Which ecosystem demonstrates the greater biodiversity?Explain your conclusion

Answers

Answer 1

Many people think that coral reefs have more biodiversity than any other ecosystem on the planet—even more than a low rainforest. More than 25% of all sea life lives in coral reefs, which make up less than 1% of the ocean floor.

The number of different kinds of organisms that can be found in an ecosystem is known as its biodiversity. The higher biodiversity implies that the environment can support (keep up with) a wide range of sorts of makers, customers, and decomposers. This typically indicates that the location is healthy.

Brazil is the planet's champion for biodiversity. Between the Amazon rainforest and Mata Atlantica backwoods, the woody savanna-like cerrado, the enormous inland marsh known as the Pantanal, and a scope of other earthbound and sea-going biological systems, Brazil drives the world in plant and land and water proficient species counts.

To learn more about coral reefs here

https://brainly.com/question/15794949

#SPJ4


Related Questions

The molecule of water is described as a polar molecule polar molecules have an unequal sharing of electrons explain how this unequal sharing is present by using our water molecule graphic below

Answers

The unequal sharing of electrons means that the atoms are unsymmetrically arranged within the molecules like water. The shape of the water molecule has two poles a positive charge on the hydrogen pole and a negative charge on the oxygen pole.  

What is a Polar molecule?

A Polar molecule may be defined as a type of molecule that has a charge on one side of the molecule, that is not canceled out. Apart from this, polar molecules have a region of partial charge. One end is slightly positive one end is slightly negative.

The oxygen atom in a water molecule has a stronger pull on the negative bonding electrons the oxygen atom has a slightly negative charge and the hydrogen atom has a positive charge. Due to this, unequal sharing of electrons may have arisen which is called a polar bond or dipole.

To learn more about Unequal sharing of electrons, refer to the link:

https://brainly.com/question/1906476

#SPJ1

how does the dna polymerase that is synthesizing the lagging strand stay bound to its template dna strand and coordinate with the dna polymerase on the leading strand?

Answers

The dna polymerase that is synthesizing the lagging strand stay bound to its template dna strand and coordinate with the dna polymerase on the leading strand is DNA polymerase on the leading strand attaches to DNA polymerase on the trailing strand.

DNA replication is the process of doubling the DNA chain assisted by DNA polymerase before mitosis or meiosis I in the S phase of the cell cycle. The DNA is made of two strands and each strand of the parent cell acts as a template for the production of complementary strands.

The lagging strand is the synthesized DNA strand and is located in the 5'→3' direction at the replication fork. During the replication process, nucleotides will be added to the end of the sugar from the Okazaki fragment with the help of DNA ligase enzymes. In order for the lagging strand to remain attached to the template DNA strand, the DNA polymerase on the leading strand attaches to the DNA polymerase on the trailing strand.

Learn more about DNA replication  at:

https://brainly.com/question/16464230

#SPJ4

Eyeglasses would rest upon which skull bone?

Answers

Answer:

axial skeleton

Explanation:

Nasal bone ( this is where the glasses touch the nose)

Alive (%)
100
Monita Farms
Control Farm
If you wish, you can select a different mechanism of evolution:
Gene Flow
Genetic Drift
Test Farm
Natural Selection
Hypothesize I
This is your final chance to revise your hypothesis. Explain how this new data supports your hypothesis.

Alive (%)100Monita FarmsControl FarmIf you wish, you can select a different mechanism of evolution:Gene

Answers

The new data supports the hypothesis that natural selection is the mechanism of evolution.

How to explain the hypothesis

In the control farm, where the bacteria were not exposed to antibiotics, 100% of the bacteria survived. However, in the test farm, where the bacteria were exposed to antibiotics, only 30% of the bacteria survived.

This suggests that the bacteria that were resistant to the antibiotic were more likely to survive and reproduce, passing on their resistance genes to the next generation. Over time, this would lead to a population of bacteria that is increasingly resistant to antibiotics.

This is an example of natural selection because the bacteria that were better adapted to their environment (the ones that were resistant to the antibiotic) were more likely to survive and reproduce. This led to a change in the population of bacteria over time, as the resistant bacteria became more common.

Learn more about hypothesis on

https://brainly.com/question/606806

#SPJ1

Two brown-eyed parents have a child. The child has blue eyes.
Which term best describes the allele for the child's blue eyes?
O heterozygous
O homozygous
O dominant
O recessive

Answers

The term that best describes the allele for the child's blue eyes is recessive. Thus, the correct option for this question is D.

What is a Recessive allele?

A recessive allele may be defined as a kind of allele that when present on its own will not affect the individual. It will only be expressed in the phenotype if two copies of it are present.

According to the context of this question, the brown eye (B) is dominant over the blue eye (b). The parents have genotypes brown-eyed which means they are heterozygous for brown-eye (Bb) and when they interbreed with each other, they produce a blue eyes child which has a recessive allele of (bb).

Therefore, the term that best describes the allele for the child's blue eyes is recessive. Thus, the correct option for this question is D.

To learn more about Recessive alleles, refer to the link:

https://brainly.com/question/463037

#SPJ1

CO2 + H2O + energy --> C6H1202 + O2 , what is this formula for ?

Answers

Answer:

Photosynthesis, the energy is sunlight

a is a part of the shore that sticks out into the beach​

Answers

Answer:

headland

Explanation:

the structure of the spleen and lymph nodes are composed mainly of

Answers

The structure of the spleen and lymph nodes are composed mainly of Reticular loose connective

The spleen is the body's biggest lymphatic organ. The spleen is made up of two types of tissue: white pulp and red pulp. It is surrounded by a connective tissue capsule that continues inside to split the organ into lobules. The white pulp is lymphatic tissue made up primarily of lymphocytes that surround arteries.

Lymph nodes are made up of lymph tissue and other types of cells, such as white blood cells (lymphocytes). Lymph nodes and other lymphatic organs such as the spleen and thymus contain lymphocytes, which are unique white blood cells. These may rapidly proliferate and produce antibodies in response to bacteria, viruses, and a variety of other stimuli emitted by dead or dying cells, as well as improperly behaving cells such as cancer cells.

Learn more about lymph nodes

https://brainly.com/question/29829253

#SPJ4

Full Question

The structure of the spleen and lymph nodes are composed mainly of ______-

8. PLEASE HELP A LOT OF POINTSSS

8. PLEASE HELP A LOT OF POINTSSS

Answers

Answer:

A. Decompose and grass

Explanation:

grass will grow and die and decompose down into soil as it dried off and faded away overtime.

Answer:

c

Explanation:

Frogs and snakes both compete for the same food source! Which is the decomposer!!

What argument has been advanced to explain how the configuration of the continents could have given seed plants an advantage at that time over non-seed plants such as horsetails, lycopods, and ferns? (Include in the "argument" two things - what conditions would result from the configuration of the continents and how seed plants could take better advantage of those conditions than a non-seed plant such as a fern.)

Answers

The argument that has been advanced to explain how the configuration of the continents could have given seed plants an advantage over non-seed plants is based on the fact that seed plants have a more efficient means of reproduction and dispersal.

During the Devonian period, when seed plants evolved, the continents were still largely connected, forming a large supercontinent known as Gondwana. This configuration created a drier interior, as the large landmasses blocked the moisture-carrying ocean winds. Seed plants, with their ability to produce seeds that can be dispersed by wind or animals, were better adapted to survive in these drier conditions compared to non-seed plants like horsetails, lycopods, and ferns, which relied on spores for reproduction and dispersal.

Additionally, seed plants developed a protective seed coat that allowed them to survive harsher environments and have a better chance of germination. These adaptations gave seed plants a competitive edge over non-seed plants and helped them dominate the land during the Carboniferous period.

TO KNOW MORE ABOUT efficient means of reproduction CLICK THIS LINK -

brainly.com/question/12189028

#SPJ11

fungibility is the property of an entity whose individual units multiple choice question. are interchangeable. each serve a unique purpose. are nearly impossible to identify. are less valuable when they are used together.

Answers

Fungibility is the property of an entity whose individual units are interchangeable. This means that each unit of the entity can be easily exchanged or replaced with another identical unit without affecting its value or utility.

Fungibility refers to the ability of individual units of an entity to be interchangeable with one another, without affecting their overall value or utility. This means that each unit can be substituted for another without any loss of functionality or quality. However, it is important to note that in some cases, individual units may be considered less valuable when they are used together, as opposed to separately. For example, a bundle of items sold together may be priced lower than the sum of their individual values if they were sold separately because they are considered less valuable as a package deal.

To know more about  Fungibility

https://brainly.com/question/10317963

#SPJ11

HELP ASAP!!!! WILL GIVE BRAINLIEST!!!!!
What does a sound scientific conclusion most likely rely upon?

a) Meticulously collected data sets that are irrefutable
b) Anecdotal evidence collected over thousands of years
c)Evidence that is independently verified through a systematic process
d) Evidence that provides all of the answers about natural phenomena

Answers

Answer:

c)Evidence that is independently verified through a systematic process

Answer:

I think it relies on evidence that provides app answers about natural phenomena

Describe the location of 2 living organisms on a phylogenic tree if they are considered
closely related.

Answers

The location of 2 living organisms on a phylogenic tree if they are considered closely related will be from the same branch.

What is a phylogenic tree?

A phylogenic tree is a diagram that shows the evolutionary relationships between two or more organisms.

The phylogenic tree is in the form of a tree with various branching points. The branching points in a phylogenic tree represents the point or time in which two related organisms diversify or acquire feature that makes them differ from each other.

Related organisms will originate from the same branch of the tree. over time, as a result of mutation and other changes, the organisms will branch away from each other.

Learn more about a phylogenic tree at: https://brainly.com/question/23213472

#SPJ1

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

Identify the TWO body systems that are directly interacting together in the scenario:
Heavy breathing while running on the treadmill.

Answers

Respiratory and circulatory systems that interact directly with each other in the scenario.

What are the functions of the respiratory system?

The main task of the respiratory organs is to bring fresh air into the body while removing waste. Once the oxygen reaches the lungs, it enters the bloodstream and travels throughout the body.

Functions of the respiratory organs include gas exchange, acid-base balance, phonation, lung protection and metabolism, and processing of bioactive substances.

The important functions of the respiratory organs are inhalation and exhalation of gases, gas exchange between the bloodstream and lungs, gas exchange between the bloodstream and body tissues, the smell and vibration of the vocal cords.

Learn more about the respiratory system:

https://brainly.com/question/190530

#SPJ9

Reduced blood volume and reduced blood pressure are characteristics most closely associated with _________________.

Answers

Reduced blood volume and reduced blood pressure are characteristics most closely associated with hypovolemic shock. Hypovolemic shock is a medical emergency that occurs when a person loses over 20% of their blood volume. When the blood volume is reduced, the amount of blood that is available to deliver oxygen and nutrients to the body's tissues is also reduced. This lack of oxygen and nutrients can cause the body's organs to fail, leading to organ damage and death.

Hypovolemic shock is caused by a variety of factors, including trauma, bleeding, burns, vomiting, and diarrhea. When a person is in hypovolemic shock, their body tries to compensate by increasing the heart rate, narrowing the blood vessels, and releasing hormones that help to maintain blood pressure. However, these compensatory mechanisms are often not enough to maintain the body's normal functioning.

Treatment for hypovolemic shock involves stopping the bleeding or other cause of fluid loss, replacing lost fluids and blood, and providing oxygen to the body's tissues. It is a medical emergency that requires prompt and effective treatment to prevent organ failure and death.

know more about Hypovolemic shock click here:

https://brainly.com/question/31603755

#SPJ11

Which of the following is true about the principle of the conversation of mass

Answers

Answer:

I don't see a file attached.

In physics and chemistry, the law of conservation of mass or principle of mass conservation states that for any system closed to all transfers of matter and energy, the mass of the system must remain constant over time, as the system's mass cannot change, so quantity can neither be added nor be removed.

Explanation:

Answer:

i dont know and idc u get none thanks for the points

Explanation:

botch

What is natural selection? Describe the peppered moths example of natural selection. NO LINKS PLEASE

Answers

Natural selection is the mechanism by which beneficial alleles rise in frequency in the population over time.

The peppered moth is an example of natural selection acting to change the frequency of a certain trait in the population over time. During the Industrial Revolution, there was a directional change in the color of the peppered moth population around Manchester. That is, there was an increase in the frequency of dark colored peppered moths within the population. This was because the increased air pollution due to the industrial revolution created a situation where the dark colored version of the peppered moths had a higher relative fitness than the light colored peppered moths (which were the traditional variety). After pollution was reduced later on, there was a increase in frequency of light colored moths, as the dark colored moths no longer received a relative fitness benefit from their dark coloration.

Which codon is the code for the amino acid histidine? (His)

Which codon is the code for the amino acid histidine? (His)

Answers

Answer: B) CAU

Explanation:

I just did the test ;)

compare the two procedures used to obtain the cells needed for preparing a fetal karyotype?

Answers

Amniocentesis. This procedure collects a sample of the amniotic fluid that surrounds the unborn baby during pregnancy. The fluid contains cells from the baby that can be tested. Amniocentesis is usually done between week 15 and 20 of pregnancy.

Passive transport is the movement of molecules across the cell membrane without requiring an input of cellular energy. identify which of these options are examples of passive transport.
a. do not require cellular energy to allow molecules to pass through the cell membrane.
b. do not require cellular energy because the kinetic energy of the molecules' movement will drive the movement down the concentration gradient.
c. do not require cellular energy because the molecules are small enough to fit through the membrane.
d. All of the above.
e. a and b
f. None of the above.

Answers

The movement of molecules across a cell membrane known as passive transport occurs without the use of cellular energy.

Special compounds can pass through plasma membranes to enter and leave the cell, keeping out dangerous substances and allowing in only necessary substances. Selectively permeable, plasma membranes let some compounds pass through while preventing others. If they abandon this selectivity, the cell won't be able to strengthen itself and would perish. The majority of passive membrane transfer methods are direct. Passive transport is a phenomena that happens naturally and does not require the cell to use energy to move. Instead of using cellular energy like active transport, which drives the movement of molecules across cell membranes, passive transport relies on the second law of thermodynamics.

Learn more about passive transport

https://brainly.com/question/29764225

#SPJ4

CAN I PLZ HAVE SOME HELP!!!! DUE TO NIGHT
choose answer chose (ROW 1 , ROW 2 , ROW 3 , ROW 4)

CAN I PLZ HAVE SOME HELP!!!! DUE TO NIGHTchoose answer chose (ROW 1 , ROW 2 , ROW 3 , ROW 4)

Answers

Answer:

Row 2

Explanation:

It is a food chain, not a food web. It is more complex than the food web.

in what way is the pupil reflex different from some other reflexes?
A A change in the environment causes impulses in the sensory neurone
B The function of the reflex is protective
C The relay neurones are in the brain
D The response occurs quickly​

Answers

Answer: The Answer is A

Explanation:

The answer is b bc i did this

Prey
A. An animal that is hunted and killed by another for food
B. Is a way an animal’s body helps sit survive or live in its environment
C.is an animal that eats other animals

Answers

Answer: A

Explanation:

i took biology and all that fun stuff with trophic levels

The answer is a because the predator eats the prey

What effect will boiling have on an enzyme's activity?
decreased active site due to changed shape
increased active site due to changed shape
O
less substrate due to increased product formation
o
more product due to increased molecular movement

Answers

Answer:

decreased active site due to changed shape.

Explanation:

With the rising temperature, chemical bonds between molecules of enzymes break resulting to alter the standard shape of enzymes. the active site no longer fits substrate molecules and thus the effect of enzymes decreases.

Which is NOT a characteristic of all vertebrates?
a backbone
an exoskeleton
paired appendages
a well-developed brain protected by a skull

Answers

The answer would be A. A backbone
The answer is A.Backbone

What is required for PKC activation? Choose one: A. binding to Gq and DAG B. binding to Gq C. binding to DAG D. continuing presence of Ca2+ E. binding to DAG and continuing presence of Ca2+

Answers

The right answer, based on the facts provided, is E binding to DAG and continued Ca2+ present.

How does PKC get started?

1,2-diacylglycerol, which is generated by the receptor-mediated hydrolysis of inositol phospholipids, activates protein kinase C (PKC) (1). The regulatory and catalytic domains are located in the amino- as well as carboxyl-terminal portions, respectively, of PKC's wide family of many isoforms.

How is PKC turned off?

These second messengers, diacylglycerol as well as Ca2+, attach to PKC's regulatory modules, the C1 and C2 domains, respectively, activating PKC. PKC is activated by raising the intracellular concentrations both Ca2+ and diacylglycerol; inactivated by lowering these ligands to baseline levels.

To know more about PKC visit:

https://brainly.com/question/29606875

#SPJ4

Student Instructions: In this activity you are going to participate in a Discussion Board. To prepare yourself for the discussion, read the Case Study 7.1. Pathology of beluga whales in the St. Lawrence estuary, Quebec, Canada which you may find on page 399 of the textbook. Open a trend by answering one of the following questions: - Which was the origin and number of the control beluga population used to study the population of the St. Lawrence estuary? - Make a list of possible pollutants and origin which pose a toxic effect responsible of diminishing the Beluga population in the St. Lawrence estuary. - Stablish the relation chemical compound - symptom or damage for two pollutants. - Name one of the symptoms associated with endocrine disruption.

Answers

Regarding the relation between chemical compounds and symptoms/damage, let's choose two pollutants. For instance, PCBs can lead to reproductive issues in beluga whales, while mercury can cause neurological damage.
Finally, one symptom associated with endocrine disruption is the disturbance of hormone levels, leading to reproductive abnormalities in beluga whales.

The Case Study 7.1 discusses the pathology of beluga whales in the St. Lawrence estuary, Quebec, Canada. To answer the question regarding the origin and number of the control beluga population used for studying the St. Lawrence estuary population, we need to refer to the textbook's page 399.

To address the question about possible pollutants and their origins that have toxic effects on the beluga population, we can compile a list. Examples include heavy metals like mercury from industrial activities, polychlorinated biphenyls (PCBs) from electrical equipment, and polycyclic aromatic hydrocarbons (PAHs) from oil spills.

Regarding the relation between chemical compounds and symptoms/damage, let's choose two pollutants. For instance, PCBs can lead to reproductive issues in beluga whales, while mercury can cause neurological damage.

Finally, one symptom associated with endocrine disruption is the disturbance of hormone levels, leading to reproductive abnormalities in beluga whales.

To know more about polychlorinated biphenyls visit:

brainly.com/question/33710986

#SPJ11

Systemic lupus erythematosus is caused by: Group of answer choices a chronic allergic condition. development of an immune-deficient state. a deficiency of T lymphocytes. immune complex deposits of antinuclear antibodies NAT 302

Answers

Systemic lupus erythematosus is caused by immune complex deposits of antinuclear antibodies.

Systemic lupus erythematosus (SLE) is an autoimmune disease caused by the formation and deposition of immune complexes containing antinuclear antibodies (ANAs).

These immune complexes cause inflammation and damage to various organs and tissues, leading to the diverse clinical manifestations of the disease.

SLE is not a result of a chronic allergic condition, development of an immune-deficient state, or a deficiency of T lymphocytes.

Instead, it is primarily driven by the body's immune system attacking its own cells due to the presence of these autoantibodies, resulting in a range of symptoms and complications.

For more such questions on  lupus erythematosus, click on:

https://brainly.com/question/15190521

#SPJ11

A seedling sprouts and its roots crack apart concrete, it is a type of _________ weathering. A. Organic B. Physical C. Chemical D. Biological Hurry!

Answers

Answer:

The correct answer is - D. biological.

Explanation:

Wheathering is the process of breaking of the rocks or soil. It can be of different types on the factors such as chemical wheathering, physical wheathering and biological wheathering.

When a seed fall on to on a rock surface its sprouts, push roots into cracks in the rock or concrete. As the roots of plants develop, they secrete weak acids that slowly dissolve rock around the roots.

It is a type of biological wheathering.

Other Questions
A couple plans to have 4 children. The gender of each child is equally likely. Design a simulation involving 55 trials that you can use to model the genders of the children. Write your answers as numbers.You can toss __ coins __ times. Janie has $48 in her checking account. If she writes a check for $19, find her new account balance. I would like help and please don't google it cause that won't help at all. Why is it important to be agile at any stage in your life? Which statement is the most likely conclusion you can draw from the cause-and-effect relationship shown in the diagram?CauseEffectThe TranscontinentalRailroad is completedin 1869.The population ofcities in the AmericanWest grows.A. Most American settlers refused to travel on the TranscontinentalRailroad.B. Most American settlers considered the Transcontinental Railroada failure.C. The Transcontinental Railroad made it harder for more Americansettlers to move west.O D. The Transcontinental Railroad made it easier for more Americansettlers to move west. The fallopian tubes link the A. ovaries and uterus B. cervix and uterus C. bladder and urethra D. uterus and vagina HELP PLEASEKrystal bought 9 pounds of ground beef. She saved $8.37 by using a coupon. How much did she save per pound of ground beef? Four big water bottles can hold 8 gallons of water. How much water can 10 big water bottles hold? MAX POINTS!!!! Please help me solve the problem in the picture and tell me what Im doing also explain each step. what is the highest position a pediatrician could get? The difference between the Ricardian model of trade and the immobile factor model is that: O Ricardo assumed one factor of production while the immobile factor model assumed two factors of production, labor and capital. O Ricardo considered the country s workforce as an endogenous variable, while the immobile factor model considered labor supply as exogenous. O Ricardo assumed a barter economy while the immobile factor model introduced money into the system. O Ricardo assumed labor was immobile between industries, while the immobile factor model considered labor to be immobile only between countries. O Ricardo assumed labor employed in each sector to be endogenous, but the immobile factor model assumed labor employed in each sector to be exogenous. Which three characteristics make a glowing piece of charcoal a blackbody radiator? A. The frequencies of EMR it emits depend on its temperature. B. It emits only one frequency of EMR. C. It absorbs most of the EMR it receives. D. It emits a range of wavelengths of EMR. A survey of students' favorite sports was taken from a random sample ofstudents in a school. The results are shown in the table below. If there are550 students in the school, predict how many students at the school prefertrack and field. *Students' FavoriteSportsSoccer8Baseball/Softball 3Volleyball5Track & Field4.Your answer Given that f(x) = 4x + 5 and g(x) = x2 - 2x - 2, find (f + g)(x).A) (f + g)(x) = x2 + 2x+3B) (f + g)(x) = x2 + 6x+ 3C) (f + g)(x) = -x2 + 6x + 7D) (f + g)(x) = x2 + 2x - 7 Add 6.1 and 51.24What the answer please :) The system of Sharia was developed to join together _____ and _____ in Islamic countries. Draw the structure of the alkene that reacts with hbr to give the alkyl bromide as the major organic product. What could B-29 Bombers do once the Marianas Islands were captured? TRUE/FALSE. Group cohesion is a term used to describe feelings of interpersonal attraction and the sense of belonging to the group by its members. TRUE/FALSE. Researchers found that it is important that a persons decision to exercise should be linked to a desire to lose weight. TRUE/FALSE. Exercise barriers are called perceived barriers because they are fact based Where does oxygen enters first How do the commercial and social implications of printmaking relate to contemporary American culture?