when shares are sold back to the investment company that sponsors the fund, the fund is blank .

Answers

Answer 1

A closed-end fund is a form of mutual fund that, in order to raise money for its initial investments, issues a predetermined number of shares through a single initial public offering (IPO).

What Is a Closed-End Fund?

A closed-end fund is a form of mutual fund that, in order to raise money for its initial investments, issues a predetermined number of shares through a single initial public offering (IPO). After that, its shares can be purchased and sold on a stock exchange, but no new shares or funds will be generated for the fund.

Open-ended funds, which include the majority of mutual funds and exchange-traded funds (ETFs), accept a continuous stream of fresh investor capital. It both issues new shares and, upon request, buys back its own shares.

Closed-end funds include a lot of municipal bond funds and certain international investment funds.

To know more about Closed-End Fund, refer:

https://brainly.com/question/29381829

#SPJ4


Related Questions

Discuss three typical categories of performance measurement that are commonly used for evaluation in the scorecard.

Answers

Answer:

The four dimensions of performance that are considered in a balanced scorecard are financial, customer, internal process, and learning and growth.A balanced scorecard will include qualitative and quantitative measures.Stakeholders cannot include stockholders.

Explanation:

hope it helpss!!

Suppose you have the opportunity to invest in a project that provides you with $4,000 every year forever. If you require an 8% return on investments with similar risk, what is the most you would be willing to pay for this project?

Answers

To determine the maximum amount you would be willing to pay for the project, we can use the concept of the present value of perpetuity. The present value is the current worth of future cash flows discounted at a specified rate of return. In this case, the perpetuity provides a constant cash flow of $4,000 every year indefinitely.

The formula for the present value of perpetuity is:

Present Value = Cash Flow / Discount Rate

Given that the cash flow is $4,000 and the required return or discount rate is 8% (0.08 as a decimal), we can calculate the present value as follows:

Present Value = $4,000 / 0.08 = $50,000

Therefore, the most you would be willing to pay for this project is $50,000. This amount ensures that the annual cash flow of $4,000 is equivalent to an 8% return on your investment, considering the risk and time value of money.

For more such answers on amount

https://brainly.com/question/14510611

#SPJ8

8. What was the result of John overdrawing his checking account?

Answers

Based on John overdrawing his checking account, John’s payment was greater than the balance he had available in his account so he was charged a $35 fee.

What happens when an account is overdrawn?

From the statement of John's account given, we can see that John made a payment of $710.49 that was more than he had in the account.

As a result, he overdrew his account and took it to a negative balance. He will therefore have to pay an overdraft fee of $35.

Options for this question are:

John’s payment was greater than the balance he had available in his account so the bank will deposit $237.81 into John’s account so he can pay his bills.John’s payment was greater than the balance he had available in his account so he was charged a $35 fee.John’s payment was greater than the balance he had available in his account so he was charged a $5 monthly maintenance fee.John’s payment was greater than the balance he had available in his account so the bank will transfer $35 from a linked account.

Find out more on bank overdrafts at https://brainly.com/question/25532516

#SPJ1

This year Don and his son purchased real estate for an investment. The price of the property was $630,000, and the title named Don and his son as joint tenants with the right of survivorship. Don provided $358,000 of the purchase price and his son provided the remaining $272,000. Has Don made a taxable gift and, if so, in what amount

Answers

Answer:

$28,000

Explanation:

Calculation for Don taxable gift amount

Taxable gift amount=[$358,000 − ($630,000)/2] − $15,000

Taxable gift amount=[$358,000 −$315,000] − $15,000

Taxable gift amount=$43,000-$15,000

Taxable gift amount=$28,000

Therefore Don has made a taxable gift of the amount of $28,000

NEED HELP ASAP! WILL GIVE BRAINLIEST TO CORRECT ANSWER
Opportunity for advancement is which rewards of work factor?

Affiliation
Benefits
Career
Compensation

Answers

Answer: B

Explanation:

Opportunity for advancement is the career of the work factor. An opportunity for promotion in a corporation is the potential to take on a new role. The opportunity for professional development, such as employer-sponsored certifications or continuing education courses, is included in other definitions.

How does advancement influence the meaning of work?

Promotional chances and advancement put workers in a better position to show how well they can do their tasks, which encourages improved job performance. Employee performance depends heavily on the cycle of promotion, inspiration, satisfaction, and feedback.

The possibility of professional advancement is an effective strategy for inspiring and keeping employees. Opportunities for advancement can come in many forms, including job promotions, specialized training for a particular profession, and single assignments with more responsibility.

Learn more about Opportunities for advancement here:

https://brainly.com/question/8651942

#SPJ2

Which of the following file extensions can the browser render with no help from any other software?

Answers

A file with the extension.html may be opened in a browser even if the browser does not have any additional software or extensions installed.

Simply clicking on the file will cause it to open in your browser, at which point it will display the content that is included inside the file.

What is a web browser extension?

Generally, A web browser may have its functionality enhanced via the installation of add-ons known as extensions.

The majority of browsers support a diverse range of extensions, which may include changes to the user interface, cookie management, the banning of advertisements, and the custom scripting and design of web pages.

It is possible for a browser to open a file that ends in.html even if the browser does not have any extra software or extensions installed.

Simply clicking on the file will cause it to open in your browser, at which time it will show the content that is included inside the file. Clicking on the file will cause it to open in your browser.

Read more about web browser extension

https://brainly.com/question/9776568

#SPJ1

it is the process of enabling people to increase control and to improve their health.​

Answers

Answer:

Health Promotion

Explanation:

Health promotion is the process of enabling people to increase control over, and to improve, their health. This is accomplished by building healthy public policies, creating supportive environments, and strengthening community action and personal skills. ...

Hope this helps!

I think health promotion is correct the other person said that too so it’s Health promotion

analyze product, price and cost in relationship in the market

Answers

Answer:

ok

Explanation:

wjeres the picthere is no picyure attached

Please Show Picture:/

Can anyone explain the popularity of the Types of housing in the UK for me?

Answers

Explanation:

Save

There are numerous different types of residential properties to be found throughout the United Kingdom. However, not all may be suitable for your unique requirements. Let’s take the guesswork out of the picture by listing all of the most common variants as well as the bespoke aspects of each. You can then make an informed and educated decision at the appropriate time.

It is currently estimated that there are more than 25 million residential properties throughout the United Kingdom. From detached homes and flats to bungalows and cottages, you have a host of amazing options at your disposal. There is still no doubt that finding the most appropriate structure for your needs can be a bit tricky. Let us examine these and other variants in greater detail. What are the advantages of specific properties? What does each have in store? How will price come into play? These important questions deserve a great deal of attention if you hope to obtain the insight and clarity required to make the best choice possible.

Detached Houses

As the name already suggests, detached houses do not share any walls with a separate structure. They also tend to have both front and back gardens. Associated with a greater degree of privacy when compared to other variants, these units are often ideal solutions for those who have children. The median price for a detached house (at the time that this article was written) is £242,286. If you are curious to know the worth of your property, feel free to use our online house valuation tool at your disposal.

Semi-Detached Houses

As the name suggests, the only major difference between a detached house and a semi-detached property is that semi-detached homes share at least one wall with an existing structure that is separately owned. Not only does this save a great deal of space, but these variants are also noticeably cheaper when compared to fully detached houses. This is why the average 2018 value of these structures was £225,674. The only possible concern is that semi-detached houses do not offer the same level of privacy as their detached alternatives.

Terraced Housing

These are actually some of the most well-known and iconic housing types within the United Kingdom. Terraced houses are connected by a single wall on either side; leading to a literal “row” of structures that occupy a street. The main advantage here is that this type of construction saves a great deal of space. This is why they are quite popular within urban districts where land is at a premium. The prices of these properties are also somewhat lower due to the fact that front or back gardens are sometimes absent from their design (although some may contain small front yards). According to government figures compiled in January 2018, the average price for a terraced home is £194,167.

End-of-Terrace Houses

The only main difference between end-of-terrace houses and the terraced counterparts mentioned previously is that these structures are found at the terminal of a row of homes. In other words, only one wall is shared with an adjacent structure. This is why such houses are often found at the end of a road or on a cul-de-sac. This is also the reason why end-of-terrace homes are priced slightly higher. Some studies have found that these structures cost as much as 18 per cent more than normal terraced homes.

Flats

There is no doubt that flats are by far the most well-known types of homes in the UK. Often being offered as a series within a single building, flats are known for their space-saving qualities as well as their convenience. These structures can either be rented on a contractual basis or purchased (the former is quite common). Flats are ideal for single individuals or those with small families due to the fact that they are often much more affordable when compared to detached or semi-detached houses. In fact, the average rental price of a flat (taking into account both urban and rural locations) is approximately £650. Purchase prices will naturally vary and if you would like to get a better idea of what flats have recently sold for in your area, take a look at our sold house price tool.

Converted Flats

The name for these types of residential properties is actually a bit of a misnomer. Converted flats are often houses that have been split into two sections; a top and bottom half. Either of these can be considered a flat while the other portion is normally where the owner resides. Please note that larger structures can be divided into multiple sections (such as individual bedroom-bathroom combinations) which can be rented separately. Depending upon the property in question, converted flats may or may not offer front and back gardens. The price of these locations fluctuates; depending upon issues such as the age of the property, its overall size and the cost of renting a section out to a customer.

why is brainy a good place if with most the questions if you can simplify the question and get all of them for free

Answers

Answer:

Looll.. well ig some ppl like to wait for their answer then instead of searching or going back through notes.. have a great day :3

Explanation:

Answer: Brainly works better

Explanation:

What is the price of a bond with a par value of $1,000,
11 years to maturity and a 7% coupon rate with semi-
annual coupon payments if the bond has a yield to
maturity of 4%?

Answers

Bonds are priced at $1,264.87.

Is six months a semi-annual?

Something that is paid, reported, published, or otherwise occurs twice a year, often once every six months, is referred to as semiannual.

How is the annual coupon payment determined?

Simply multiply the bond's face value by its annual coupon rate to determine the annual coupon payment for the bond. In other words, if your bond has a $1000 face value and a 10% yearly coupon rate, the annual coupon payment you would get will be $100.

To Know more about  semiannual.

https://brainly.com/question/12353356

#SPJ9

A team of analysts at Amazon is researching the viability of producing a smart watch. How might they estimate potential demand for their smart watch

Answers

Solution :

It is given that an analyst team at Amazon is researching the feasibility and the viability of manufacturing a smart watch.

The analyst team must carry out few steps in order to estimate the potential demand for the smart watch. They should begin with customer survey to know for the demand of the watch. Then the team find the total quantity of the product that is demanded by the customers, the third step is to scale the quantities demanded by the survey respondents. The final step is the team should plot and make the demand curve for the watch in the market.

What change should this candidate make to his profile
to make it more appealing to recruiters?
O He should remove his experience as a cashier
because it is not relevant
O He should delete his interests so employers do not
think he socializes too much,
O He should provide more detailed information about
his most recent job.
O He should describe his interests in greater detail to
appear more fun and personable,

Answers

Answer:

C. He should provide more detailed information about his most recent job.

Explanation:

Answer:

C

Explanation:

Kennedy, Inc. reported the following data: Net income $128,451 Depreciation expense 12,655 Loss on disposal of equipment (8,582) Gain on sale of building 20,190 Increase in accounts receivable 9,009 Decrease in accounts payable (3,174) Prepare the cash flows from operating activities section of the statement of cash flows using the indirect method. Use the minus sign to indicate cash outflows, a decrease in cash, cash payments, or any negative adjustments. Kennedy, Inc. Statement of Cash Flow Cash flows from operating activities: $- Select - Adjustments to reconcile net income to net cash flow from operating activities: - Select - - Select - - Select - Changes in current operating assets and liabilities: - Select - - Select - Net cash flow from operating activitiesomPrepare the cash flows from operating activities section of the statement of cash flows using the indirect method. Refer to the list of Amount Descriptions for the exact wording of the answer choices for text entries. Use the minus sign to indicate cash outflows, cash payments, decreases in cash and for any adjustments, if required.
Statement of Cash Flows (partial)
1 Cash flows from operating activities:
2
3 Adjustments to reconcile net income to net cash flow from operating activities:
4
5
6
7 Changes in current operating assets and liabilities:
8
9
10

Answers

Answer:

god help you

Explanation:

to long question, sumerize it Please

What could be done to make U.S. products more competitive in other nations?

Answers

One thing that could be done to make U.S. products more competitive in other nations is branding them as luxury goods.

How can U.S. goods be more competitive?

The United States has high costs of labor which means that products made in the United States are often more expensive that the goods made in many other parts of the world.

This makes the U.S. goods less competitive with other nation goods. However, if the U.S. were able to package their goods as luxury items, then they would be more competitive because people would still buy those goods at higher prices due to their luxury goods classification.

Find out more on competitive goods at https://brainly.com/question/26514848

#SPJ1

The first effort to apply scientific study to the management of business was when

Answers

Answer:

Explanation:

In 1911, Frederick Winslow Taylor published his work, The Principles of Scientific Management, in which he described how the application of the scientific method to the management of workers greatly could improve productivity.


hope it helps

Which of the following arguments refutes Carr's claim that business strategy is analogousto poker strategy?A.Because good poker playing often involves concealing information and bluffing ordeception, these rules ought to apply to business transactionsB.If an executive refuses to bluff periodically he or she is probably ignoring opportunitiespermitted under the "rules" of businessC.Most games do not legitimize deception, and therefore business should not be analogousto a game that does legitimize deceptionD.Bluffing, exaggeration and concealment are legitimate ways for corporations to maximizetheir self interestE.None of the above arguments refute Carr's claim

Answers

The answer  is option c. Most games do not legitimize deception, and therefore business should not be analogous to a game that does legitimize deception.

What is the most accurate way to define business?

An organization or enterprising entity engaging in commercial, industrial, or professional activity is referred to as a business. Businesses can be for-profit corporations or charitable institutions. Limited liability firms, sole proprietorships, corporations, and partnerships are among the several types of businesses.

What is the definition of a business simple?

An innovative company or group that engages in professional activities is referred to as a business. They could be industrial, commercial, or something else. Businesses that are for profit operate to make a profit, whereas those that are nonprofit do so to further a philanthropic cause.

To know more about Business visit:

https://brainly.com/question/29896340

#SPJ4

I started my career at 30. I want to be able to retire at 58. I do not have any money to put away today, but I can put away $1,000 a month at 5% How much
will I have at retirement?

Answers

After 28 years of consistent monthly contributions at a 5% annual rate of return, your retirement account would have grown to approximately $817,000.

How to solve

Assuming you have 28 years until retirement and can consistently save $1,000 per month at a 5% annual rate of return, you would have approximately $817,000 at retirement.

Here's the breakdown of the calculation:

Monthly contribution: $1,000

Annual rate of return: 5%

Time until retirement: 28 years

Using a compound interest calculator, the future value of your retirement account can be calculated as follows:

Enter $1,000 as the initial amount and $1,000 as the monthly contribution.

Enter 5% as the annual interest rate.

Enter 28 years as the time until retirement.

After 28 years of consistent monthly contributions at a 5% annual rate of return, your retirement account would have grown to approximately $817,000.

It's important to note that this calculation assumes a consistent monthly contribution and a constant rate of return

Read more about retirement pay here:

https://brainly.com/question/7748595

#SPJ1

help it’s due tomarrow
Jot down ideas for a promotional mix for the three scenarios (at the bottom). Create a
quick promotional mix. Include specific and creative tactics needed to promote the
event, company or product. Be sure to include at least one tactic for each element of
the mix:
• advertising
• public relations
• sales promotions
• personal selling
Possible tactics include: Slogans, Billboards, Free Samples, Sponsorships, Commercials,
Contests, Telemarketing, Trade Shows, Sweepstakes, Press Kits, Coupons or Loyalty
Programs. You are NOT limited to this list.
Create a Microsoft® PowerPoint describing your promotional mix and each tactic.
Briefly explain why you selected the elements you choose.
SCENARIOS
• A charity carnival raising funds and supplies for a homeless shelter
• A non-profit children's agency
• Season tickets to a women's college basketball team

Answers

Answer:

hun you're going to have to do this on your own

United States Steel Corporation’s (X) 7.5% bonds due in 2022 were reported as selling for 103.2.

Icon Were the bonds selling at a premium or at a discount? Why is United States Steel able to sell its bonds at this price?

Answers

Answer:

because they are able to create it at a lower price

Explanation:

As a result of the lower market interest rate for bonds of comparable quality, the bonds were being sold for a premium.

What are bonds?

The loan given by an investor to a debtor is represented by a bond, a fixed-income financial instrument. The terms of the loan and the payments are outlined in a bond, which can be compared to an I.O.U. between the lender and borrower.

The amount the bank charges the borrower when making a loan of any kind is referred to as the interest rate. This interest rate-based loan amount must be repaid by the borrower along with the principal sum.

Keeping in mind that investors are prepared to pay more for securities that have lesser potential risk, the bonds are going to sell for more than their nominal value if the market rate of return is lower than the contract rate of interest.

Learn more about Bonds, here:

https://brainly.com/question/14759160

#SPJ2

Which of the following arguments are in favor of active stabilization policy by the government? Check all that apply

Answers

Answer:

D) Shifts in aggregate demand are often the result of waves of pessimism or optimism among consumers and businesses.

Explanation:

The Federal Reserve (FED) can respond to excessive pessimism among consumers and businesses by expanding the money supply and lowering interest rates. To deal with excessive optimism they can do the opposite, they can shrink the money supply and increase the interest rate.

Once you purchase a house. It typically appreciates in value. Appreciation is
A. an increase in value
B. stability in value
C. polite
D. a decrease in value​

Answers

Answer:

A.

Explanation:

Appreciation means that something increases in value therefore it is A.

accounts payable had a normal starting balance of $900. there were debit postings of $100 and credit postings of $450 during the month. the ending balance is: group of answer choices $1,250 credit. $1,450 debit. $1,250 debit. $1,450 credit.

Answers

Total balance after transaction phase of the month is $ 1250 credit.

What is Debit and Credit ?

A documented entry for a made or unpaid payment is referred to as a debit. In a ledger account, a debit entry is often made on the left side. So, with a double entry system, when a transaction happens, one account is debited and another account is credited.

When a business buys goodwill or services to produce a debit, it happens in financial accounting and indicates disparities in the balance sheet of the business. For instance, if Barnes & Noble sold $20,000 worth of books, it would credit its inventory or books account with $20,000 and debit its cash account with $20,000.

A credit is an entry made in the books of an organization that shows a drop in assets or a rise in liabilities as well as a decrease in costs or an increase in income (as opposed to a debit that does the opposite). Therefore, a credit results in higher net income on the income statement of the business, whereas a debit results in lower net income.

Account Balance at start $ 900

Total Debited = $ 100

Total Credited = $ 450

Total balance after transaction phase is = $ (900 - 100 + 450) = $ 1250 credit

To learn more about Accounts refer to :

https://brainly.com/question/28177528

#SPJ4

Human Resources and many other departments at Walmart will use the following as a form of business communication

Answers

Human Resources as well as many other departments at Walmart usually use Accounting as a form of business communication.

Human resources  can be regarded as division of a business which carry out some functions such as;

 finding and screening of employees. recruitment of employees.training job applicants.administering employee-benefit programs.

This department overseas the employees affairs as well as their behavior.

Therefore, they use accounting as means of communication.

Learn more human resources at:https://brainly.com/question/14595106

Calculating Returns and Variability (LO1) You’ve observed the following returns on Regina Computer’s stock over the past five years: 7%, −12%, 11%, 38%, and 14%. a. What was the arithmetic average return on Regina’s stock over this five-year period? b. What was the variance of Regina’s returns over this period? The standard deviation?

Answers

The arithmetic average return that Regina Computer stock saw on its returns over the five years was 11. 6 %

The variance of the returns over the period was 320.3, and the standard deviation was 17.9 %

How to find the arithmetic mean?

The arithmetic mean on returns can be found by summing up all the returns and then dividing this by the number of returns.

The  arithmetic mean to Regina stock in the five year period was therefore:

= (7 % + - 12% + 11 % + 38 % + 14 % ) / 5

= 58 % / 5

= 11. 6 %

Using this mean, the variance can be found on a spreadsheet to be 320.3.

The standard deviation is the square root of variance so the standard deviation of Regina Computer stock in the past 5 years is:

= √ Variance

= √ 320.3

= 17.89

= 17.9 %

Find out more on standard deviation at https://brainly.com/question/475676

#SPJ1

Cecil budgets 1/6 of his weekly salary for comic books. Cecil's weekly comic book bill is $30.00. What is his weekly salary?

Answers

$180

if 1/6=30, then we have to figure out 6/6. 1x6=6 so multiply 30 times 6. 180

5.6 Last month Quick Industries produced 900 units. This month they produced 1,264 units. What is the rate of change in production? a. 29.8% b. 32.8% c. 40.4% d. 60% ​

Answers

Answer: C. 40.4%

Explanation:

To find the rate of change in production, we can use the following formula:

Rate of change = (New value - Old value) / Old value * 100

Where,

Old value = Production of last month = 900

New value = Production of this month = 1264

Substituting the values in the formula,

Rate of change = (1264 - 900) / 900 * 100= 364 / 900 * 100= 0.404 * 100= 40.4%

Therefore, the rate of change in production is 40.4%, which is an option (c). I hope that this answer has helped you!

Answer:

The correct answer is C.

Explanation:

The rate of change in production is: (1264 - 900) / 900 = 0.404 or 40.4%. So, the correct answer is c. 40.4%

finance and financial planning professionals have to work with clients on a (what) basis?
monthly
daily
weekly or
rare​

Answers

Monthly customer interaction is necessary for those in finance and financial planning. As a result, choice (A) is right.

According to common use, a financial planning is a thorough assessment of a person's present financial situation and anticipated future financial status that uses current known variables to forecast future earnings, asset values, and withdrawal schedules.

A budget that organizes a person's finances is frequently included in this, as well as perhaps a list of actions or precise objectives for interaction future spending and saving.

This plan divides up future income into several categories of costs, such rent or utilities, while also setting aside a portion for both short- and long-term savings.

Learn more about financial planning, from :

brainly.com/question/31687151

#SPJ1

Which of the following statements about debt financing is FALSE?
A. Debt financing comes from banks or other commercial
lenders.
B. When a bank gives a company a loan, they become partial
owners of the company.
C. Companies often have to pay interest when they use debt
financing.
D. It's harder for startups to get debt financing.

Answers

Answer:

B

Explanation:

Explain why many countries choose to create trade agreements?

Answers

Answer:

Explanation:

many countries choose to create trade agreements because this allows unlimited

Imports and exports of goods . And the cost of trade is usually low hence it gives countries the opportunity to engage in the act with other countries.but while that may sound like a good thing note that everything hv their advantages and disadvantages

- trade is a really important factor towards development. when countries trade, it lets them get the resources they don't have and build a good relationship with other countries.

Other Questions
Draw a ConclusionChoose an answer.Question: What types ofenvironmental changes does arabbit need to adjust to with thechange of the seasons every year?Changes in temperatureChanges in food supplyChanges in habitatAll of the above What is x =- 5 on a graph? Which statements describe functions of DNA? Select three options.DNA gives instructions on how to make keratin, the protein that makes up human hair and skin.DNA contains information about eye and fur color that is passed on from parents to kittens.DNA provides energy for cheetahs to run fast.DNA helps create substances that fight the bacteria that enter the body.DNA stores energy for a bear as it hibernates during the winter.Which statements describe functions of DNA? Select three options.DNA gives instructions on how to make keratin, the protein that makes up human hair and skin.DNA contains information about eye and fur color that is passed on from parents to kittens.DNA provides energy for cheetahs to run fast.DNA helps create substances that fight the bacteria that enter the body.DNA stores energy for a bear as it hibernates during the winter. Productivity refers to the degree to which an organization can achieve its ends at a low cost. true/ false 1. On July 1, Salvatore, the owner invested $10,500 cash into the company. John Roberts is 51 years old and has been asked to accept early retirement from his company. On July 1, the company offered John three alternative compensation packages to induce John to retire: 1. $180,000 cash payment to be paid immediately. 2. A 16-year annuity of $18,000 beginning immediately. 3. A 10-year annuity of $52,000 beginning on July 1 of the year John reaches age 61 (after 10 years). Required: Determine the present value, assuming that he is able to invest funds at a 7% rate, which alternative should John choose? to assist with searching for a missing child, the operations section chief assigns 4 teams of 3 people each to specific search areas. the operations section chief is applying what ics principle? What are the savanna's two seasons in Africa? A. Cold and hot. B. Hot and humid. C. Humid and wet. D. Dry and wet an else must always be associated with an if, and vice versa.T/F Jason lives in a country in which political power derives solely from the people, where he and fellow citizens elect representatives and a president to enact their views in government. Jason lives in a state best described as which of the following? when the economy is at full employment, what types of unemployment may exist?question 7 options:nonestructural and frictionalseasonal and cyclicalfrictional, cyclical, and structuralcyclical Expand 5.7(26-3.82x) The circumference of Earth is forty million meters long. (This is where the definition of meter originated from.) You have a forty million meter long rope. You tie the rope around the Earth on the equator. On land you avoid all the high mountains. At sea the rope floats, it doesn't sink. The rope is tight, it doesn't have any slack in it. Then you insert ten extra meters of rope. This extra rope is distributed evenly around the Earth. The rope is then raised up evenly by forty million minions at the same time. At sea the minions don't sink, they have boats. How high is the rope above the surface of the Earth You are exploring kidney function in kangaroo rats. You measure urine volume and osmolarity, as well as the amount of chloride Cl and urea in the urine. If the water source provided to the animals were switched from tap water to a 2% NaCl solution, what change in urine osmolarity would you expect? How would you determine if this change was more likely due to a change in the excretion of Cl or urea? Fill in the complementary DNA strand (template strand). Then transcribe \& translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5'TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3 ' 5GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3 Many artists are drawn to painting and drawing images of __________ because looking at earth in its natural and pure form can sometimes feel like you are looking at a painting.A). natureB). citiesC). vehiclesD). still life The openpsychometrics "Which Character" personality quiz is all based on certain character traits that you possess. How does it work? Using the text for reference, list one vitamin and one mineral janie should consume more of to strengthen her immune system. then, list three foods that contain that vitamin and three that contain that mineral. Determine the type of triangle that is drawn below. The school is having a play. They have sold a total of 1000 tickets. Student tickets cost $5 andgeneral admission tickets cost $8. The play made a total of $6461. How many of each studentand general admission tickets were sold?The answer is (513, 487) or 513, 487