Where does ocean salt come from?
a. macrofungi
b. sporophere
c. roomology
d. mycology​

Answers

Answer 1

Ocean salt primarily comes from the evaporation of seawater, leaving behind the dissolved minerals and salts. It is not derived from macrofungi, sporophere, roomology, or mycology.

Ocean water contains dissolved salts and minerals, which are primarily derived from various sources such as weathering of rocks on land, volcanic activity, and underwater vents.

When the sun's energy heats the surface of the ocean, it causes the water to evaporate. Evaporation is the process by which water molecules escape into the atmosphere as water vapor.As the water vapor rises, it leaves behind the dissolved salts and minerals, which become concentrated in the remaining seawater.Over time, with continued evaporation, the concentration of salts and minerals in the remaining water increases.Eventually, the remaining water becomes supersaturated with salts, leading to the formation of salt crystals. These crystals can take the form of various salt compounds, such as sodium chloride (common table salt) and others.These salt crystals may precipitate and settle at the bottom of the ocean or accumulate in saltwater bodies, such as salt flats or salt pans.

Therefore, ocean salt is primarily a result of the evaporation of seawater, concentrating and leaving behind dissolved salts and minerals. It is not derived from macrofungi, sporophere, roomology, or mycology.

For more such question on evaporation

https://brainly.com/question/20459590

#SPJ8


Related Questions

What is the scientific method? Answer in 2-4 sentences, including the words below:

Observation

Hypothesis

Data

Conclusion​

Answers

Answer: The scientific method is a series of processes that people can use to gather knowledge about the world around them, improve that knowledge, and attempt to explain why and/or how things occur. This method involves making observations, forming questions, making hypotheses, doing an experiment, analyzing the data, and forming a conclusion.

Explanation:

ANALYZE Why might scientists choose to study the genomes of healthy elderly people
when searching for mutations that lead to a more beneficial phenotype?

Answers

Several genetic mechanisms for defense against age-related disease may be studied in the genomes, according to scientists.

Does behavior depend on phenotype?

The numerous ways in which an individual interacts with some of its environments, whether in its responses to predators, food sources, and habitat, or in its relational or monogamous relationships with conspecifics, appear to be influenced by its behavioral phenotype.

Can the phenotype of two persons be identical?

Yes, it is conceivable for two people to have distinct genotypes and the same phenotype. Each parent contributes one allele to an individual, which may be considered dominant or recessive depending on the trait.

To know more about phenotype visit:

brainly.com/question/29894104

#SPJ1

Explain how plastic can be both beneficial and detrimental at the same time.

Answers

Answer:

Some benefits of plastic are that plastic packaging helps protect and preserve goods, while reducing weight in transportation, which saves fuel, reduces greenhouse gas emissions and are low in cost.

Some disadvantages are that toxic chemicals can leach out of plastic and can be found in the blood and tissue of nearly all of us. Exposure to them is linked to cancers, birth defects, impaired immunity, endocrine disruption and other ailments

It effects animal environments negatively when the waste is not controlled and I don’t think there’s much positive things lol

biogechemical cycles on earth serve on earth serve a variety on different purpose. what do the biogechemical cycles have in common

biogechemical cycles on earth serve on earth serve a variety on different purpose. what do the biogechemical

Answers

Answer:

Son procesos naturales que reciclan elementos en diferentes formas químicas desde el medio ambiente hacia los organismos, y luego a la inversa. Agua, carbón, oxígeno, nitrógeno, fósforo y otros elementos recorren estos ciclos, conectando los componentes vivos y no vivos de la Tierra

Explanation:

Name 3 places in your body where Mitosis might take place

Answers

Answer:

It can take place in many areas. Three being the skin, hair and liver.

Explanation:

Answer:

skin tissues, hair and liver

Explanation:

Most organisms can be divided into two categories - prokaryotes and eukaryotes. What is the main difference between these two categories?
A.
Eukaryotes are found in all of the six major taxonomic kingdoms.

B.
Prokaryotes do not possess a nucleus or any other membrane-bound organelles.

C.
Prokaryotes do not possess any means of locomotion and are thus unable to move.

D.
Eukaryotes are living organisms whereas prokaryotes include some nonliving matter.

Answers

Answer:

B

Explanation:

They don't have an enclosed nucleus.

Yeah it’s definitely b

Choose the correct answer from the two choices you are given.

1. (Parallax, Spectroscopy) is used to determine how far away stars are.
2. Enzymes are (catalysts, organelles) that help cells make energy.
3. Mitochondria, lysosomes, and vacuoles are (organelles, proteins) inside cells.
4. (Ethologists, Anthropologists) are scientists who study animal behavior. ​

Answers

Parallax is used to determine how far away stars are.

Parallax is a measurement technique that astronomers use to determine the distance to nearby stars. It involves observing the apparent shift in the position of a star as the Earth orbits the Sun. By measuring this shift, astronomers can calculate the distance to the star using trigonometry.

Enzymes are catalysts that help cells make energy.

Enzymes are specialized proteins that act as catalysts in biological reactions. They facilitate and accelerate chemical reactions in cells, including those involved in energy production. Enzymes play a vital role in processes such as cellular respiration, where they help break down nutrients and convert them into usable energy molecules like ATP (adenosine triphosphate).

Mitochondria, lysosomes, and vacuoles are organelles inside cells.

Mitochondria, lysosomes, and vacuoles are all examples of organelles found inside cells. Organelles are specialized structures within cells that perform specific functions. Mitochondria are responsible for producing energy through cellular respiration. Lysosomes contain enzymes that break down waste materials and cellular debris. Vacuoles are membrane-bound sacs involved in storing various substances, maintaining cell turgor, and facilitating cellular processes.

Ethologists are scientists who study animal behavior.

Ethologists are scientists who specialize in the study of animal behavior. They observe, analyze, and seek to understand the behavioral patterns, social interactions, and ecological relationships of animals in their natural environments. Ethologists use various research methods, such as field observations and experiments, to investigate animal behavior and gain insights into their evolutionary and ecological significance. Anthropologists, on the other hand, study various aspects of human societies, cultures, and behavior.

To know more about Parallax:

https://brainly.com/question/29210252

#SPJ1

Which of the following is NOT a function of a cell membrane?
a. the cell membrane protects the cell
b. the cell membrane helps molecules move into or out of the cell
c. the cell membrane assists in the synthesis of proteins
d. the cell membrane has identifying marker molecules on it

Answers

Answer:

A. the cell membrane protects the cell

Describe how the process of photosynthesis uses sunlight to produce glucose and how this molecule is broken down in the cell to produce energy / ATP.

Answers

Photosynthesis is the process by which b) glucose is synthesized. In the reactions of photosynthesis, carbon dioxide and water are the reactants. They are converted into glucose (sugar) and oxygen gas, and the reaction is powered by the sun's energy. Chlorophyll is the green pigment that absorbs light energy from the sun, utilizing this energy to drive the reactions in photosynthesis. The glucose that is created serves as food for the plants and for nearly every other living thing. Glucose stores the sun's energy in its chemical bonds and this energy can be accessed later when the glucose is broken apart through cellular respiration.

Select all that apply to El Nino and La Nina Question 1 options: Pacific ocean becomes COLDER El Nino, the mass of air over the ocean brings mild temperatures to US causing a wet winter in the south WARM Pacific produces La Nina, mild winter in the South and colder air in the Northeast. Pacific ocean becomes WARMER El Nino, the mass of air over the ocean brings mild temperatures to US causing a wet winter in the south COOL Pacific produces La Nina, mild winter in the South and colder air in the Northeast.

Answers

Answer:

The question you inputted here is formatted kind of jumbly so I can't really answer this

Explanation:

However, I attached a comparison map that should be able to help you identify the ocean currents. When there are no El Nino/Nina weather, Southeast Asia's coast has a small patch of warm ocean currents residing near it, giving the area a humid weather. Sorry, I know this is not really an answer, but hope this helps.

Select all that apply to El Nino and La Nina Question 1 options: Pacific ocean becomes COLDER El Nino,

Answer:

COOL Pacific produces La Nina, mild winter in the South and colder air in the Northeast.

Pacific ocean becomes WARMER El Nino, the mass of air over the ocean brings mild temperatures to US causing a wet winter in the south

Explanation:

I took the test and got them right...

Select all that apply to El Nino and La Nina Question 1 options: Pacific ocean becomes COLDER El Nino,
Select all that apply to El Nino and La Nina Question 1 options: Pacific ocean becomes COLDER El Nino,

phosphofructokinase-1 is regulated allosterically by: please choose the correct answer from the following choices, and then select the submit answer button. answer choices
a. atp.
b. citrate. c.amp.
d.fructose 2,6-bisphosphate.
e. all of the answers are correct.

Answers

The correct answer is "e. all of the answers are correct." Phosphofructokinase-1 is allosterically regulated by ATP, citrate, AMP, and fructose 2,6-bisphosphate.

Phosphofructokinase-1 is an important enzyme in the glycolysis pathway, which is responsible for the breakdown of glucose to produce energy in the form of ATP. This enzyme is regulated allosterically, meaning that its activity can be modulated by the binding of certain molecules at specific sites on the enzyme that are distinct from the active site.

ATP, citrate, AMP, and fructose 2,6-bisphosphate are all known to bind to different allosteric sites on phosphofructokinase-1 and influence its activity. ATP and citrate are both negative regulators of the enzyme, meaning that they inhibit its activity. AMP, on the other hand, is a positive regulator that activates the enzyme. Fructose 2,6-bisphosphate is also a positive regulator that stimulates the activity of the enzyme.

Know more about glycolysis here: https://brainly.com/question/29604117

#SPJ4

Most articles pass right through the atom, this means that most of the atom is

Answers

Most articles pass right through the atom, this means that most of the atom is an empty space.

What is an atom?

An atom is described as a particle that consists of a nucleus of protons and neutrons surrounded by a cloud of electrons.

Protons and neutrons make up the core nucleus of an atom, which is encircled by an electron cloud. In relation to the size of the atom as a whole, the nucleus is exceedingly small.

As a result, the electrons surrounding the nucleus are the primary target of interactions when particles or even light pass through an atom. The majority of the atom's remaining space, which includes the nucleus, is vacant.

Learn more about atoms at:

https://brainly.com/question/6258301

#SPJ1

I NEED HELP FAST For a science day demonstration, Ms. Morella's class built a model showing how Earth's various spheres interact with one another. Which process could the class use to show interactions among the hydrosphere, the atmosphere, and the biosphere?
Group of answer choices

erosion of soild by flowing water

photosynthesis in a large rain forest

formation of icebergs as glaciers reach the sea

breaking down of rocks by mechanical weathering of tree roots

Answers

The process that the class could use to show interactions among the hydrosphere, the atmosphere, and the biosphere is the photosynthesis in a large rain forest.

What is photosynthesis?

Photosynthesis can be described as the  process  that the  plants do utilize to engage sunlight, water, as well as the  carbon dioxide  so that they can form oxygen as well as  energy .

It should be noted that in this process there will be  interactions among the hydrosphere, the atmosphere, and the biosphere as a result of the sunlight and water that is been used by plant in this process.

Therefore , option B is correct.

Learn more about photosynthesis at:

https://brainly.com/question/19160081

#SPJ1

how much is 300000 *​

Answers

Answer:

300,000

Explanation:

It is 30% of a million and quite a bit of money that can be used to buy a house.

Answer:

300000

Explanation:

lol easyyy

Describe the development of the zygote until implantation occurs.​

Answers

The zygote undergoes a series of cell divisions called cleavage, which results in the formation of a ball of cells called a blastocyst. The blastocyst consists of an inner cell mass that will develop into the embryo, and an outer layer of cells that will form the placenta. The blastocyst travels down the fallopian tube and enters the uterus, where it will eventually implant into the uterine wall. Implantation occurs when the blastocyst attaches to the endometrium, a process that is facilitated by specialized cells in the blastocyst called trophoblasts. Once implanted, the trophoblasts begin to invade the endometrium and form the placenta.

Which of the following would be most likely to cause a mutation?

A.
the addition of nucleotides to the 3’ end of the growing strand

B.
the insertion of a mismatched nucleotide into a DNA strand

C.
the unwinding of the DNA strand

D.
the synthesis of short stretches of DNA

Answers

Answer:

B. the insertion of a mismatched nucleotide into a DNA strand

Explanation:

Biology please help me

Biology please help me

Answers

1) b

2) c

3) d

4) c

5) b

6) a

7) b

8) a

9) a

10)c

Answer:

1. b 2.c 3.d 4.c 5.b 6.a 7.b 8.c 9.a 10.c

Explanation:

not the most certain on 9 and 10 sorrym

Grace is a pregnant woman in an area of Africa that is experienced many years of drought civil unrest and poverty Grace is underweight and has been unable to eat enough nutrients during her pregnancy based on your knowledge of Grace and her living condition which of the following situations is most likely to occur​

Answers

The most likely situation to occur would be: Grace may be at an increased risk of complications during pregnancy and childbirth.

What is the pregnancy?

Given that Grace is thin and has happened unable to eat enough vitamins during her gestation, her overall strength and happiness may be negotiated.

Malnutrition  can bring about a range of adverse belongings on two together the mom and the cultivating fetus.The lack of approach to an enough and equalized diet, combined accompanying the disputing living environments in an area overwhelmed by dryness, civic unrest, and want, can increase the possibility of complexities during pregnancy.

Learn more about pregnancy from

https://brainly.com/question/862356

#SPJ1

Imagine that you live in the near future when fossil fuels are no longer available. Can you suggest other sources of electrical energy? What would be the consequences of using those other (alternative) sources of energy? You can draw your vision of an alternative energy source of electrical energy​

Answers

Answer:

imagining that we live in the future when fossil fuels are no longer

those fuels which are extracted from dead body of animals bones and plants Is called fossil fuel

fossil fuels play important role in this 21st century

Explanation:

consequences of alternative sources is a land use and habitat loss,water use and the use of hazardous materials manufacturing

What role do chromosomes play when a cell makes proteins?
A.
They transport the proteins out of the cell.
B.
They destroy the proteins when they are not functional.
C.
They provide a place for the proteins to be made.
D.
They contain the information to make the proteins.

Answers

A. They transport the proteins out of the cell is the correct answer

Reverse transcriptase is a useful enzyme to have when?

Answers

Answer:

Reverse Transcriptase (RT) is essential for HIV replication because the viral RNA genome on its own is highly susceptible to degradation by intracellular RNases. RT rapidly makes a much more nuclease-resistant double-stranded DNA copy of the RNA template that later integrates to form the proviral DNA.

This molecule is used by retroviruses to create DNA by using mRNA as a template. We know that normally transcription is the synthesis of mRNA from DNA. This can be useful in bioengeneering when using a virus as a vector to alter the genetic material of the host.

which of the following is a function of the central vacuole? a. converting light energy to chemical energy b. storing the genetic information of the cell c. storing compounds produced by the cell d. working with mrna to synthesize proteins e. separating the cell from its surrou

Answers

Storing compounds produced by the cell. The central vacuole is a large organelle found in plant cells that can take up to 80% of the cell's volume. The correct answer is c.

As per the question given,  

It has various functions, but one of its main roles is to store a variety of molecules, such as water, ions, sugars, amino acids, and waste products. The vacuole can also play a role in maintaining turgor pressure, which is the pressure of the cell contents against the cell wall. In addition to storage, the central vacuole can also be involved in the breakdown of macromolecules and the detoxification of harmful compounds.

However, it is not involved in converting light energy to chemical energy (a function of chloroplasts), storing genetic information (a function of the nucleus), working with mRNA to synthesize proteins (a function of ribosomes), or separating the cell from its surroundings (a function of the cell membrane).

For such more questions on Central vacuole

https://brainly.com/question/28660848

#SPJ4

what is imminohistochemistry in breast pathology? what does it take care of?

Answers

Immunohistochemistry (IHC) is a common diagnostic tool used in breast pathology to help determine the type of breast cancer a patient has, as well as the best course of treatment. It is a technique that uses antibodies specific for certain proteins to detect the presence of those proteins in breast cancer cells. In breast pathology, IHC is typically used to examine the expression of hormone receptors (estrogen and progesterone) and human epidermal growth factor receptor 2 (HER2) in breast cancer cells.

By analyzing these markers, doctors can better determine the prognosis and the appropriate course of treatment for the patient. For example, patients whose breast cancer cells express hormone receptors may be candidates for hormone therapy, while those with HER2-positive breast cancer might benefit from targeted therapies such as trastuzumab (Herceptin).

Abigail works for a holistic veterinarian who regularly performs acupuncture on patients. The vet asks Abigail to write up a brief aftercare flyer that could be handed out to the owners of new patients after their first acupuncture treatment . She believes that this might cut down on phone calls and questions that the practice regularly receives from first-time patients Which statement will Abigail MOST likely include on the flyer for acupuncture aftercare ? A. If you notice your pet having difficulty swallowing call immediately . B. Expect to see more bowel movements within the first two days after treatment . C. The dog or cat may exhibit sleepiness for a day or two after treatment . D. Your pet should be bouncing and back to normal by the time you get home .

Answers

Among the given options, the statement that Abigail is most likely to include on the flyer for acupuncture aftercare is C. "The dog or cat may exhibit sleepiness for a day or two after treatment."

Abigail is tasked with creating an aftercare flyer for new patients after their first acupuncture treatment at a holistic veterinary clinic. The purpose of the flyer is to provide helpful information to owners and minimize the need for phone calls and inquiries.

This statement is relevant and important because it informs pet owners about a common post-treatment effect of acupuncture, which is temporary sleepiness in their pets.

By including this information, Abigail can prepare owners for this normal reaction and alleviate any concerns they may have. It helps manage their expectations and ensures that they don't worry unnecessarily if their pet appears sleepy after the treatment.

For more such answers on the veterinary clinic

https://brainly.com/question/14887975

#SPJ8

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

How would you explain the key concepts for the CWA in less than two minutes?

Answers

Answer:

Explanation:

vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.

Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from  a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.

Navigable Waters of the United States  For the purposes of the Clean Water Act, the term "navigable waters" includes:

all waters used in commerce, including groundwater;

all interstate waters including wetlands, mudflats, and sand-flats; and

all other waters such as lakes, rivers, streams, wetlands and sloughs.

EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters."  The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect.  In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.

Additional executive orders were issued 2015 in 2019.  Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.

Could the requirement for one or more NPDES Discharge Permit apply to my campus?

If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.

Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.

Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.

What do I have to do related to NPDES Discharge Permits?

Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.

French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.

Details of NPDES

What happened to us consumption of natural gas

Answers

In recent years, the United States has experienced an increase in its consumption of natural gas.

Factors contributing to this rise include the abundance of domestic natural gas resources, advancements in extraction techniques such as hydraulic fracturing (fracking), and the transition from coal to natural gas in power generation. Natural gas is utilized for a variety of purposes, including residential and commercial heating, electricity generation, industrial processes, and as a feedstock in the petrochemical industry.

The cleaner-burning nature of natural gas compared to coal has also played a role in its increased use as the country aims to reduce greenhouse gas emissions and transition towards cleaner energy sources.

Learn more about gas consumption, here:

https://brainly.com/question/15587617

#SPJ1

what causes the density of ocean water to be different from fresh water?
A: An increase in wind speed
B: A decrease in salinity
C: An increase in temperature
D: An increase in salinity

Answers

D. an increase in salinity

Answer: The answer would be D

Explanation: The salinity would change the density of ocean water due to how the ocean water is heavily diluted with salt

How could you describe the connection between properties of materials, molecular-structure of materials and functions of materials?

Answers

Answer:

The properties of materials related to their molecular structure are important to consider in the design of materials. For example, materials may exhibit properties such as conductivity, flexibility and hardness, based on their molecular structure and atom choice.

Explanation:

i guess

Zandile set up the following apparatus to investigate how temperature affects transpiration rate

Answers

Zandile found that as the temperature increased, the transpiration rate also increased, leading to increased water loss from the plant. This experiment helped her conclude that temperature directly affects transpiration rates.

Transpiration is the process of water movement through the plants from roots to leaves, and eventually lost by evaporation from the stomata. Various factors, including temperature, humidity, light, and wind, influence the transpiration rate.

Temperature affects transpiration as it affects the diffusion rate of water vapor from the leaves into the surrounding air.

To investigate how temperature affects transpiration rate, Zandile set up an apparatus comprising a potted plant, a beaker, and a thermometer. The plant was selected for the experiment, and its leaves were covered with a plastic bag to prevent any water loss through the leaves' surface.

The apparatus was set up in the following way: The plant was placed in a beaker containing water. The beaker was placed on a heat source, and the temperature was monitored with the help of a thermometer. The plastic bag was tied around the stem to ensure no air entered the plastic bag, making the experiment airtight.

Zandile then increased the temperature by placing the beaker on a heat source. She noted the temperature of the water in the beaker and the temperature inside the plastic bag. She continued to monitor the temperature and the rate of water loss from the plant.

For more question on temperature visit:

https://brainly.com/question/28950625

#SPJ8

Other Questions
if the reserve ratio is 10% and excess reserves increase by $1,000, what is the maximum possible increase in checkable deposits throughout the banking system? The girl were sad to lost the game in this sentence tell verb and object two dice are rolled sequentially. what is the probability that the first die shows six and the other die shows an odd number? how to use average bond energies and standard enthalpy of formation to find standard enthalpy of formation what is the height of a parallelogram with base 6 meters and an area of 90 square meters Use the power-reducing formulas to rewrite the expression in terms of first powers of the cosines of multiple angles.5 cos4(x) on digital circuits, we use _________ to reshape the incoming signal and prevent attenuation. Why would a borrower choose an adjustable-rate mortgage ARM instead of a fixed-rate mortgage? Compare and contrast driving in the winter and driving in the summer. someone please help cions: 5 1. Find the solution set for the inequality 2x - 4 8 from the replacement set{2,3,4,5,6,7}{2,3,4,5,6,7}{2,3,4,5,6){7}{6,7} social factors influencing unemployment among youth in south africa Use the distance formula to find The distance between the points (-1 ,3) and (2,6) write you answear as a square root, do not give me the decimal Convert the distance from Kilometers to miles In a competitive market, which of the following would individually result in an increase in equilibrium quantity? Supply increases Demand decreases Both a supply increase and a demand decrease would reduce equilibrium price None of the above Can someone please help me? :( What did both the Germans and Africans have in common How does the design of an ancient Roman building, such as the Pantheon, differ from that of an ancient Greek temple, such as the Parthenon? 53000 divided by ? = 53 Commissions and fees to invest in a limited partnership are directly related to the potential return.True or False?