when recording or documenting outcome attainment in the chart, nurses are to be very clear with the descriptions used. which term is appropriate?

Answers

Answer 1

"Demonstrated steps". Within 3 days of physical treatment, the client will be able to move securely with a walker inside the room. Results must be precise, quantifiable, doable, reasonable, and time-bound.

What does an outcome assessment look like in practice?

Surveys, interviews, focus groups, document analyses, and student self-reports are a few examples. Program-Level Measures: These are tasks or exams that evaluate students' knowledge and abilities at the program's conclusion rather than being integrated into any individual course.

What are some illustrations of patient results?

Results. Patient functional status (kept or improved), patient safety (protected or uninjured), and patient happiness are characteristics of patient outcomes (patient reporting of comfort and contentment).

Learn more about therapy here:

https://brainly.com/question/12368886

#SPJ4


Related Questions

a patient describes numbness in the arms and hands with a tingling sensation. the patient also frequently stumbles when walking. what vitamin deficiency does the nurse determine may cause some of these symptoms?

Answers

Numbness in the arms and hands with a tingling sensation, often stumble when walking is a symptom of vitamin B12 deficiency.

What is vitamin b12 deficiency?

Vitamin B12 deficiency can lead to nerve damage. The reason is, vitamin B12 plays a role in the metabolism of myelin formation, the fat that coats and protects the peripheral nerves (peripheral neuropathy).

If the body lacks vitamin B12, myelin cannot be produced properly and the nerve system cannot function properly. Disfunction of this nerve can be in the tingling or paresthesias at the feet and hands.

Nerve damage from a lack of vitamin B12 intake can also make the vision blurry or impaired. If damage occurs to the nerve that connects the eye and brain, the nerve signals that travel from the eye to the brain are also disrupted. As a result, the eye's ability to see is reduced.

Learn more about

Vitamin B12 here: https://brainly.com/question/22468338  

#SPJ4

Morbid obesity due to excess calorie intake what is the main term?

Answers

Answer:

Class 3 obesity

Severe obesity and the technical code is E66. 01

The main term for morbid obesity due to excess calorie intake is "obesity."

Obesity is a medical condition characterized by the excessive accumulation of body fat, which can have significant negative effects on a person's health. When obesity is specifically attributed to excess calorie intake, it means that the individual is consuming more calories than their body requires for daily energy expenditure.

Excess calorie intake is a major contributor to weight gain and obesity. When a person consistently consumes more calories than their body needs for daily activities and functions, the excess calories are stored as fat. Over time, this can lead to significant weight gain and an increase in body fat percentage.

To know more about obesity here

https://brainly.com/question/27031973

#SPJ2

Latov N, Vo ML, Chin RL, Carey BT, Langsdorf JA, Feuer NT. Abnormal nutritional factors in patients evaluated at a neuropathy Center. J Clin Neuromuscular Dis 2016; 17: 212-4

Answers

The study emphasizes the importance of maintaining a healthy and balanced diet to support nerve health and prevent neuropathy.

A neuropathy center is a health center that specializes in the diagnosis and treatment of nerve damage. Nutritional factors such as vitamins, minerals, and other essential nutrients are critical to maintaining healthy nerves, muscles, and other body systems. The study aimed to identify which factors are most often present in patients with neuropathy.

The researchers found that many patients with neuropathy had abnormal levels of various vitamins and minerals, such as vitamin B12, vitamin D, and iron. These deficiencies are common in patients with neuropathy and can be caused by various factors such as poor diet, malabsorption, or chronic illnesses.

Overall The article is relevant for patients with neuropathy and healthcare providers who specialize in the diagnosis and treatment of neuropathies.

To know more about Abnormal visit:

https://brainly.com/question/27999898

#SPJ11

Imagine that a patient has damage to the semicircular canals on one side
of the head only. What would you expect to happen. (2choose1)

A.
The patient would lose one member of the pair of opponent angular motion
channels. They would therefore perceive the world as spinning.

B.
Since the damaged vestibular system cannot send any nerve impulses, nothing
would happen. The patient would simply have less good balance because he
lost half of his vestibular input.​​

Answers

Answer: Since the damaged vestibular system cannot send any nerve impulses, nothing would happen. The patient would simply have less good balance because he lost half of his vestibular input.​​

Explanation:

When are vision changes an emergency?.

Answers

Answer:

Sudden blurred vision in one or both eyes

Explanation:


Which of the following best describes the most widely known injury associated with individuals routinely using
computer?

Answers

Answer:

Back Pains.

Explanation:

Seems correct.

Answer:

Wrist Spasm

Explanation:

given that the wrist is in constant contact with the keyboard while typing.

When the duration of a disease becomes short and the incidence is high, the prevalence becomes similar to incidence.True or False

Answers

True, when the duration of a disease becomes short and the incidence is high, the prevalence can become similar to the incidence.

If the duration of a disease is short, and the incidence is high, then the number of new cases during a given period is likely to be similar to the total number of cases present in the population at that time. In this scenario, the prevalence would be similar to the incidence. For example, if a disease has an incidence rate of 100 new cases per month and a duration of one month, then at the end of the month, there would be approximately 100 cases in the population. In this case, the prevalence would be similar to the incidence rate of 100 new cases per month.

However, if the disease has a longer duration, then the prevalence would be higher than the incidence rate, as there would be cases that were present before the given period. Similarly, if the incidence rate is low, then the prevalence would be higher, as the cases would accumulate over time.

Learn more about disease :
https://brainly.com/question/8611708

#SPJ11

which character of the 12 step program distinguishes it from other programs

Answers

Name the characters of the 12 step program

a topical medication used to keep out light is a(n): multiple choice question. keratolytic astringent protective antipruritic

Answers

A topical medication used to keep out light is a protective agent. Protective agents are substances that create a barrier on the skin's surface, shielding it from external factors such as light, moisture, etc.

Among the given options, a protective agent is the most suitable choice for a topical medication used to keep out light. In the context of topical medications, protective agents are often used to provide a physical barrier to the skin, preventing exposure to light or other environmental elements that may interfere with the therapeutic effect of the medication. These protective agents can come in the form of ointments, creams, or films that create a barrier over the affected area.

While the other options listed - keratolytic, astringent, and antipruritic - may have their own specific uses and effects, they do not directly relate to the function of keeping out light. Keratolytic agents are used to promoting the shedding of dead skin cells, astringents are used to tighten tissues or reduce secretions, and antipruritic agents are used to relieve itching. Therefore, the most appropriate choice for a topical medication used to keep out light is a protective agent.

Learn more about topical medication here:

https://brainly.com/question/30712457

#SPJ11

Neck Masses and Vascular Anomalies: What are the imaging characteristics of arteriovenous malformations (MRI versus CTA)?

Answers

Arteriovenous malformations (AVMs) are abnormal connections between arteries and veins that bypass the capillary network, resulting in the direct shunting of blood from high-pressure arteries to low-pressure veins.

The imaging characteristics of AVMs can be evaluated by both MRI and CTA. MRI can provide high-resolution images that help to evaluate the morphology, location, and size of the malformation. MRI can also provide information about the presence of edema, hemorrhage, or other related abnormalities.

On the other hand, CTA provides excellent visualization of the vascular anatomy and allows for the identification of feeding arteries and draining veins.

It is also useful for identifying the presence of associated aneurysms or venous stenosis. Both imaging techniques have their strengths and weaknesses, and the choice of which modality to use depends on the specific clinical question and individual patient characteristics.

Overall, MRI and CTA are valuable tools for evaluating AVMs and providing important information for treatment planning.

To know more about Arteriovenous malformations refer here:

https://brainly.com/question/4336507#

#SPJ11

"Look over there! It's a bear," your friend yells. You quickly turn your head to look.
This movement of attention accompanied by movement of the eyes or body is
known as:

Answers

This sudden movement of attention accompanied by the movement of the eyes or body is known as Saccadic movement.

Which part of the eyes undergoes the movement?

The part of the eyes that undergoes sudden movement is the eye lens. But the superior colliculus gives the command to your eyes when and where to move with respect to the movement of your head and shoulders.

Saccadic movement may be defined as the quick and simultaneous movement of both eyes in the same direction with respect to any external stimuli. It involves two or more phases of fixation immediately after one by one.

Therefore, Saccadic movement is the sudden movement that involves attention accompanied by the movement of the eyes or body with respect to external commands or stimuli.

To learn more about Saccadic movements, refer to the link:

https://brainly.com/question/14886489

#SPJ2

a client who has a medication diagnosis of hyperparathyroidism is complaining of right flank pain. the nurse providing care for this client suspects this client has what complication?

Answers

The client with a medical diagnosis of hyperparathyroidism who is experiencing right flank pain may be suspected of having a complication known as kidney stones (renal calculi).

Hyperparathyroidism is a condition characterized by overactivity of the parathyroid glands, which are responsible for regulating calcium levels in the body. In hyperparathyroidism, excessive production of parathyroid hormone (PTH) leads to increased levels of calcium in the bloodstream. Elevated levels of calcium in the urine can contribute to the formation of kidney stones.

Kidney stones, or renal calculi, are solid deposits that form in the kidneys when substances such as calcium, oxalate, or uric acid accumulate and crystallize. These stones can vary in size and may cause obstruction or blockage within the urinary system, leading to symptoms such as severe flank pain, lower abdominal pain, blood in the urine (hematuria), and urinary urgency or frequency.

The right flank pain reported by the client may be indicative of a kidney stone that has passed or is causing obstruction in the right ureter, the tube connecting the kidney to the bladder. Flank pain is commonly described as a sharp, severe, and colicky pain that radiates from the back towards the lower abdomen and groin.

It's important for the nurse to assess the client's symptoms, obtain a thorough medical history, and collaborate with the healthcare team to confirm the diagnosis and develop an appropriate plan of care. Prompt medical intervention may be necessary to manage the pain, address any potential complications related to kidney stones, and manage the underlying hyperparathyroidism.

Here you can learn more about hyperparathyroidism

https://brainly.com/question/30636742#

#SPJ11  

What is a current personal, educational, or professional goal that you are working towards achieving in your life? Explain.
Describe at least two actions you are taking to reach your current goal.
Reflect on your past accomplishments and describe a personal, educational, or professional goal that you have already achieved in your life. How did accomplishing this goal make you feel?

Answers

Medical personnel often have a variety of personal, educational, and professional goals that they work towards achieving throughout their careers.

What is my present career goals?

As a  medical personnel I work to  advance their knowledge and skills through continued education and training. This may involve pursuing advanced degrees, attending conferences and workshops, or participating in professional development opportunities to stay up-to-date with the latest research and techniques in their field.

Also, I work to improve patient care and outcomes by implementing evidence-based practices, developing effective treatment plans, and communicating clearly with patients and their families. This could involve collaborating with colleagues, attending case conferences, and seeking feedback from patients and other healthcare professionals.

Learn more about career goals:https://brainly.com/question/11286180

#SPJ1

General nutrition recommendations.
Medications/supplements that are commonly used to treat NAFLD (can include necessary vitamins); and which should be avoided.

Answers

General nutrition recommendations for NAFLD include:

- Consuming a healthy diet that is rich in fruits, vegetables, whole grains, and lean proteins.
- Avoiding foods that are high in saturated and trans fats, added sugars, and sodium.
- Limiting alcohol consumption.
- Maintaining a healthy weight through regular exercise and a balanced diet.

Medications/supplements that are commonly used to treat NAFLD include:

- Vitamin E: It may help reduce liver inflammation and damage.
- Pioglitazone: It can help improve insulin resistance and reduce inflammation in the liver.
- Ursodeoxycholic acid: It may help protect liver cells from damage.
- Omega-3 fatty acids: They may help reduce liver fat and inflammation.

It's important to consult with a healthcare provider before taking any medications or supplements to treat NAFLD. Some supplements may interact with other medications or have side effects. Additionally, it's important to avoid supplements that may be harmful to the liver, such as high doses of vitamin A, iron, and niacin.

heart failure is due to either natural occurrences what is the mean number of heart failure patients

Answers

Either natural occurrences (84%) or external influences (16%) are the cause of heart failure. Foreign items or induced compounds are connected to external influences.

What are signs of heart failure?

You often complain about how tired, uneasy, or restless you are just after waking up. Blood "backs up" in the pulmonary veins, major blood vessels that carry blood from the heart to the lungs, since the heart is unable to keep up with the demand. The effect is that fluid enters the lungs.

How long is heart failure a viable condition?

The average life expectancy for those with final heart failure is less than a year. 4. Heart-damaging conditions like diabetes, blood pressure, and heart disease are the main causes of heart failure.

To know more about Heart Failure visit:

https://brainly.com/question/28447404

#SPJ4

You need to prepare 65 ml of 60% soda/syrup ‘prescription’ you use the 80% soda solution and the syrup solution (0% strength) that you have in inventory. How many ml of each solution do you need to create this final solution?

Answers

Answer:

16.25 mL

Explanation:

Since we are mixing from the syrup in the inventory, we can say that the syrup in the inventory must be equal to that in the final solution. Thus, we will use the dilution equation to solve for the Initial volume;

Dilution equation is;

V₁C₁ = V₂C₂

Where;

V₁ is initial volume

C₁ is initial concentration or initial molarity

V₂ is final volume

C₂ is final concentration of final molarity

We are given;

C₁ = 80% = 0.8

C₂ = 60% = 0.6

V₂ = 65 mL

Making V₁ the subject in the dilution equation, we have;

V₁ = (V₂C₂)/C₁

V₁ = (65 × 0.6)/0.8

V₁ = 48.75 mL of inventory syrup

Some organisms in this zone make their own food through chemosynthesis .

Answers

Yes, that is true. I think

how long does it take for dental anesthesia to wear off

Answers

Answer:

Approx. 2-5 hours

Explanation:

A typical dental local anesthetic will last anywhere from two to five hours, depending on how much your dentist applied for the procedure. The local anesthetic effects wear off gradually, with feeling slowly returning to the area in the hours after your procedure

Adam is 19 and plays basketball. Recently, he has been thirsty all the time and he needs to get up several times a night to urinate. He has lost 10 pounds and is so tired that he has been missing basketball practice. What type of diabetes is most likely affecting Adam

Answers

Answer:

Type 1 diabetes.  

Explanation:

Adam most likely has type 1 diabetes since he has symptoms such as thirst, weight loss, frequent urination, and tiredness, which are usually present when the pancreas does not produce insulin, the hormone that decreases glucose levels in the blood and allows it to enter the cells and the liver so that the body can work properly.

In type 2 diabetes, the symptoms may not be present or not be as strong as in type 1 diabetes. Besides, type 2 commonly appears in people who are 40 years old or older, while type 1 can appear at any age.

which effect happens when beta blockers are coadministered with anticholinergics

Answers

Reduced beta blocker effect. Beta blockers may cause problems with the blood supply to your hands and feet, which can cause chilly hands or toes, fatigue, dizziness, or lightheadedness.

Beta blockers may also cause dreams or difficulty falling asleep. Lowering heart rate is the main method that beta blockers work. They achieve this by preventing hormones like adrenaline from having their intended effects.

The most used beta blocker delivery method is tablets. Only a general practitioner or another qualified healthcare professional may prescribe these prescription-only drugs because they are not available over the counter.

The following beta blockers are often used:

atenolol (sometimes referred to as Tenormin) (also called Tenormin), Bisoprolol, sometimes referred to as Cardicor or Emcor (also called Cardicor or Emcor), Carvedilol and labetalol.

The complete question is:

What happens when beta blockers are coadministered with anticholinergics?

1. Reduced beta blocker effect

2. Increased blood glucose levels

3. Enhanced effect of anticholinergics

4. Prolonged neuromuscular blockade

Learn more about adrenaline here:

https://brainly.com/question/30707895

#SPJ4

determine if this conjecture is true. if not, give a counterexample. the difference of two negative numbers is a positive number. luoa

Answers

The conjecture "the difference of two negative numbers is a positive number" is true. This can be proven using the following example:

Let a and b be any two negative numbers. Thus, a < 0 and b < 0. Therefore, a - b < 0 - 0. Simplifying the equation gives a - b < 0 which means that the difference of two negative numbers is negative, not positive

.However, if a = -2 and b = -5, then a - b = -2 - (-5) = -2 + 5 = 3, which is a positive number. Therefore, this particular example serves as a counterexample to the conjecture for the values a = -2 and b = -5.

About Negative

Negative is a trait or state that shows disapproval, dislike, or rejection of something. Negative can also mean something opposite to positive, as in math or physics. Negative can have a bad impact on yourself and others if not balanced with a positive attitude.

Learn More About Negative at https://brainly.com/question/30096822

#SPJ11

What do you call the space
where a chondrocyte sits in?
Select one:
O a. Space of Disse
O b. Space of Mall
O c. Vacuole
O d. Lacuna​

Answers

Answer:

the space where a chondrocyte sits in is Lacuna.

True OR False:
cones sense color and intensity of light, rods only sense color

Answers

cones sense color and intensity or a light, rods and only sense color is true

Select the correct sign(s) and symptom(s) of an anaphylaxis. * Hypotension Respiratory Problems Gastro-intestinal Symptoms Urticaria/Angioedema None of the above

Answers

Answer:

Hypotension, Respiratory Problems, Gastrointestinal Symptoms, and Urticaria/Angioedema.

Explanation:

Anaphylaxis is a severe allergic reaction that can cause death. The main symptoms are congestion, sneezing, and urticaria. Severe anaphylactic shocks, where the person is at risk of dying, present the following symptoms: are respiratory problems such as bronchial constriction, which makes it hard to breathe, gastrointestinal symptoms like bloating, nausea, diarrhea and abdominal pain, and hypotension due to the cardiovascular problems and vascular collapses. In severe cases, the administration of epinephrine is crucial for a person's survival.

Your umbilicus (​bellybutton​) is (​anterior/posterior​) to your tushy.

Answers

the bellybutton is anterior to the butt
The belly button is in posterior to your

select the statement that includes the correct element to use when documenting a problem-based nursing diagnosis.

Answers

Use the problem-etiology-symptom (PES) technique to create a problem-focused diagnostic statement.

The following components are frequently included in a problem-based nursing diagnosis:

the current or potential illness or situation

Related symptoms and signs

Associated elements (aetiology or risk elements)

Defining attributes (based on objective or subjective information)

Outcome standards (objectives or desired results)

Expected time frame for the result.

The process of diagnosing and treating patient health problems in nursing is known as problem-based nursing diagnosis. Identifying the underlying issue or illness entails examining the patient's signs, symptoms, and general health status. Improving patient outcomes and fostering general health and wellbeing are the two main objectives of problem-based nursing diagnosis.

To know about diagnosis

https://brainly.com/question/28427575

#SPJ4

government funding currently covers around _____ of all mental health services.

Answers

Government funding currently covers around  "25%" of all mental health services.

Explanation: Government funding currently covers around 25% of all mental health services. Mental health services refer to the range of support and treatment options that are intended to improve the mental health of an individual or a group. Government funding is the financial support provided by the government to the different sectors of society for their development, progress, and welfare.

Mental health services may include counseling, therapy, medication, hospitalization, rehabilitation, and support groups among others. Mental health problems are common and affect people of all ages, genders, races, and backgrounds. It is important to seek help when experiencing mental health issues to prevent them from getting worse.

To learn more about Government  visit;

https://brainly.com/question/4160287

#SPJ11

What non-visceral effectors that are controlled by the ANS?

Answers

Cardiac muscle, or the heart muscles, is one of the non-visceral effectors regulated by the ANS.

What organs are under the ANS's control?

System of the autonomic nervous: The autonomic nervous system is the portion of the nervous system that supplies the internal organs, such as the sweat, salivary, and digestive glands, blood vessels, stomach, gut, liver, kidneys, bladder, genitals, lungs, and pupils. Skeletal muscle is not an autonomic nervous system effector.

What do the ANS's effectors do?

The SNS uses acetylcholine (ACh), whereas the ANS uses either norepinephrine (NE) or NE. Adipose tissue, cardiac muscle glands, and smooth muscle are the ANS effectors, whereas skeletal muscles are the SNS effectors.

To learn more about ANS visit:

brainly.com/question/30019180

#SPJ4

Which of the following professionals assist patients with improving mobility, strength, and range of motion?

Answers

Answer:

Physical therapist?

Explanation:

They work on rehabilitation, mobility, and strengthining the muscles

How much cation is people

Answers

Answer: 4

Explanation:

iron atoms can form 2+ cations or 3+ cations.

Other Questions
I just want to know how to find a percent change and to round to the nearest percent what is a negative pledge? why is it important to unsecured bondholders? PLEASE HELPQuestion 31 PointThe Southern states had more people than the Northern states to fight in the war.TrueFalseQuestion 41 PointThe North manufactured more than 90% of all the goods in America.TrueFalseQuestion 51 PointOne advantage the South had in the war was better military leaders like Robert E. Lee.TrueFalseQuestion 61 PointSouthern victory in the Civil War meant the United States would follow the path that the South laid down. It would become an industrial rather than agrarian nation, with a national government pre-eminent over those of individual states.TrueFalseQuestion 71 PointWith the Homestead Act, if you were an American Indian, you did not get to have land.TrueFalseQuestion 81 PointThe main strategies of the British was to capture all the cities and force the colonies to surrender such as New York, Boston and Charleston.TrueFalseQuestion 91 PointThe revolution was deeply hypocritical. How could Thomas Jefferson write that all men are created equal when he himself owned slaves.TrueFalse offering a cumulative quantity discount seeks to: a. reduce the seller's shipping costs. b. eliminate some marketing function. c. shift some of the storing function to the buyer. d. encourage the buyer to make additional purchases. e. all of these alternatives are correct If dy/ dx = y, then all line segments comprising the slope field will hae a non-negative slope. true or false Evaluate the expression shown below and write your answer as a fraction in simplest form. Pls Motivation affects a person's O a. size, shape, and weight O b. antecedents, consequences, and reinforcers O c. direction, intensity, and persistence O d. aptitudes, abilities, and competencies a recent health screening revealed a low-density-lipoprotein (ldl) level over 130. which of the following should be prescribed? a. statins b. iron c. insulin d. glucagon Sujet: Votre maman vous a charge de lui acheter des legumes et des fruits mais vous avez perdu largent de commission Cancer can result from a variety of different mutational events. Which of the following is LEAST likely to result in the initiation of a cancerous tumor? A protooncogene is mutated to an oncogene: A mutation In a Growth factor receptor causes the cell to respond to signals from the receptor In the absence of proper ligand. A defect in a cell cycle checkpoint prevents cell from entering the M phase A mutation in the CDK/cyclin complex at the M phase checkpoint allows cell cycle progression to occur without proper kinetochore attachment why do air waves move faster than earthquake waves? Erosion typically wears the Hawaiian volcano Mono Loa down about 20 cm in 5 years. Lava flows build the volcano up about 10 cm every time there is an eruption. Mono Loa erupts about once every 2 years. Is the volcano growing or wearing down? brennan, a, chick, se, davies, r. a taxonomy of model structures for economic evaluation of health technologies. predict the organic product formed when bzcl reacts with water. bzcl = benzoyl chloride. 5. Why is the expression Never... repeated so many times in the final paragraphs of the excerpt? What effect does this have on the reader? Is there a way in which this alludes to prayer? Place the semicolons where needed in the following sentences. Cross out any misplacedsemicolons. If the sentence is correct as written, indicate with a "C." An answer key follows.The first few years the campers consisted of mostly relative therefore mr and mrs caldwell acquired the titles of uncle max and aunt marion An AutoCAD drawing has a scale of 3/4 inches to 2 ft. If a piece of a bridge measures 15 feet, how long is that piece in the AutoCAD printout?11.25 inches5.625 inches22.5 inche51 inchesPlease I really need this for tonight 5'-CGACACCGTTTCCAGCGCTCGAGCCACGCGAAGCTTCAGTCGCTGTGTCTCGAAG3'-GCTGTGGCAAAGGTCGCGAGCTCGGTGCGCTTCGAAGTCAGCGACACAGAGCTTCCGCACTACCACGAAGCGGAGCGCCTCCGCCGTCGCCCGCTTGGCCCCGTCGACAAGCGTGATGGTGCTTCGCCTCGCGGAGGCGGCAGCGGGCGAACCGGGGCAGCTGTTGTACCCCGTGAGGAAGAAGTTCCCTCTGCCGAGCACTATTTAGCAGTCCGAACAG-3'CATGGGGCACTCCTTCTTCAAGGGAGACGGCTCGTGATAAATCGTCAGGCTTGTC-5'1. Underline a 20-nucleotide target DNA sequence in the top (5 to 3) strand of the sequence above. Remember that this sequence should be directly upstream (on the 5 end) of a PAM sequence (5-NGG-3, where N stands for any of the four bases).2. Highlight the PAM sequence that is next to your target DNA sequence. This is where Cas9 will bind. 15. The cost of one yard of fabric is $7.99. What is the cost of 0.51 yd of fabric correct to 2 decimal places? Can somebody please help me I dont know what to do. Thank you