The best role of communication in scientific investigations is 1) Communication can help identify good scientific questions to further investigate.
Communication is a critical aspect of scientific investigations, and it plays several roles throughout the research process. One of the most important roles is to help identify good scientific questions to investigate. Scientists may communicate with each other to exchange ideas, discuss current research findings, and identify knowledge gaps that need to be addressed. This collaboration can lead to new research questions and hypotheses that may not have been considered otherwise.
Once the data are collected, communication is still necessary as scientists often collaborate to analyze the data and interpret the findings. Collaboration and communication can help ensure that the data are analyzed correctly and the findings are valid.
Overall, communication is important to help scientists convince other researchers that their results are valid.
Therefore, the option 1. Communication can help identify good scientific questions to further investigate is correct.
To learn more about communication here
https://brainly.com/question/29811467
#SPJ1
The ___________ hemisphere of the brain develops strengths in nonverbal areas such as comprehension of spatial relationships, recognition of patterns and drawings, music, and emotional expression.
Answer:
the right hemisphere
Explanation:
Where is starch stored in the chloroplast?
Answer:
Stroma
Explanation:
Starch is stored in the stroma of chloroplast and in the cytoplasm of leaves.
Neurons in the somatosensory cortex receive somatic sensory information from ______.
Neurons in the somatosensory cortex receive somatic sensory information from Efferent neurons.
The somatosensory cortex gets tactile records from the body, along with sensations such as contact, pressure, temperature, and ache. This sensory records is then carried to the brain thru neural pathways to the spinal wire, brainstem, and thalamus.
The number one somatosensory vicinity of the human cortex is placed within the postcentral gyrus of the parietal lobe. The postcentral gyrus is the place of the primary somatosensory vicinity, the vicinity of the cortex dedicated to the processing of touch information.
Sensory receptors are categorized into five classes: mechanoreceptors, thermoreceptors, proprioceptors, ache receptors, and chemoreceptors.
Learn more about Neurons here:-https://brainly.com/question/13061744
#SPJ1
Neurons in the somatosensory cortex receive somatic sensory information from Afferent neurons.
Afferent Neurons or Sensory Neurons receive information from the sensory neurons to the somatosensory cortex.
The somatosensory cortex gets tactile records from the body. Along with sensations such as pressure and temperature.
The sensory records is carried to the brain through neural pathways to the spinal cord and deep brain.
The number one somatosensory vicinity of the human cortex is placed within the postcentral gyrus of the parietal lobe. The postcentral gyrus is the place of the primary somatosensory vicinity, the vicinity of the cortex dedicated to the processing of touch information.
Sensory receptors are of following types:
MechanoreceptorsThermoreceptorsProprioceptorsAche receptors ChemoreceptorsLearn more about Neurons here, brainly.com/question/13061744
#SPJ1
What are some of the interactions between the geosphere, hydrosphere, and atmosphere that relate to changing in the sea levels?
The geosphere, hydrosphere, and atmosphere interact to cause changes in sea level through processes like erosion, sea level rise, and climate change.
The geosphere, hydrosphere, and atmosphere are interconnected and affect one another. For example, melting glaciers and ice caps (geosphere) contribute to rising sea levels (hydrosphere). Changes in atmospheric temperature (atmosphere) can also affect sea levels through thermal expansion. Additionally, erosion and sedimentation processes (geosphere) can alter the shape and size of coastlines (hydrosphere).
Climate change (atmosphere) also plays a significant role in sea level changes, as it leads to increased ocean temperatures, melting ice caps, and thermal expansion. These interactions between the geosphere, hydrosphere, and atmosphere are complex and intertwined, and understanding them is crucial in predicting and mitigating the effects of sea level change on human societies and the environment.
Learn more about geosphere here:
https://brainly.com/question/16930020
#SPJ11
describe the arrangement of water molecules in a solid, liquid and gas form. how does the movement of the molecules differ in each form? Describe the bonds when the molecules are in motion.
Answer:
In a solid, the molecules are tightly packed in neat rows and they vibrate quickly. Solids have a definite shape and volume. In a liquid, the molecules have more energy and they move around more freely. Liquids have a definite volume but they don't have a definite shape. The molecules in gases are spread apart and move very freely with very much energy. Gases do not have a definite shape or volume.
Hope this helps!
:)
The description of the arrangement of water molecules and their motion in a solid, liquid and gas form and how they differ in each form is as follows:
Solid state is characterized because the molecules that compose it are very close together by a network of covalent bonds and in more or less fixed positions; this makes the distance between the particles practically unchanged.
This is due to the fact that the attractive forces are very intense and the particles are only free to carry out small vibrations and that is why solids have constant shape and volume.
In the liquid state, the forces between the particles are weaker than in the solid state, which allows the particles to have some freedom of rotation and translation, due to mobile ions.
Besides the vibration; they can slide over each other and maintain a constant mean distance between them without being fixed.
For this reason, liquids, unlike solids, take variable forms, depending on the container that contains them and they can also flow easily.
Their similarity to solids is based on the fact that, like the solids, they are difficult to compress and have constant volume.
In the gaseous state the attractive forces are practically zero and the particles acquire a total mobility of vibration, rotation and translation,
Being the distance between the molecules much greater than the one that they have in solid or liquid state and, in addition, variable at all times.
Gases, unlike solids and liquids, can be easily compressed or expanded and also take the shape of the container that contains them, occupying the entire available volume.
Therefore, the intensities of the interactions or cohesion forces of water molecules are not the same in solids, liquids and gases, the effects of movement and interaction on the arrangement of the particles are opposed, resulting in different states of aggregation.
Learn more here: https://brainly.com/question/18155670
in a patient, at what phase of the bacterial growth curve do antibodies and white blood cells affect the progress of the disease?
In a patient, antibodies and white blood cells affect the progress of the disease during the log phase of the bacterial growth curve.
The bacterial growth curve is a graph that represents the growth of bacterial populations over time. It is divided into four phases: lag phase, log phase (exponential phase), stationary phase, and death phase.
During the log phase of bacterial growth, bacteria multiply rapidly and achieve maximum growth rate. At this point the immune system responses to the infection, which includes the production of antibodies, proliferation and activation of white blood cells.
If the immune response is adequate, the bacteria may be effectively controlled and the growth curve will have quick transition into the stationary phase and progress into the death phase.
To know more about immune response here:
https://brainly.com/question/29557865#
#SPJ4
When particles collide, they transfer
Answer:
energy
Explanation:
When particles collide, they transfer
✔ energy
i just got it right
the peritoneal cavity (a) is the same thing as the abdominopelvic cavity, (b) is filled with air, (c) like the pleural and pericardial cavities is a potential space containing serous fluid, (d) contains the pancreas and all of the duodenum.
The peritoneal cavity is a potential space containing serous fluid that surrounds the organs of the abdominal cavity. Therefore, option (c) is the correct answer.
Here Option (a) is not entirely correct. While the peritoneal cavity is located within the abdominopelvic cavity, the two terms are not interchangeable. The abdominopelvic cavity includes both the abdominal and pelvic cavities. Option (b) is incorrect. The peritoneal cavity is not normally filled with air, but rather contains a small amount of serous fluid that helps lubricate and protect the organs within it.
Option (d) is also incorrect. While the pancreas and the first part of the duodenum are located within the peritoneal cavity, not all of the duodenum is contained within it. The second through fourth parts of the duodenum are retroperitoneal, meaning they lie behind the peritoneal cavity and are not surrounded by it.
Learn more about peritoneal cavity Visit: brainly.com/question/13020486
#SPJ4
Which factor does NOT change the size of population?
A. Aging
B. Birth
C. Death
D. Living
A. Aging
hope it helps you
What is the best example of biological contamination food handlers?
Answer:
Failure to wash hands properly before handling food.
Explanation:
When a person, prepares or handles food without properly washing their hands or properly sanitizing equipment and surfaces,it can lead to contamination. This can lead to the spread of the illness to others through the contaminated food. It is important for food handlers to practice good hygiene and sanitation to prevent the spread of illness to the food consumers and fellow workers.#spj4
What are haploid cells, and which cells are haploid?
A. haploid cells have the normal amount of DNA; these are the parent cells.
B. haploid cells have half as much DNA as a normal cell; these are the parent cells.
C. haploid cells have the normal amount of DNA; these are the four daughter cells.
D. haploid cells have half as much DNA as a normal cell; these are the four daughter cells
Answer:
A
Explanation:
i am sorry if this is wrong
which part of the basilar membrane responds to high frequency sounds and why? choose the correct option.
The part of the basilar membrane responds to high frequency sounds is the base .
What is the basilar membrane?
The scala media and the scala tympani, two liquid-filled tubes that go through the coil of the cochlea, are divided by the basilar membrane, a stiff structural component inside the cochlea of the inner ear. When sound waves enter the basilar membrane, they become traveling waves on the membrane, which cause the basilar membrane to rise and fall in response.
Due to the fact that low frequencies induce maximum membrane displacement at the apical end and high frequencies generate maximal membrane displacement close to the base of the cochlea (near the stapes). The wave must travel more to reach the peak if the sound constantly goes from base to apex.
Therefore the part of the basilar membrane responds to high frequency sounds is the base .
To know more about basilar membrane from the given link
https://brainly.com/question/14819706
#SPJ4
The body’s internal environment must say
Answer:
Within narrow ranges that support human life
How do vaccines work if the pathogen in them is dead?
A. The immune system holds on to the dead pathogen from the vaccine, and if you are infected again, the new pathogen recognizes the dead
form of itself and becomes inactive so that it is not killed as well.
B. It causes antibodies to be generated that take the form of the pathogen, so the next time it is encountered, the antibodies make the pathogen
think the body is friendly and not a target.
C. It causes memory cells to be generated so that next time the pathogen is encountered the immune response is very fast, killing the pathogen
before it can do any harm.
D. The vaccine alters your body chemistry so that whichever pathogen you are vaccinated against cannot even enter your body in the first place.
Answer:
B
Explanation:
Vaccination is the conferring of immunity to an individual by artificial means. A vaccine can be in the form of weakened or dead disease causing micro organisms. In the body, the dead pathogens stimulate the production of specific antibodies by the body such that next time the body gets infected by the actual pathogens, there will be no serious illness caused.
the liver doesn’t have the enzyme needed for consuming ketone bodies. why is this?
The liver does not have the enzyme needed for consuming ketone bodies because the liver is the major site of ketone body formation, and ketone bodies are generated by liver cells through the process of ketogenesis.
What are ketone bodies? Ketone bodies are formed by the liver cells as a by-product of fatty acid metabolism during times of low carbohydrate intake or starvation, and they serve as an alternative fuel source for the body.
Ketone bodies are a type of acid that is produced when the body breaks down fat for energy instead of using carbohydrates.
They include acetoacetate, beta-hydroxybutyrate, and acetone. The liver is the primary site of ketone body synthesis, and ketogenesis is the process by which ketone bodies are formed.How does the liver produce ketone bodies? The liver produces ketone bodies through a process called ketogenesis.
During ketogenesis, the liver breaks down fatty acids into acetyl-CoA, which is then used to produce ketone bodies. When glucose is scarce, the body begins to break down fatty acids for energy.
This process occurs primarily in the liver, where fatty acids are converted to acetyl-CoA, which then enters the citric acid cycle. When the citric acid cycle is overwhelmed, excess acetyl-CoA is converted to ketone bodies instead of being used for energy.
learn more about liver ketogenesis at https://brainly.com/question/31389509
#SPJ11
the heart is a cone-shaped muscular organ located within the (1) . its apex rests on the (2) , and its base is at the level of the (3) rib. the coronary arteries that nourish the myocardium arise from the (4) . the coronary sinus empties into the (5) . relative to the roles of the heart chambers, the (6) are receiving chambers, whereas the (7) are the discharging chambers. the outermost layer of the heart is called the (8) . the fluid that fills the pericardial sac acts to decrease (9) during heart activity. the heart muscle, or myocardium, is composed of a specialized type of muscle tissue called (10) .
The heart is a cone-shaped muscular organ located within the thoracic cavity. Its apex rests on the diaphragm, and its base is at the level of the fifth rib. The coronary arteries that nourish the myocardium arise from the aorta. The coronary sinus empties into the right atrium. Relative to the roles of the heart chambers, the atria are receiving chambers, whereas the ventricles are the discharging chambers.
The outermost layer of the heart is called the epicardium. The fluid that fills the pericardial sac acts to decrease friction during heart activity. The heart muscle, or myocardium, is composed of a specialized type of muscle tissue called cardiac muscle.
The heart is a cone-shaped muscular organ located within the (1) thoracic cavity. Its apex rests on the (2) diaphragm, and its base is at the level of the (3) third rib. The coronary arteries that nourish the myocardium arise from the (4) aorta.
The coronary sinus empties into the (5) right atrium. Relative to the roles of the heart chambers, the (6) atria are receiving chambers, whereas the (7) ventricles are the discharging chambers. The outermost layer of the heart is called the (8) epicardium. The fluid that fills the pericardial sac acts to decrease (9) friction during heart activity. The heart muscle, or myocardium, is composed of a specialized type of muscle tissue called (10) cardiac muscle.
To know more about tissue visit-
https://brainly.com/question/17664886
#SPJ11
NASCAR fans love race day when they get a chance to cheer on their favorite team! If a driver was able to travel 960 kilometers in 3 hours, what was his average speed?
If a NASCAR driver was able to travel 960 kilometers in 3 hours, his average speed was 320 km/hr.
What is average speed?Average speed is a measure of the distance traveled by an object, divided by the time it takes to travel that distance. It is a scalar quantity, expressed in units of distance per unit of time, such as meters per second or kilometers per hour.
The average speed can be calculated by dividing the total distance traveled by the time taken.
Average speed = 960 km / 3 hours = 320 km/hr
So, the driver's average speed was 320 km/hr.
Find out more on average speed here: https://brainly.com/question/4931057
#SPJ1
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
what happens at the synapse between two neurons
Answer:
transfer of electrical signals occurs at the synapses of two nurons
Answer: an action potential that makes neuron A release a chemical neurotransmitter. The neurotransmitter can help (excite) or hinder (inhibit) neuron B from firing its own action potential
Explanation:
Why do ecologist measure biomass
Answer:I have no clue
Explanation: I really don't have an explanation, as my brain can't seem to comprehend one
In a food web, which type of organism receives energy from every other food type?
Answer:
Decomposer
Explanation:
<3
Answer:
Called
Explanation:
Heterotrophs Meaning:
A heterotroph is an organism that cannot produce its own food, instead taking nutrition from other sources of organic carbon, mainly plant or animal matter. In the food chain, heterotrophs are primary, secondary and tertiary consumers, but not producers.
20 POINTS EASY PUNNETT SQUARES PLS HELP
(The questions are in the picture. Please answer all question to get the points)
Answer:
See file below
Explanation:
See file below
let me know if this helped by hitting thanks or brainliest! if not, please comment and I'll get back ASAP.
We say that the event horizon of a black hole is the outermost "trapped surface." What is being trapped, and why? [Select] trapped because of [Select] Question 6 is(are) being the direction to the fut
The trapped surface of a black hole is a sphere, and it is called the event horizon. It represents the surface where the gravitational force is so strong that not even light can escape.
In this way, anything inside the event horizon of the black hole is trapped, even light, hence the term "trapped surface."This phenomenon occurs because a black hole has an enormous gravitational force that pulls everything toward it, even light. As an object approaches a black hole, the gravitational force on it increases, and it becomes more challenging to escape the gravitational pull. Eventually, the gravitational force becomes so strong that the escape velocity exceeds the speed of light, trapping everything within the event horizon, including light.
Therefore, it is considered the point of no return. Question 6 is being the direction to the future because it is the direction away from the singularity inside the black hole, which is the region where the gravitational force is infinite. The direction towards the singularity is the direction to the past.
To know more about event horizon visit :
https://brainly.com/question/13045740
#SPJ11
Which is a function of the central nervous system? Ingenuity
Answer:
It controls all voluntary movement, such as speech and walking, and involuntary movements, such as blinking and breathing. It is also the core of our thoughts, perceptions, and emotions.
Explanation:
None.
Plzzzzzzz helpppppppppp
1st is parasitism; flea
2nd is flower and bee; none
3rd is commensalism; remora
Cellulose is found throughout the cell walls of plant cells. Cellulose makes cell walls rigid, which indicates that cellulose is a carbohydrate. lipid. nucleic acid. protein
Answer:
Carbohydrate
Explanation:
Cellulose is a type of carbohydrate
Answer:
Carbohydrate
Explanation:
What are the political opinions of celia and her daughter lourdes?.
Answer:
Celia and Lourdes have very different opinions about Cuban political
Total protein in the crude extract was then determined using the Lowry assay using a solution of bovine serum albumin (BSA) as a standard. In order to be operating within the linear region of the assay, the original crude extract was diluted 6-fold. 132 µl of this diluted crude extract was found to contain 18 µg of protein.
Calculate the total protein concentration in the original crude extract, in mg.ml-1. Express your answer to one decimal place.
The total protein concentration in the original crude extract is 0.1 mg.ml-1.
To calculate the total protein concentration in the original crude extract, we need to consider the dilution factor and the amount of protein in the diluted crude extract.
Calculate the amount of protein in the original crude extract.
We are given that 132 µl of the diluted crude extract contains 18 µg of protein. Since the crude extract was diluted 6-fold, we can multiply the protein amount by the dilution factor to find the protein content in the original crude extract:
18 µg × 6 = 108 µg
Convert the protein amount to mg.
To express the concentration in mg.ml-1, we need to convert the protein amount from µg to mg. Since 1 mg = 1000 µg, we divide the protein amount by 1000:
108 µg ÷ 1000 = 0.108 mg
Calculate the total protein concentration.
The total protein concentration is calculated by dividing the protein amount by the volume of the original crude extract. The volume is not explicitly given in the question, but since the diluted crude extract was 6-fold, we can assume that the original crude extract had a volume of 132 µl × 6 = 792 µl.
Converting this volume to ml: 792 µl ÷ 1000 = 0.792 ml
Finally, we can calculate the total protein concentration:
0.108 mg ÷ 0.792 ml = 0.136 mg.ml-1
Therefore, the total protein concentration in the original crude extract is 0.1 mg.ml-1.
Learn more about protein concentration
brainly.com/question/31112334
#SPJ11
Dioxin, produced as a by-product of various industrial chemical processes, is suspected of causing cancer and birth defects in animals and humans. It apparently acts by entering cells, binding to proteins, and altering the pattern of gene expression. The proteins affected by dioxin are probably __________.
The proteins affected by dioxin are probably the aryl hydrocarbon receptor (AhR).What are dioxins?Dioxins are a group of chemical compounds that are often formed as by-products of industrial processes
. Dioxins are environmental pollutants that are also formed through natural processes like forest fires, volcanoes, and wildfires. They are persistent and can travel long distances. Dioxins are highly toxic and can cause serious health problems.
Dioxins have been associated with cancer, damage to the immune system, and reproductive and developmental problems, among other things. Explanation:The main answer is the aryl hydrocarbon receptor (AhR) is probably the proteins affected by dioxin.
To know more about proteins visit:
https://brainly.com/question/27862350
#SPJ11
In a chain of consequences after a forest is cleared, what is an immediate, direct impact?
O habitat is destroyed
O the greenhouse effect increases
O species go extinct
O carbon dioxide is sequestered at lower rates
Answer:
I think its the habitat is destroyed