hydrophilic (water-loving) parts. In the case of phospholipids, the hydrophobic tails are attracted to each other and repelled by water, while the hydrophilic heads are attracted to water. When suspended in water, the phospholipids spontaneously arrange themselves into a bilayer, with the hydrophobic tails facing each other and the hydrophilic heads facing outward towards the water. This arrangement creates a barrier that excludes water from the interior of the bilayer, allowing for the formation of vesicles (liposomes).
For more such questions on Amphipathic molecules.
https://brainly.com/question/30431914#
#SPJ11
Which organ systems work together to help the body shiver in order to maintain homeostasis? circulatory and respiratory nervous and muscular circulatory and muscular respiratory and nervous.
Answer:
The organ systems that help the body shiver are the nervous system and the muscular system. When our temperature gets too cold, sensory neurons in the skin and the body detect it and send the message to the brain. The brain processes this information and then sends signals through the motor neurons to the muscles.
Explanation:
The organ systems that help the body shiver are the nervous system and the muscular system.
What happens when temperature gets too cold?When our temperature gets too cold, sensory neurons in the skin and the body detect it and send the message to the brain. The brain processes this information and then sends signals through the motor neurons to the muscles.
A nervous system simply refers to a network that typically consist of nerve cells and fibers, which are primarily used for the transmission of neural impulses (signals) and control of the muscular system in the body of a living organism.
This ultimately implies that, the nervous system is saddled with the responsibility of controlling the muscular system within the body of all living organisms.
In conclusion, we can reasonably infer and logically deduce that the nervous and muscular system are organ systems that helps the body of a living organism shiver.
Read more on nervous system here:
brainly.com/question/3381118
#SPJ5
Identify a human disorder with developmental limitations that results from changes in chromosome number. Explain how nondisjunction leads to changes in chromosome number.
Answer:
The Klinefelter syndrome is caused by the presence of one extra X chromosome (i.e., XXY males). Developmental limitations of this genetic disorder include: reduced muscle mass, neurodevelopmental problems, hypogonadism, etc. Abnormal chromosome numbers (known as aneuploidies) are usually caused by the nondisjunction of homologous chromosomes during Anaphase I or the nondisjunction of sister chromatids during Anaphase II
Explanation:
The Klinefelter syndrome is the most common sex chromosomal disorder in males, which is caused by the presence of an extra X chromosome (i.e., males with a XXY karyotype). This genetic disorder has many effects on development, including small testes (hypogonadism), weaker muscles, longer arms and legs, larger breasts than normal, infertility, immature development of secondary male sex features, cognitive problems (e.g., speech and language delays), etc. A chromosomal disorder occurs when chromosome pairs or chromatids fail to separate during meiosis, thereby producing cells (gametes) with more or fewer chromosomes than normal, a phenomenon known as aneuploidy.
Question 14 (2 points) The process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called natural selection. O mutation. genetic drift. migration.
The process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called a mutation.
A mutation is a sudden and lasting alteration in the DNA sequence that can influence genetic variation. Changes in the DNA sequence can influence phenotype, which may or may not have an effect on an organism's fitness. Mutations occur spontaneously, either from errors in DNA replication or from exposure to mutagenic agents. Mutations may happen in either coding or non-coding regions of the DNA, and they can be either silent or expressed.
Evolution is a natural process that results in the gradual change of inherited characteristics in populations over generations. It is the process of alteration in the inherited characteristics of species over successive generations. In other words, it is the process of gradual changes that happen to species over time as they adapt to their environments. It can be defined as a change in the gene frequency in a population over time.
Types of Evolution 1. Natural Selection 2. Genetic Drift 3. Gene Flow 4. Mutation 5. Non-Random Mating 6. Admixture 7. Mutation Pressure 8. Genetic Draft 9. Bottleneck and Founder Effect 10. Sexual Selection the process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called a mutation.
To learn more about DNA sequence here
https://brainly.com/question/31650148
#SPJ11