What’s the measure for angle C?

Whats The Measure For Angle C?

Answers

Answer 1

Answer:

  152°

Step-by-step explanation:

Angles B and A of the isosceles triangle have the same measures, so we have ...

  ∠B = ∠A

  (x -14)° = (x/2)°

  2x -28 = x . . . . . . divide by °, multiply by 2

  x = 28 . . . . . . . . . .add 28-x to both sides

Then the base angles, A and B, both have measure (x/2)° = 14°.

The third angle, C, will bring the total to 180°.

  ∠A + ∠B + ∠C = 180°

  ∠C = 180° - 2(14°)

  ∠C = 152°


Related Questions

you can continue to tranform 12=5x-3 into simpler form by adding 3 to both sides to get 15=5x when x =3 do youu get true statement

Answers

Answer:

yes

Step-by-step explanation:

12+3=5x-3+3

15=5x

15=5(3)

15=15

Tutorial Exercise Find all the points at which the direction of fastest change of the function f(x, y) = x2 + y2 _ 8x 16y is i +j_ Step The direction in which the maximum rate of change of f(x, y) occurs at a point (a, b) is given by the vector Vfla, b) For flx,y) = x2 + y2 _ 8x - 16y, we have Vf(x, y) 2x 8)i + (2y - 16)jl (2x 8. 2y 16) Step 2 We need to find all points (x, Y) for which (2x 8)i + (2y 16)j is parallel to +j. So we must solve (2x 8)i + (2y 16)j k[i + j]- This means that k = 2x 8 and k = 2y 16. Equating these gives uS Submit

Answers

There are no points at which the function has its direction of fastest change along the vector i + j. This is because the equations lead to a contradiction.

The exercise asks to find all the points at which the function f(x, y) = x^2 + y^2 - 8x - 16y has its direction of fastest change along the vector i + j.

To find the points, we need to solve the equation:

(2x - 8)i + (2y - 16)j = k(i + j)

where k is a constant. Since the direction of fastest change is along the vector i + j, we know that the left-hand side of the equation represents the gradient vector of f(x, y).

Equating the x and y components of the gradient vector to the corresponding components of the vector i + j, we get:

2x - 8 = k

2y - 16 = k

Equating these two expressions for k, we get:

2x - 8 = 2y - 16

Solving for y in terms of x, we get:

y = x - 4

Substituting this expression for y into the equation of the gradient vector, we get:

2x - 8 = k

2(x - 4) - 16 = k

Simplifying, we get:

2x - 8 = k

2x - 24 = k

Substituting the first equation into the second, we get:

2x - 24 = 2x -

Simplifying, we get:

16 = 0

This is a contradiction, which means there are no points at which the function has its direction of fastest change along the vector i + j.

To know more about fastest change of the function:

https://brainly.com/question/17055351

#SPJ4

please assist me with this math problem​

please assist me with this math problem

Answers

Answer:  see below

Step-by-step explanation:

I'm not sure exactly what you are asking for but here is what the box plot tells you:

Minimum is 17 items.

Q1 (Lower Quartile) is 22 items. So, 25% of the customers bought 22 items.

Q2 (Median) is 32 items. So, 50% of the customers bought 32 items.

Q3 (Upper Quartile) is 35 items, So, 75% of the customers bought 35 items.

Maximum is 62 items.

The data is "heavier" on the right so it is skewed left.

Range is 62 - 17 = 45

IQR (Interquartile range) is Q3 - Q1 = 35 - 22 = 13

Find the slope of the line passing through the two points: (1, -2) and (-3, -7)

Answers

Answer:

5/4

Step-by-step explanation:

Answer:

slope = 1.25

Step-by-step explanation:

use the formula

m=rise/run or m=\(y_{2} - y_{1} / x_{2} - x_{1}\)

-7-(-2)/(-3)-1

= 5/4 (or 1.25)

hope this helps :)

What is 219in in feet

Answers

18 ft 3 inches or 18.3 ft
18.3 or 18 feet and three inches

I need help please!
What did Nixon's visit to China prove to the US?
A. If you can deal with one communist nation, others will likely join in
B. The Soviet Union was close to falling apart and communism would leave Eastern Europe
C. Most communist nations actually practice capitalism and have free elections
D. The communist world was not a single entity, and had many different positions

Answers

Nixon's visit to China was intended to advance their relationship and create new trade opportunities.

Why was Nixon's visit to China?

The President stated on live television that he would visit the PRC in 1972 on July 15, 1971. The American public was able to see photos of mainland China for the first time in more than 20 years during the week-long tour, which took place from February 21 to 28, 1972.

Nixon intended to protect the global populace, which meant he wanted to improve relations amongst the world's superpowers. Nixon's visit to China was intended to advance their relationship and create new trade opportunities.

A significant step in normalizing diplomatic ties with China, Nixon's visit was a big success. The following year, American tourists began to travel there, and American business organizations established a booming trade with China. The United States and China achieved complete diplomatic ties by the year 1979.

Therefore, the correct answer is option B. The Soviet Union was close to falling apart and communism would leave Eastern Europe.

To learn more about Nixon's visit refer to:

https://brainly.com/question/2951685

#SPJ1

let f(x)= 1/x+(1/y-2)+7 what i the domain of difinition of f(x)

Answers

Step-by-step explanation:

(x)=1/x+(1/y-2)+7

(x-1/x)=1/2y+7

3x/2=8/2Y

3x×8=2×2y

24x:4y

NEED ASAP BEFORE MARCH 11

NEED ASAP BEFORE MARCH 11

Answers

C. is the answer......

Write .0043 as a percentage

Answers

Answer:

0.43%

Step-by-step explanation:

In order to change a decimal to a percentage, you multiply it by 100. You can also move the decimal point to the right two times. By doing so, you get 0.43%. Someone tell me if I did it wrong please.

Use the law of sines to prove that the sides..............

Use the law of sines to prove that the sides..............

Answers

Given the triangle:

We could use the law of sines to prove that sides b and c have the same length.

Use the law of sines to prove that the sides..............
Use the law of sines to prove that the sides..............

The fence around a circular pool is 75 ft long.
Radius=
Diameter=
Circumference=

Answers

Answer:

Step-by-step explanation:

circumference=75 ft.

2πr=75

r=75/2π=75/(2×3.14)≈11.937

radius=11.94 ft

Diameter=2r=2×11≈23.87 ft

The photo is kinda blurry but please help me with it

The photo is kinda blurry but please help me with it

Answers

The perimeter of rectangle M'N'O'P' is given as follows:

54 cm.

What is a dilation?

A dilation can be defined as a transformation that multiplies the distance between every point in an object and a fixed point, called the center of dilation, by a constant factor called the scale factor.

The ratio between the areas is given as follows:

126/14 = 9.

The area is measure in square units, while the perimeter is measured in units, hence the ratio of the perimeters is the square root of the ratio of the areas, that is:

3.

Hence the perimeter of rectangle M'N'O'P' is given as follows:

3 x 18 = 54 cm.

Missing Information

The complete problem is:

Rectangle MNOP has a perimeter of 18 cm and an area of 14 cm2. After rectangle MNOP is dilated, rectangle M'N'O'P' has an area of 126 cm2. What is the perimeter of rectangle M'N'O'P'?

More can be learned about dilation at brainly.com/question/3457976

#SPJ1

The perimeter and area of a rectangle are 22 cm
and 30 cm² respectively. Find the length and
breadth of the rectangle

Answers

The perimeter and area of a rectangle are (5,6) and (6,5).

The perimeter method for a rectangle states that P = (L + W) × 2, where P represents perimeter, L represents length, and W represents width. when you are given the size of a square form, you may simply plug within the values of L and W into the formula that allows you to clear up for the fringe.

A perimeter is a closed course that encompasses, surrounds, or outlines either a two-dimensional shape or a one-dimensional period. The perimeter of a circle or an ellipse is known as its circumference. Calculating the perimeter has several practical programs.

The perimeter P of a rectangle is given by means of the method, P=2l+2w, in which l is the period and w is the width of the rectangle. The place A of a rectangle is given with the aid of the components, A=lw, wherein l is the length and w is the width.

The perimeter of the rectangle:

P=2l+2w=22

divide 2 into both sides

l+w=11 -------------> (1)

w=11-l

Area of the rectangle:

l*w=30

l(11-l)=30

11l-l^2-30=0

l^2-11l+30=0

By factor method,

(l-5)(l-6)=0

l=5,6.

Substitute this value in w,

l=5 implies w=6

l=6 implies w=5

There we have two solutions.

The length and breadth of the rectangle is

(5,6) and (6,5).

Learn more about perimeter here https://brainly.com/question/397857

#SPJ9

Please answer this before friday

Please answer this before friday

Answers

Answer: 21:9 and 42:18

Step-by-step explanation:

14:6 at its most basic form is 7:3, so find anything that could be equal to this if a number is multiplied on both sides.

21:9 is our simplified ratio multiplied by 3 on both sides.

42:18 is our simplified ratio multiplied by 6 on both sides.

But, the final ratio doesn't work, because 7 and 3 respectively cannot multiply to 13 and 8 with the same value.

7. A cylindrical tank can hold 2279.64 cubic feet of water. The radius of the tank is 11 feet. What is the height of the tank?

Answers

Answer:

r = 8.12

Step-by-step explanation:

The volume for a cylinder is V=πr^2h therefore,

v = 2279.64

h = 11ft

r = ?

2279.64 = πr^2 * 11

\(\frac{2279.64}{11}= {\pi r^2} \\\)

207.24 = πr^2

\(\frac{207.24}{\pi} =r^2\\\\66 = r^2\\\\\sqrt{66} = r\\\\\\8.12 = r\)

Please help?!! Hurry please!!

Please help?!! Hurry please!!

Answers

Answer:

C. \( \frac{ {m}^{2} - m - 2}{ {m}^{2} - 1} \)

Explanation:

\( \frac{ {m}^{2} - m - 2}{ {m}^{2} - 1} \\ = \frac{ {m}^{2} - 2m + m - 2 }{ {(m)}^{2} - {(1)}^{2} } \\ = \frac{ m(m - 2) + 1(m - 2)}{(m - 1)(m + 1)} \\ = \frac{(m + 1)(m - 2)}{(m - 1)(m +1) } \\ = \frac{(m - 2)}{(m - 1)} \)

Hope you could get an idea from here.

Doubt clarification - use comment section.

Help me with this radius and area work

Help me with this radius and area work

Answers

Answer:

1. This question seems to already have the answer. The radius of the circle is the distance from the center of the circle to any point on the circle.

2. $65.91

3. 36.04cm

Step-by-step explanation:

2. First, you neeed to solve for the circumference of the circle to determine how much fencing you will need. To do this, use the formula C=2πr and insert the given radius of 3.8 into the equation.

C = 2 * pi * 3.8

C = 23.88

Then, to find the total cost, multiply the circumference by the price per meter of fencing.

23.88 * 2.76 = 65.91

3. First, you have to find the total area of the circle so you can work backwards to find the diameter. To do this, since there are 12 slices, multiply the area of each slice by 12.

85 * 12 = 1020

So 1020 is the area of the circle. The formula to find the area of a circle is A = πr^2. So we need to use that equation to find the radius, so we can double it to get the diameter.

We know the area is 1020 so we set that to A.

1020 = pi(r^2)

Divide both sides by pi.

1020/pi = r^2

Then square root both sides.

sqrt(1020/pi) = r

r = 18.02

Then, since diameter is r*2, you can just multiply 18.02 * 2 to get the diameter.

d = 18.02 * 2

d = 36.04

Hope this helps.

A banshees s dD dsbshshshs shshshshshah

Answers

Please don't spam the questions.

Step-by-step explanation:

Which symbol correctly relates 23 ? 16 check all that apply

Which symbol correctly relates 23 ? 16 check all that apply

Answers

Answer:

C and E

Step-by-step explanation:

23 > 16 and \(23\geq 16\) are both true statements since the quantity of 23 is greater than that of 16.

the correct symbol that relates is c and e

Explain the process you would use to find the area of the shaded region. Then calculate the shaded region.
You may leave your answer in terms of π or round to the nearest tenth.

Explain the process you would use to find the area of the shaded region. Then calculate the shaded region.You

Answers

The shaded region of the rectangle is 242.9 cm² and the shaded region of the sector is 7.1 square units.

What is the area of the shaded regions?

Question 17) is a figure of a rectangle and two inscribed circles.

The area of a rectangle is expressed as: A = length × width

The area of a circle is expressed as: A = πr²

Where r is the radius.

To determine the area of the shaded region, we simply subtract the areas of the two circles from the area of the rectangle.

Area = ( Length × width ) - 2( πr² )

Area = ( 40 × 10 ) - 2( π × 5² )

Area = ( 400 ) - 2( 25π )

Area = 400- 50π

Area = 242.9 cm²

Area of the shaded region is 242.9 squared centimeters.

Question 18) is the a figure a sector of a circle and a right triangle.

The area of a sector is expressed as: A = (θ/360º) × πr²

The area of a triangle  is expressed as: A = 1/2 × base × height

To determine the area of the shaded region, we simply subtract the areas of the triangle from the area of the sector.

Hence:

Area = ( (θ/360º) × πr² ) - ( 1/2 × base × height )

Plug in the values:

Area = ( (90/360º) × π × 5² ) - ( 1/2 × 5 × 5 )

Area = 25π/4 - 12.5

Area = 7.1

Therefore, the area of the shaded region is 7.1 square units.

Learn more about circles here: brainly.com/question/11952845

#SPJ1

Please help!!!!! In a hurry

Please help!!!!! In a hurry

Answers

Answer:

1/12

Step-by-step explanation:

Answer:

1 /12. hope you get an a, thx

To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4
years.
(a) What was the total amount Donna ended up paying for the car (including
the down payment and monthly payments)?

(b) How much interest did Donna pay on the loan?

Answers

Total amount paid by Donna is $16,689.6 and interest paid is $789.6.

What exactly does a down payment mean?

The cash up front paid by the buyer in real estate transactions and other significant purchases is known as a down payment on a house. For a property being used as a primary residence, down payments, which are typically a percentage of the purchase price, can range from as little as 3% to as much as 20%.

According to question:

Given,

Price of car= $15,900

Down Payment=$4800

number of months=12 x 4=48 month

Monthly payment=$245.70

Total amount Donna paid = Down payment+ all monthly installment

Total amount = $4800+ 48 x 247.70 =$16,689.6

Interest Paid = $16,689.6 - $15,900 = $789.6

To know more about down payment visit:-

brainly.com/question/29075522

#SPJ1

Factor −5x2 + 10x.

PLS HURRY NEED THIS DUE TODAY

Answers

Answer:

C.  5x(-x + 2)

Step-by-step explanation:

To factor the expression -5x² + 10x, we need to look for a common factor that can be factored out.

Finding a common factor involves identifying a term or expression that can be factored out from each term of a given expression.

Both terms have the common factor of 5x, so we can factor out 5x:

5x(-x + 2)

Therefore, the factored form of -5x² + 10x is -5x(x - 2).

\(\hrulefill\)

Additional notes:

If we expand the expressions in the given answer options, we get:

  A.  −5x(x + 2) = -5x² - 10x

  B.  5(−x² + 10x) = -5x² + 50x

  C.  5x(−x + 2) = -5x² + 10x

  D.  x(5x + 10) = 5x² + 10x

Hence confirming that the correct answer is option C.

SOLUTION:

To factor \(-5x^2+10x\), we can begin by factoring out the greatest common factor, which is \(-5x\):

\(-5x^2 + 10x = \boxed{-5x(x - 2)}\)

We can check our answer by distributing \(-5x\) to the expression inside the parentheses:

\(\begin{aligned}-5x(x - 2)& = (-5x)(x) + (-5x)(-2)\\& = -5x^2 + 10x\end{aligned}\)

\(\therefore\) The answer is \(-5x(x-2)\).

\(\blue{\overline{\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad\qquad}}\)

Get brainly if right!! Plsss help

A dozen roses in a gift box cost 21 dollars. Twenty roses in a
gift box cost 32.6 dollars. How much does a gift box cost? How
much does one rose cost?

Answers

Answer: \(\$1.45\); \(\$3.6\)

Step-by-step explanation:

Given

A dozen roses in a gift box costs $21

Similarly, 20 roses in a gift box costs $32.6

Suppose the price of single rose and gift box is \(x\) and \(y\)

\(\therefore 12x+y=21\quad \ldots(i)\\\Rightarrow 20x+y=32.6\quad \ldots(ii)\)

Solving (i) and (ii) ,  we get

\(x=\$1.45;y=\$3.6\)

Thus, the price of the one rose is \(\$1.45\) and the price of gift box is \(\$3.6\)

Answer:

1.45 and 3.5

Step-by-step explanation:

Calculate the distance between the points N=(-2,-1) and L=(3-4) in the coordinate plane. Give an exact answer (not a decimal approximation)

Answers

The distance between N=(-2,-1) and L=(3,-4) in coordinate plane will be √34 unit.

What is plane?

In two dimensions, a plane can continue on forever. The lack of breadth. A plane is an example of coordinate geometry. A point's location in a plane is determined by its coordinates.

A plane is a two-dimensional, flat surface that never ends in mathematics. A plane is a two-dimensional equivalent of a three-dimensional equivalent that contains three spatial dimensions, a line, and a point. Planes can resemble subspaces in some higher-dimensional situations, as if the room's walls had been substantially stretched. These walls have their own existence, exactly as in the context of Euclidean geometry.

A flat surface in three dimensions can be represented using the plane equation. There are several approaches for determining the equation for a given function.. The equation for the plane can be expressed in either cartesian form or vector form.

Hence, the general form of the equation is A(x−x1)+B(y−y1)+C(z−z1)=0

Now,

For given two points in (x1,y1),(x2,y2) in coordinate plane

distance between them will be = √((x2-x1)²+(y2-y1)²)

So, distance between  N=(-2,-1) and L=(3,-4)=√((3+2)²+(-4+1)²)

=√(25+9)

=√34

hence,

          The distance between N=(-2,-1) and L=(3,-4) in coordinate plane will be √34 unit.

To know more about Planes visit the link

https://brainly.com/question/29271728?referrer=searchResults

#SPJ4

Write the absolute value equations in the form | x - b |= c (where b is a number and C can be either a number or an expression) that has the following solution set. all numbers such that x <= 5

Answers

The absolute value equations in the form | x - b |= c is x-5<=0

What is absolute value?

A number's absolute value is defined as how far it is from the origin of a number line. The symbol |a|, which represents the size of any integer "a," is used to represent it. Any integer's absolute value is a real number, regardless of its sign or whether it is positive or negative.  Two vertical lines are used to depict the modulus of an as |a|.

Given,

The absolute value equations in the form | x - b |= c

Where b is a number and C can be either a number or an expression

The equation must be written down for x <= 5

All numbers will be such that x <= 5

So, x-5<=0

To learn more about absolute value from the given link

https://brainly.com/question/12928519

#SPJ1

PLEASE HURRY

#1 Find the y intercept. 9x - 12y + 18z = -36

A (-4, 0, 0)

B (0, -3, 0)

C (0, 3, 0)

D (0, 2, 0)

#2 Find the x intercept. x + y + z = 3

A (0, 0, 0)

B (0, 0, 3)

C (0, 3, 0)

D (3, 0, 0)

#3 Find the z intercept. 9x - 12y + 18z = -36

A (-4, 0,0)

B (0, -3, 0)

C (0, 3, 0)

D (0, 0, -2)

#4 In three dimensions the graph of an equation in three variables such as: 3x - 2y + z = 6 is a

A Sphere

B Plane

C Line

D Single Point

Answers

Answer:

4B

Step-by-step explanation:

i just did this and i got 4/4

Answer:

1: C

2: D

3: D

4: B

Step-by-step explanation:

just did it, 4/4

y=9/4×2

sketch the graph of f and f on the same set of axes

Answers

The graph of the function \(f(x) = (9/4)x^2\) is a symmetric upward-opening parabola.

The graph represents a parabola that opens upward. As x increases, the corresponding y-values increase, forming a curved shape. The vertex of the parabola is at the origin (0,0). The graph is symmetric with respect to the y-axis, meaning that the left and right sides of the parabola are mirror images of each other.The slope of the graph gradually increases as x moves away from the origin. The steepness of the curve becomes more pronounced, indicating a faster rate of increase in y-values for larger x-values.The graph does not intersect the x-axis, indicating that there are no real roots or solutions for the equation f(x) = 0. The y-intercept of the graph is at (0, 0), and the y-values increase indefinitely as x approaches positive or negative infinity.

Overall, the graph represents a quadratic function with a positive leading coefficient, resulting in an upward-opening parabolic curve. The graph has been attached.

For more questions on graph:

https://brainly.com/question/19040584

#SPJ8

y=9/42sketch the graph of f and f on the same set of axes

Find unit rate round to nearest hundredth if necessary.

Brainliest

Please don’t put any files I cannot download them. Therefore I cannot accept files please and thank you.

Find unit rate round to nearest hundredth if necessary. Brainliest Please dont put any files I cannot

Answers

Answer:

Step-by-step explanation:

0.57 . im guessing

Leila has a deck of 10 cards numbered 1 through 10 . She is playing a game of chance.
This game is this: Leila chooses one card from the deck at random. She wins an amount of money equal to the value of the card if an even numbered card is drawn. She loses $6 if an odd numbered card is drawn.

(a) Find the expected value of playing the game.

(b) What can Leila expect in the long run, after playing the game many times?
(She replaces the card in the deck each time.)

Leila can expect to gain money.

Leila can expect to lose money.

Leila can expect to break even (neither gain nor lose money).

Answers

a. The expected value is $12

b. She is expected to win money

What is the expected value of playing the game?

To find the expected value of playing the game, we need to calculate the average value of the winnings or losses.

(a) Expected Value:

The probability of drawing an even-numbered card is 5/10 (since there are 5 even-numbered cards out of 10), and the probability of drawing an odd-numbered card is also 5/10.

If Leila draws an even-numbered card, she wins an amount equal to the value of the card. So the expected value of winning is:

(5/10) * (2 + 4 + 6 + 8 + 10) = (5/10) * 30 = 15/10 = $15

If Leila draws an odd-numbered card, she loses $6. So the expected value of losing is:

(5/10) * (-6) = -3

To find the overall expected value, we subtract the expected value of losing from the expected value of winning:

Expected value = (15) + (-3) = 12

Therefore, the expected value of playing the game is $12

(b) In the long run, after playing the game many times, Leila can expect to lose money. Since the expected value is positive $12 , on average, she will win $12 per game.

Learn more on expected value here;

https://brainly.com/question/14723169

#SPJ1

Other Questions
2.with so many children,the parents have a lot of chores to do at home.what can you say about this? Im a fruit cocktail for every 30ml of orange juice and you need 45ml of apple juice and 25ml of coconut milk . Whats proportion if the cocktail is apple juice ? Which of these four atoms is the MOST chemically stable given the electron formation of each?A) HeB) LiC) ND) S Which section of Ethernet frame contains the data from higher layers? The relationship between the natural variation and specifications is quantified by a measure known as the _____. Preterite vs imperfect break out room Can you please help me ? I need this really bad. Geologists use radioactive dating to determine the absolute ages of rocks. *TrueFalse What is the area of the circle shown? Use 3.14 for pi.Help Me fast I need to submit this test in 20 minutes help please can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400 Pleaseeeee help urgent! Write a letter to your friend who moved to a new school, explaining how things have been here at your school An aircraft is flying at an altitude of 6 km. Its velocity with respect to the surrounding air is 100 m/s. Calculate the dynamic pressure. whoevers answers this CORRECTLY gets brainliest . its due tmr ! What force makes an object slide? Ok so,I have a theater assignment and I don't know how to do it...I have to design a 1980's living room and I don't know what website to use. someone help me please! What became in 1858 to link New Mexico tot he rest of the country Is my answer choice wrong or right? Robot Smart Ltd is a leading high-tech company which is incorporated in Surrey, BC. Thecompany wants to add an additional production line in August 2022. They hired you, a UCWgraduate, to prepare a capital budgeting for the project.Below is the information that your manager provided:1. The facility is made up of one piece of land in North Vancouver value at 10%, one nonresidential building value at 20% of the total cost 70% of manufacturing equipment. Atthe end of projects life, the equipment will be sold for an estimated $0.2 million; assumethe buildings value will be $0.1 million. Land residual value is unclear.2. Start-up costs include $1.5 million to build the production facilities, including land,building and equipment. The project will last for 8 years.3. The company estimated that it is able to make 2300 of its new products robots, could besold annually over the next eight years at a price of $800 each. Variable costs per robotare $300 and each years fixed costs is 55,000.4. To handle the new product line, Robot Smarts net operating working capital would haveto increase by an amount equal to 10% of sales revenues and will be half recovered at theend of project.5. However, if Robot introduces its new products, sales of its existing products will fall$300,000 per year. There will also be $80,000 to hire new workers who are familiar withthe new equipment operation. The market research on the new robots was $350,000. Thecompany will retool one of its existing manufacturing facilities to produce the newmodel. The one-time retooling cost is $170,000. BC government also granted thecompany an innovation funding of $10,000 in Jan 20226. The manager is complaining the inflation will affect fixed cost, variable cost and the salesprice in current years. The financial division has estimated the companys WACC is12%. The company also assume the sales will increase 8% per year.Requirements1. Using an Excel spreadsheet: Find the NPV of the project by using the pro forma financial statement method to determine cashflows. Set up the necessary equations by referencing to the input variable cells. The spreadsheet must beformula driven; do not put any numbers in equations, must use cell references. Why was going to school at H.A. Jack such an important part of Trevor Noah's childhood? Explain in your own words.If anyone can help please help me answer this as soon as possible thank you What does Ira Berlin mean when he says that freedom and slavery were created at the same moment? How does creating an out group strengthen the identity and status of the in group?