Answer:
Adenosine Triphosphate
Explanation:
What is Mendol’s contribution to genetics?
Answer:
He proved that organisms get their genes inherited from their parents, they come in gene pairs.
why is carbon so important
Answer/Explanation:
Carbon is an acidic element that can dissolve just about anything overtime. It can be used to make your drink fizzy, clean up stains, break down decay, and more.
Carbon is used the most in cleaning supplies and food products because of its high reactivity with air and heat.
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!!
Transcribe the following DNA strand:
AAATACCCCGTAATGGCATAGGTCTGCACT
Answer:
Transcription is the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA). During the process of transcription, each nitrogenous base is connected with it's pair, (Guanine and Cytosine)
(Adenine and Thymine)
However one must remember that RNA contains uracil instead of Thymine. Therefore whenever there is supposed to be a "T" on the MRNA strand, there will be a "U"
AAAGTCGCTCTGAGTTGTTAT 21 Depositors primer
Explanation:
Yesterday i saw thousands and thousands of frog egg in the pond. The frogs _ of their offspring is incredible !
A. biology
B. genetic variation
C. organism
D. population
E. species
F. environment
G. offspring
H. overproduction
i. reproduction
The frogs genetic variation of their offspring is incredible.
Life cycle of frogs:The process begins when adult frogs deposit hundreds of small eggs, known as frogspawn, that collect together in clusters. Early in the spring, as the temperature is just beginning to warm up, this occurs.
Tadpoles won't move around much for the first week or two after hatching since they are still taking nutrition from the yolk of their egg. But once the yolk is completely consumed, the tadpoles are large and robust enough to enter their aquatic environment.
Frogs and toads depend on water significantly less as adults. They can live on land as long as they stay in the shade and don't dry up, but they frequently go back to ponds and lakes for a splash.
To learn more about genetic variation visit:
https://brainly.com/question/848479
#SPJ1
researchers use a technique called rna interference to significantly decrease, but not completely remove, expression of the bcl2 gene in the amygdala of lab animals. what would be the effect of this change?
researchers use a technique called RNA interference to significantly decrease, An increase in apoptosis would be the effect of this change. RNA interference (RNAi) is a preserved physiological response to double-stranded RNA
RNA interference (RNAi) is a preserved physiological response to double-stranded RNA which helps facilitate barrier to both endogenous parasitic and exogenous pathogenic nucleic acids as well as transcriptional regulation of nutrient genome. Increased apoptosis is seen in AIDS, neurodegenerative diseases like Alzheimer's, Parkinson's, and amyotrophic lateral sclerosis, ischaemic injury after a heart attack, stroke, or reperfusion, and autoimmune diseases like hepatitis and graft versus host disease.
learn more about RNA interference here:
https://brainly.com/question/29523032
#SPJ4
Which of the following is false
1. Cells form tissues
2. Tissues for organ systems
3. Organs form organ systems
Answer:
2 is false
Explanation:
tissues don't form organ systems
What makes up a bay?
Bays are formed when the regions where the soft rock is eroded away that is present to the headland.
How is a bay formed simple?The regions where the soft rock is eroded away that is present to the headland is known as bays. The bands of soft rock i.e. sand and clay which erode more quickly than other more resistant rock. This leaves a part of land to stick out into the sea which is known as a headland. When a stretch of coastline is created from different kinds of rock, headlands and bays can be formed. Bands of soft rock i.e. clay and sand are weaker so that's why they can be eroded quickly. This process will leads to the formation of bays. A bay is also defined as inlet of the sea where the land curves inwards. A bay is a water body that is covered by land on three sides while on the other hand, oceans have no land is present on a specific side.
So we can conclude that due to erosion of soft rocks at the headland, bays are formed.
Learn more about bay here: https://brainly.com/question/16109710
#SPJ1
Explain the law's of segregation and independent assortment.
I hope this helps.
Explanation: The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.
Answer:
The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. ... The law of independent assortment states that the allele of one gene separates independently of an allele of another gene. This has has to do with 2 genes.
Explanation:
How did Mendel prevent self- pollination by the pea plants? A. He kept male plants in a separate room. B. He removed the pollen- bearing part of the plant. C. He allowed the plants to self pollinate.
Mendel prevented self-pollination by the pea plants by removing the pollen-bearing part of the plant.
Mendel's ExperimentMendel conducted several plant breeding experiments to study how traits are inherited in living organisms using the pea plant.
In some of the experiments, he needed the plant not to self-fertilize. Thus, he decided to remove the polling-bearing part of such plants.
The pollen-bearing part of a plant is known as the anther. By doing so, the male gamete, which is the pollen, will not be available to fertilize the female gamete of the same plant.
More on Mendel's experiments can be found here: https://brainly.com/question/12993314
#SPJ1
To make ethanol for use in _______, yeast is provided with sugars that have come from crops such as maize.
Answer: To make ethanol for use in BIOETHANOL( a biofuel), yeast is provided with sugars that have come from crops such as maize.
Explanation:
Ethanol Fermentation is defined as the process whereby sugar( fructose, sucrose or glucose) are broken down by the action of microorganism such as yeast to give of ethanol(alcohol) and carbondioxide as by products.
In the use of ethanol as a biofuel, there are different sources where sugar products can be gotten from, but the main sources of sugar required to produce ethanol come from energy crops. These crops are grown specifically for energy use and include corn, maize and wheat crops.
BIOETHANOL is a renewable source of fuel that can be produced through the yeast fermentation of sugar gotten from crops such as maize. Although ethanol can be used in wine and beer production, sugar sources are usually gotten from grape fruits and barley.
6 A student observed an open container filled
with soil, decaying plants, and worms.
Which of the following is most important to the
worms' survival?
A, Carbon dioxide
C. Plastic
B. Oxygen
D. Sunlight
Compare and contrast the processes of mitosis and meiosis
Answer: Mitosis has only one round of cell division, while meiosis has two........ Mitosis produces daughter cells (diploid cells) that are identical to the parent cell, while mitosis produces haploid/monoploid cells that only have half of the normal number of chromosomes.
Explanation: I remember I studied this last year. it was a pain in the butt.
Answer:
Cells divide and reproduce in two ways, mitosis and meiosis. Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells.
rrrrrrrrrrrrrrrrrrrrrrrr
ŕrrrrrrrrrrřrrrrrrrrrrrrrrr
Answer:
okk
Explanation:
What will happen if both the biceps and triceps muscles contract at the same time?
Answer:
the biceps and triceps muscles work together to allow you to bend and straighten your elbow. When you want to bend your elbow, your biceps muscle contracts, and, at the same time, the triceps muscle relaxes.
Explanation:
Veterinary Science!!
Why do you think veterinary science is also important to public health? What factors do you think make veterinary science important to public health and safety?
Answer:
Why do you think veterinary science is also important to public health?
- it also benefits humans in some pretty sizeable ways.
What factors do you think make veterinary science important to public health and safety?
- parasitology, zoonoses, and epidemiology
Hope this helped :)
What is a cluster of bananas called?
A cluster of bananas is called a "hand". The term "hand" is used to refer to a group of bananas that grow together on a stem. A hand typically consists of 10 to 20 individual bananas, which are called "fingers". The term "hand" comes from the way the bananas are arranged on the stem, with the bunch hanging down like the fingers on a hand
Answer:
A bunch or a stalk of bananas.
Explanation:
What are the two main categories of contaminants in water?
Answer:
physical contaminant
chemical contaminant
PLEASE HELP!!!
How do animals and plants interact in terms of the two gases involved in photosynthesis?
Answer:
Explanation:
Photosynthesis use carbon dioxide and water to assemble carbohydrate molecules and release oxygen into the air easy
Pig dissection circulatory system terms and functions
Here are terms and functions of the pig circulatory system:
Arteries: Arteries are blood vessels that carry blood away from the heart.Capillaries: Capillaries are very small blood vessels that allow the exchange of oxygen and nutrients between the blood and the cells.Heart: The heart is a muscular organ that pumps blood throughout the body.Lungs: The lungs are organs that allow the exchange of oxygen and carbon dioxide in the blood.Veins: Veins are blood vessels that carry blood back to the heart.What does the circulatory system do?The circulatory system of a pig is similar to that of a human. It is made up of the heart, blood vessels, and blood. The heart is a muscular organ that pumps blood throughout the body. The blood vessels are tubes that carry blood to and from the heart. The blood is a fluid that contains red blood cells, white blood cells, and platelets.
During a pig dissection, the circulatory system consists of various structures that play essential roles in the transportation of oxygen, nutrients, and waste throughout the body.
Find out more on pig's circulatory system here: https://brainly.com/question/29841899
#SPJ1
Energy transformations result in
a.) a loss of energy
b.) a gain of energy
c.) a loss or gain in energy depending on the situation
d.) no loss or gain in energy
Answer:
c
Explanation:
depends on what you are transforming it into
Ferns, such as the one in the picture, can be found today. They are usually found
growing in warmer climates. However, fossils of ferns have been found in places with
cold climates where it often snows today. What can we conclude about the places
where the fossils of ferns have been found?
A. Ferns used to live in cold climates.
B. These places once had a warmer climate.
C. Someone tried to grow ferns in cold climates.
D. These places once had a colder climate.
Answer:
B. These places once had a warmer climate.
Explanation:
They're fossils meaning they're extremely old therefore the climate they once grew in was suitable for its needs until the climate changed causing them to die.
The amount of food that can be produced in an given area is called
Food production is the quantity of food produced, processed, prepared in an area.
What is Food production area?Food production area refer to a geographical location where food products or their ingredients for human consumption are prepared, processed, repacked, handled or manufactured.
The food produced are localised in that area and can be exported to other place.
The food production area is normally known for a specific food manufactured in that area.
Therefore, Food production is the quantity of food produced in an area
Learn more about food production area here.
https://brainly.com/question/532582
2. Some students used these dialysis tubing bags as models of human red blood cells. The students observed the changes in the bags when they were placed in different solutions and recorded the mass of each setup in the table below. (0 R Dialysis tubing Which statement best describes the role of the cell membrane in this model?
The cell membrane allows the solute to enter the cell which causes the cell to shrink is the statement that best describes the role of the cell membrane in this model.
The semipermeable cell membrane provides for the selective entry and exit of solutes, water, salts, and other substances. The concentration of the solute inside the cell was raised when it entered the cell membrane.
Water began to migrate outside of the cell membrane as the water gradient outside the cell wall diminished, which caused the cell to contract.
Cell membranes act as boundaries and checkpoints. Because of their semi-permeability, some molecules can diffuse across the lipid bilayer but not others. Gases like oxygen and carbon dioxide, as well as small hydrophobic compounds, quickly traverse membranes.
To learn more about Cell membranes visit: https://brainly.com/question/13524386
#SPJ9
A child receives an x chromosome from its mother and a y chromosome from its father.What is true about this child?
they are male due to the XY chromosomes
5. In what way are ferns and mosses alike?
A. They are flower-bearing
B. They are spore-bearing
C. They have vascular bundles
D. They have roots, stems and leaves
Answer:
the is A
Explanation:
Answer:
option B
they are spore bearing
hope it helps
The genotype of a person with blood type O negative is _________ for the ABO allele and __________ for the Rh factor allele.
Answer:
IiIi; Rh-Rh-
Explanation:
what "clot buster" enzyme removes unneeded clots after healing has occurred during fibrinolysis?
"Clot buster" enzyme that removes unneeded clots after healing has occurred during fibrinolysis is called plasmin.
What is the function of plasmin?Blood clot fibrinolysis and the restoration of regular blood flow are the primary physiological functions of plasmin. By converting its zymogen plasminogen by fibrinolytic activators in the presence or absence of fibrin, plasmin is a key fibrinolytic protease.
Clot retraction reduces the size of the clot as healing proceeds, and plasminogen is activated into plasmin that breaks down the fibrin in the clot.
An essential enzyme called plasmin, which is found in blood, breaks down a variety of blood plasma proteins, including fibrin clots. The term "fibrinolysis" refers to the breakdown of fibrin.
To know more about, fibrinolysis refer
https://brainly.com/question/28373670
#SPJ4
help please this is harddd
Answer:
food shortages? i think thats the right one ive never heard of food justice
HELP PLS: NEED ANSWER ASAPPPPPPPPPPPP <3
1. Explain acid deposition. Your explanation should include the following:
• The sources of acid deposition
• The chemical equations involved in acid deposition formation
• An explanation of the types of acid deposition
• A discussion of the effects of acid deposition
• A drawing that shows the sources, formation, and precipitation of acid deposition
Acid deposition, also known as acid rain or acid precipitation, refers to the deposition of acidic substances from the atmosphere onto the Earth's surface. It is primarily caused by emissions of sulfur dioxide (SO2) and nitrogen oxides (NOx) from human activities, particularly the burning of fossil fuels such as coal and oil in power plants, industrial processes, and vehicle emissions.
The chemical equations involved in acid deposition formation are as follows:
1. Formation of sulfuric acid (H2SO4):SO2 (sulfur dioxide) + O2 (oxygen) + H2O (water) → H2SO4 (sulfuric acid)
2. Formation of nitric acid (HNO3):NOx (nitrogen oxides) + OH (hydroxyl radical) → HNO3 (nitric acid)
Acid deposition can occur in two main forms: wet deposition and dry deposition.
1. Wet deposition: This occurs when acidic compounds in the atmosphere combine with water vapor to form acids that are then brought down to the Earth's surface through precipitation, such as rain, snow, sleet, or fog.2. Dry deposition: In this form, acidic compounds settle directly onto the Earth's surface without the involvement of precipitation. These compounds can be in the form of gases, particles, or dust, which are deposited onto plants, buildings, soil, and water bodies.The effects of acid deposition can be significant and wide-ranging:
1. Environmental impact: Acid deposition can acidify soil and bodies of water, leading to detrimental effects on aquatic ecosystems and plant life. It can harm fish, amphibians, and other aquatic organisms, as well as affect the pH levels and nutrient availability in soil, hindering plant growth.2. Damage to infrastructure: Acidic substances in acid deposition can corrode and damage buildings, statues, bridges, and other structures made of materials such as limestone, marble, and metals.3. Human health concerns: Acid deposition does not directly pose a significant health risk to humans. However, the pollutants that contribute to acid deposition, such as sulfur dioxide and nitrogen oxides, can contribute to respiratory problems and aggravate existing respiratory conditions in susceptible individuals.\(\huge{\mathfrak{\colorbox{black}{\textcolor{lime}{I\:hope\:this\:helps\:!\:\:}}}}\)
♥️ \(\large{\underline{\textcolor{red}{\mathcal{SUMIT\:\:ROY\:\:(:\:\:}}}}\)
6.2.2 Why does the control have no leaves?
The control in an experiment with plants has no leaves to provide a baseline for comparison and to eliminate variables that could influence the results.
In an experiment, the control group serves as a reference point to compare the outcomes of other experimental groups.
By having a control with no leaves, researchers can observe the effects of different variables on plant growth or other factors without the influence of leaves.
This helps to ensure that any differences observed in the experimental groups are genuinely due to the variables being tested and not due to random factors related to the presence of leaves.
The control has no leaves to create a valid comparison between different experimental groups and to ensure accurate results by minimizing the influence of external variables.
For more information on control experiments kindly visit to
https://brainly.com/question/23246431
#SPJ11