when a plant forms glucose molecules, what is its source of carbon atoms

Answers

Answer 1
Carbon dioxide (CO2)

Related Questions

An
(beginning/ end) of a gene is the most harmful.
(insertion / substitution) mutation at the

Answers

The most dangerous gene mutation is frameshift.

Which mutation is the most harmful?

The DNA sequence is most severely damaged by mutations brought on by the insertion or deletion of nitrogenous bases because they entirely alter the reading frame for the process of protein production. The most harmful mutation is thought to be a frameshift mutation caused by an insertion or deletion.

Which is worse for you, insertion or substitution?

Insertions and deletions typically do more damage than substitutions, which only change one amino acid, since they create a frame-shift that alters the reading of succeeding codons and, consequently, changes the complete set of amino acids that follow the mutation.

To know more about mutation visit:-

https://brainly.com/question/13923224

#SPJ1

Why do we use Punnett Squares today? Explain in your words
how it works?

Answers

Answer:

Punnett squares are used today as a tool to predict the probability of certain traits being expressed in offspring. They are named after the scientist Reginald Punnett, who invented them in the early 20th century. The Punnett square works by organizing the alleles (different forms of a gene) from the parents into a grid. Each parent's alleles are placed along the top and left side of the grid. Then, every combination of alleles is shown in the boxes inside the grid. For example, if one parent has the alleles Aa and the other parent has the alleles aa, the grid would look like this: | a | a --|---|--- A |Aa | Aa --|---|--- a |aa | aa In this case, the offspring have a 50% chance of inheriting the dominant A allele and a

0 / 350

Please help I would greatly appreciate it

Please help I would greatly appreciate it

Answers

Answer:

Ice is less dense than water

Explanation:

Whenever a substance floats on top of another it has to be less dense.

PLEASE HELP! TIME LIMIT! In fruit flies the allele for long wings (L) is dominant and the allele for short wings (l) is recessive. What is the likely genotype of a fruit fly with long wings? Either LL or Ll Either Ll or ll Only LL Only ll

Answers

Answer:

Mate with an Ll. If about 25% offspring are short-winged, it is also Ll. If none, it is LL.

Explanation:

Raekwon wanted to see if listening to music would make the basketball players make more
baskets. On day one, he didn't play any music and counted how many baskets they could
make in 10 minutes. On day 2, he played rap music and counted the baskets, and on day 3,
he played classical music and counted the baskets. IV DV control​

Answers

answer

IV-music

DV-baskets in 10 mins

control-the day no music was played

step by step

IV is the variable being adjusted to achieve variety of results

DV is the counts that will depend on the music played

control with no music only one variable was being tested the counts so a control is where one variable is being tested

Can someone please help me? :(

Can someone please help me? :(

Answers

Answer:

B i think or C

Explanation:

Because in the way I am thinking it's B, "School cooks should be educated on allergies to peanuts." It makes the most sense

Answer:  b

Explanation:

it can't be a since source 2 says "few people recognize..." which contradicts "students know what to do..."

it can't be c because there is no source comparing peanut allergies now vs. past.

it can't be d because you cannot infer this from the given data.

leaving us with b because since a majority of peanut allergies happen at school and not many know how to deal with an event with a peanut allergy, then teaching cooks about peanut allergies will help students in the case of an allergic reaction in school.

hope this helped! ♡

Before genetic engineering, insulin for diabetics was extracted from the pancreases of slaughtered animals. This was good because it gave diabetics the insulin they needed to maintain their blood sugar levels.

Can you think of any disadvantages of this practice?

This is due today and I really need help

Answers

Answer:

There is a chance that the person receiving that insulin will get a bad immune response, and there is a possibility that the animal might have a disease or infectious organisms, that their insulin might contain, and putting it inside a human might transmit that disease.

Explanation:

Explain how drawin theory of evolution has been criticized

Answers

Darwin theory of evolution has been criticized due to its failure to explain origin and transmission of variations.

What is Evolution?

This is defined as the changes in the heritable characteristics of a biological populations over successive generations and is usually a long period of time.

Darwin's theory of evolution states that all species arise as a result of the inherited variations which increases their chances of survival in the ecosystem as a result of the varying environmental conditions from time to time.

However this theory was criticized because there was no emphasis on the origin and transmission of variations thereby making it the correct choice.

Read more about Evolution here https://brainly.com/question/12271572

#SPJ1

LUIZ
4. How are fructose and glucose different?
A One has 6 carbon atoms and the other has 5 carbon atoms.
B One is a monosaccharide and the other is a disaccharide.
C They have a double-bonded oxygen in different locations.
D They each have a unique molecular formula.

Answers

Answer:

anwser is C

Explanation:

they both have 6 carbon atoms so A is wrong

both are monosacchride so B is wrong

both have same molecular formula which is (C₆H₁₂O₆) so D is wrong

in glucose the anomeric carbon is the first carbon, whereas in fructose, the anomeric carbon is the second carbon. The anomeric carbon is the one containing the carbonyl group (carbonyl group is a functional group composed of a carbon atom double-bonded to an oxygen atom: C=O)

Which statement about sustainable development is best described by the model?



Sustainable development must protect the environment, while people’s social and economic needs are less important.

Sustainable development must meet people’s social and economic needs, while protecting the environment is less important.

Sustainable development must either meet people’s social needs, meet economic needs, or protect the environment; all three goals cannot be met at the same time.

Sustainable development must protect the environment, provide for people’s needs, and be economically viable.

Answers

Answer:

Sustainable development must either meet people’s social needs, meet economic needs, or protect the environment; all three goals cannot be met at the same time.

Are frogs and birds OR frogs and horses more closely related?

A.Frogs and birds because they have the most specific taxonomic level in common.

B.Frogs and horses because they have the most specific taxonomic level in common.

C.Frogs and birds because they are both small.

D.They are all in the same taxonomic level, so they are equally related.

Answers

A. frogs and birds because they have the most specific taxonomic level in common

12.
What is the difference between a hypothesis, theory, and a scientific law?

Answers

Answer:

a hypothesis is an educated guess or an assumption made before any of the research has been done.

a theory is a substained explanation for an occurrence.

a scientific law describes what has happened.

Explanation:

Present an overview of RNA-induced gene silencing achieved through RNA interference (RNAi). How do the silencing processes begin, and what major components participate? Select all that apply. a. The RISC complex, guided by single-stranded RNA, can silence gene expression by affecting either mRNA stability or translation. b. The RITS complex, guided by single-stranded RNA, recruits chromatin remodeling proteins that can repress transcription. c. The Dicer complex can cleave both siRNA and miRNA precursors into siRNAs and miRNAs. d. siRNA molecules are derived from single-stranded RNAs that are transcribed from the cell's own genome. e. Short, double-stranded RNA molecules are recognized by either the RISC or RITS complex and the sense strand is degraded.

Answers

RNA-induced gene silencing is a process achieved through RNA interference (RNAi), involving the RISC and RITS complexes, Dicer, and siRNA/miRNA molecules. The process begins with the Dicer complex, which cleaves siRNA and miRNA precursors into siRNAs and miRNAs (c). All the given options are correct.

These short, double-stranded RNA molecules are recognized by either the RISC or RITS complex, with the sense strand being degraded (e). The RISC complex, guided by single-stranded RNA, silences gene expression by affecting mRNA stability or translation (a).

Conversely, the RITS complex, also guided by single-stranded RNA, recruits chromatin-remodeling proteins to repress transcription (b). Notably, siRNA molecules are derived from single-stranded RNAs transcribed from the cell's own genome (d). Overall, RNAi is a crucial cellular mechanism regulating gene expression through mRNA degradation, translation repression, and chromatin remodeling. Hence, the correct options that are applicable are a,b,c,d, and e.

You can learn more about RNA at: brainly.com/question/25979866

#SPJ11

What is an enzyme and what does it do for your body? Describe the word catalase in your answer

Answers

Answer: Catalase is a common enzyme, found in nearly all living organisms. It catalyses hydrogen peroxide into water and oxygen and protects organisms from free radicals It also has industrial uses to prevent certain contaminants in food and as a disinfectant for contact lenses and a cleansing agent in some other products.

Explanation:

This wasn't helpful im sorry

Which of the following statements describes the structure of the plasma membrane?
a It is a lipid bilayer with the hydrophobic area pointing inward, and the hydrophilic area facing outward.
b Protein molecules make up the membrane, which makes it a strong structure.
c The plasma membrane is made mainly from carbohydrates that give the cell energy.
d It is made primarily of cholesterol that allows the cells to communicate with others.

Answers

Answer:

A. It is a lipid bilayer with the hydrophobic area pointing inward, and the hydrophilic area facing outward.

Explanation:

The plasma membrane (also known as the cell membrane) is a membrane that separates the cell's interior from the environment that surrounds it, protecting it. It consists of lipids, proteins, and carbohydrates.

Its main component are phospholipids that create a bilayer. Phospholipids consist of two hydrophobic tails and a hydrophilic head and are arranged so that the tails face inward and the heads outwards.  

This is why option A is the correct one.

You can see an image of the cell membrane's structure to help you visualize this below:

Which of the following statements describes the structure of the plasma membrane?a It is a lipid bilayer

Which of the following best describes a suspension?

Answers

Answer:

where is the following??????

Answer:

Can you write down the options? It will be easier....

1. A parent bacterial cell is able to survive in the presence of the antibiotic penicillin. Subsequent generations from this parent will be _______ penicillin.
A. Killed by

B. Vulnerable to

C. Resistant to

D. Dependent on


please help

Answers

A parent bacterial cell is able to survive in the presence of the antibiotic penicillin. Subsequent generations from this parent will be Resistant to  penicillin.Hence, the correct option is C.

The parent bacterial cell is able to survive in the presence of the antibiotic penicillin, which suggests that it has some form of resistance to the antibiotic.

This resistance can be due to genetic mutations or the acquisition of antibiotic resistance genes. As subsequent generations of bacteria inherit the genetic material from their parent, they will also possess the resistance to penicillin. Therefore, subsequent generations from this parent will be resistant to penicillin.

Hence, the correct option is C.

To know more about penicillin here

https://brainly.com/question/28941005

#SPJ4

37) Reactions involving isomerases are
A) anabolic.
B) catabolic.
C) both anabolic and catabolic.
D) neither anabolic nor catabolic.
E) exergonic.

Answers

Isomerases are enzymes that catalyze the conversion of one isomer to another. Isomers are molecules that have the same molecular formula but different structural arrangements. Therefore, isomerases play a vital role in various biochemical pathways.

Now, coming to the question, whether reactions involving isomerases are anabolic, catabolic, or both, it depends on the specific pathway and the substrate involved. Anabolic reactions involve the synthesis of complex molecules from simpler ones, while catabolic reactions involve the breakdown of complex molecules into simpler ones. Isomerases can participate in both anabolic and catabolic pathways. For instance, isomerases play a crucial role in glycolysis, a catabolic pathway, where they catalyze the conversion of glucose-6-phosphate to fructose-6-phosphate. Similarly, isomerases are involved in the anabolic pathway of nucleotide synthesis, where they convert ribose-5-phosphate to ribulose-5-phosphate. Therefore, the correct answer to the question is option C, "both anabolic and catabolic." Isomerases can participate in both types of reactions depending on the pathway and substrate. In summary, isomerases are essential enzymes that catalyze the conversion of one isomer to another, and they can participate in both anabolic and catabolic pathways, depending on the specific pathway and substrate involved.

Learn more about Isomerases here

https://brainly.com/question/20038368

#SPJ11

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

PLEASE I NEED HELP!!!

Compare and contrast renewable and nonrenewable resources, the explain how some renewable resources can be considered nonrenewable resources. Use details to support your answer.

Answers

Answer:

Nonrenewable energy resources, like coal, nuclear, oil, and natural gas, are available in limited supplies. This is usually due to the long time it takes for them to be replenished. Renewable resources are replenished naturally and over relatively short periods of time.

Explanation:

a bunch of amino acids attached together is called?

Answers

Answer:

protein

Explanation:

at what age does an infant typically first exhibit separation anxiety?

Answers

Separation anxiety is a developmental stage experienced by many infants and young children. Separation anxiety can begin around six months and usually peaks around 18 months, and then declines with age. Separation anxiety in infants is when the baby is distressed when separated from his/her primary caregiver.

The baby might scream, cry, or cling to the parent when they try to leave the room. It can begin around six months of age and typically peaks around 18 months, and then declines with age. Separation anxiety is a typical part of infant development and is generally considered a normal stage of development. Infants at this age may feel fear and panic when separated from their primary caregivers.

They may cry, become fussy, or refuse to eat or sleep. Separation anxiety is a normal part of development, and it typically fades away with age. Separation anxiety is a normal part of development, and it usually starts around six months of age and peaks at 18 months. It's perfectly typical and is a signal that the child is developing healthy bonds with their primary caregivers.

To know more about Separation visit:

https://brainly.com/question/8064228

#SPJ11

Small molecules are combined to form large molecules by the life function of
1
regulation
2.
excretion
3.
transport
4
synthesis

Answers

Answer:

4k synthesis

Explanation:

We have that for the Question "Small molecules are combined to form large molecules by the life function of" it can be said that

Small molecules are combined to form large molecules by the life function of Synthesis

From the question we are told

Small molecules are combined to form large molecules by the life function of

1  regulation

2. excretion

3. transport

4  synthesis

Generally

Regulation

This Speaks to the control of a system

Excretion

This speaks to the removal from a system

Transport

This speaks to movements in and around a system

Synthesis

Where synthesis defines as getting together to form a system

Therefore

Small molecules are combined to form large molecules by the life function of Synthesis

For more information on this visit

https://brainly.com/question/23379286

What would a fish with a bullet shape would be best adapted for?

Answers

Answer:

swimming fast

Explanation:

swimming fast because the only use for a bullet shaped fish.

How would these cells appear under a microscope at a higher magnification? What
parts of the cells would be visible?

Answers

This transmission electron micrograph clearly shows the cell wall, nucleus, vacuoles, mitochondria, endoplasmic reticulum, Golgi apparatus, and ribosomes.

How do you magnify cells to view them more clearly?

Once you can see the cells, carefully turn the coarse focus slider. Once the cells are in focus and are clearly visible, carefully turn the fine focus knob. To see the cells in greater detail, repeat steps 1 through 5 with the higher power magnification.

So, to study cells, scientists utilize microscopes. Compared to light, electron microscopes offer greater magnification, more resolution, and more detail.

What cell components may be seen under a microscope?

Under a light microscope, the nucleus, cytoplasm, cell membrane, chloroplasts, and cell wall can all be seen as organelles. Although mitochondria can still be seen under a light microscope, extensive investigation is not possible.

To know more about magnification visit:-

https://brainly.com/question/21370207

#SPJ13

Which is a terrestrial plant
A.lotus
B.seaweeds
C.sunflower
D.water lily





Explanation : I don’t no what is terrestrial plant pls help me

Answers

Answer:

C.sunflower

Hope this helped!

Answer:

Option C Sunflower is the answer

Explanation:

TERRESTRIAL: Terrestrial refers to things related to land or the planet Earth.

Label the producers, primary consumers, and secondary consumers in this ecosystem.

Answers

Answer:

The producers would be the plants, or any organisms that earn energy directly from the sun. The primary consumers get their energy from eating producers. The secondary consumers get their energy by eating the primary consumers.

Explanation:

Answer:

Producers: The organism that produces a product.

Primary consumers: The first organism that gets the product.

Secondary consumers: The second organism that gets the product.

When a person is anxious or fearful, the autonomic nervous system shunts blood away from peripheral veins to the core of the body.
Select the one best answer

True

False

Answers

When a person is anxious or fearful, the autonomic nervous system shunts blood away from peripheral veins to the core of the body - TRUE

Sympathetic stimulation of blood vessels causes arteries and arterioles (resistance vessels) to constrict, increasing vascular resistance and reducing distal blood flow. The increased vascular resistance that results from this across the body raises arterial pressure. When our bodies shift into superman mode, the second signal is transmitted to the hypothalamus, where it activates our autonomic nerve system, which is in charge of the fight-or-flight impulse. Our bodies receive an adrenaline boost as well as an increase in heart rate and blood pressure. When you are afraid, you get that rush.

learn more about autonomic nervous system here: https://brainly.com/question/4143211

#SPJ1

A map of the world is shown.

Click on the areas most likely to experience hurricanes, typhoons, or tropical cyclones.

Select THREE areas by clicking on the map. Selected answers appear shaded.

A map of the world is shown.Click on the areas most likely to experience hurricanes, typhoons, or tropical

Answers

Tropical storms usually have diameters of between 100 and 2,000 km (62 and 1,243 mi). Tropical storms hit a number of places around the world every year, including the Gulf Coast of North America, Australia, India, and Bangladesh.

What is a tropical cyclone?

An powerful circular storm with a tropical genesis develops over warm tropical seas. Typhoon or a storm are other names for it. Low air pressure, a lot of rain, and gusts that are faster than 119 km/h (74 mph) define it.

Every year, tropical storms form in the late summer, from July to September in the Northern Hemisphere and from January to March in the Southern. Tropical Depression, Tropical Cyclone, Typhoon, and Super Typhoon are the different categories.

Learn more about tropical cyclone

https://brainly.com/question/23936834

#SPJ1

Which of the following statements correctly describes a kingdom of classification?

A.Both Protista and Fungi have single-celled members.

B.Only the kingdom fungi have members that reproduce asexually.

C.Only the members of the kingdom Animalia have membrane-bound organelles.

D.All kingdoms contain members that store energy produced from photosynthesis.

Answers

Answer: A. Both protista and fungi have single celled members.

Explanation:

Other Questions
What is our planet called? Paragraphs 26-29 answer to Lee sherman and the toxic Louisiana bayou TRUE/FALSE the goal of this lab is for you to discover some of the properties of ionic compounds. the physical properties of a substance such as flame color,. Which of the following qualifications should be examined when selecting an expert witness? when one decision is made, the next best alternative not selected is called a comparative advantage. b economic resources. c scarcity. d production. e opportunity cost. i.box-1-100w-1/2hrs find the kwh mellisa keeps rabbits. 2 out of every 3 of her rabbits are gingers. the rest are black . mlissa has 6 ginger rabbits . how many black rabbits does she have chemical compounds secreted by mammals and insects to communicate sexual readiness are called The monthly cost, in y dollars, to download x movies is a linear function. The cost of Nate's service in described by y= 4x + 6. The table shows the cost of Elizabeth's service. Movies, x2468Cost (4), y102030401. Write an equation to represent the monthly cost of Elizabeth's service. 2. Which movie service is cheaper for 8 movies in one month? Explain how you know. 3. Which movie service has the cheaper cost per movie? Explain how you know. 4. Which movie service has a one time fee and what is the fee? Explain how you know a waiter earned $300 in tips during his shift on friday. on saturday, he earned $335 in tips. what is the percent increase of his tips from friday to saturday? Dean is taking a personal assessment and notices that many of his interests involve the reading and creation of language arts and poetry. What career cluster will the assessment most likely indicate to be fitting for Dean? O Technology O Art and Performance O Legal O Public Service Write an exponential decay function to model the situation. Compare the average rates of change over the given intervals.initial value: 42decay factor: 0.71 Consider a computer system in which computer games can be played by students only between 10 P.M. and 6 A.M., by faculty members between 5 P.M. and 8 A.M., and by the computer center staff at all times. Suggest a scheme for implementing this policy efficiently. Multiple Choice Identify the choice that best completes the statement or answers the question Solve the equation using the Zero-Product Property 1. Complete the following sentence:You can verify the zeros olyhe function y = x^2+ - 7 by using a graph and finding where the graph___a. is at a minimum b. is at a maximum c. crosses the x-axis d. crosses the y-axis Nana plants 3 red roses bushes for every 4 yellow rose bushes in her garden. If she plants 12 red rose bushes, how many yellow will she plant? Number only When a software program is purchased, the buyer is acquiring a(n) ____ that permits him or her to use the software. a nurse is teaching a client about insulin infusion pump use. what intervention should the nurse include to prevent infection at the injection site? The monster, in terror, had fled the premises for ever! I should behold it no more! My happiness was supreme! The guilt of my dark deed disturbed me but little.What theme is illustrated in the passage from "The Black Cat"?solace found in naturemoral responsibilityfreedom from fearescaping reality John weights 65.7 kg. If he reduces his weight in the ratio 5 : 4, find his reduced weight. A car dealership sold 174 cars in three months at what rate did a dealership sell cars in cars per month