What warning(s) is Orwell giving the audience in his novel, Animal Farm, and how does he get that warning (or warnings) across through the genre of fable? Make sure to embed at least four quotes from Animal Farm as support for your observations, and conclude by explaining why Orwell might have chosen to write this tale in the form of a fable instead of as a biography or a piece of historical fiction.

Answers

Answer 1

Answer:

no se :)

Explanation:

Answer 2

Answer:

c is correct

Explanation:


Related Questions

Which arrangment of these sentences would be best for a conclusion paragraph??



I need help!!

Which arrangment of these sentences would be best for a conclusion paragraph??I need help!!

Answers

Answer:

You should do C.

Explanation:

figurative language is language that

Answers

Answer:

isnt literal.

Explanation:

for example: im so hungry i could eat a horse.

I dont actually mean I can eat a horse its just an exaggeration of how hungry i am.

The boy who harnassed the wind writing assignment

Imagine you are William's cousin, living in America. He writes to you and tells you about putting his dog down and all the other issues he and his family has been struggling with. Write a letter empathizing with him and suggest ways that you could help him.

This letter must be no less than five (5) paragraphs, must be detailed and identifies the struggles mentioned in chapter 7, use words that show empathy. Structure your paper in letter format. See the sample of the format attached.

Answers

"The Boy Who Harnessed the Wind" is a criticism on how many African communities are forced to rely on corrupt governments for survival, and how those governments frequently leave the citizens who rely on them.

What are the topics in The Boy Who Harnessed the Wind?

The film The Boy Who Harnessed the Wind addresses a number of challenges confronting Malawi, including high school dropout rates, persistent poverty, and famine. The Global Goals of the United Nations demand for all children to get an education, the abolition of poverty, and access to nutritious food for all.

What is the main idea of The Boy Who Harnessed the Wind Chapter 3?

William has difficulty expressing his grief. Geoffrey, William's buddy and cousin, is distraught and perplexed by his father's death. William claims that mourning for his uncle was the most lonely time of his life.

To know more about The Boy Who Harnessed the Wind visit:

https://brainly.com/question/21086085

#SPJ1

What should audience members ask themselves when they evaluate how an actor interprets a character? Choose three answers. Which words does the actor emphasize? What makes this a talented actor? How old is the actor? In what other productions has the actor appeared? What gestures and movements does the actor make? What emotions does the actor convey?.

Answers

Answer:

What emotions does the actor convey? What gestures and movements do the actor make? which words does the actor emphasize?

Explanation:

The audience members ask themselves in evaluating a character are:

Which words does the actor emphasize?

What gestures and movements does the actor make?

What emotions does the actor convey?

What is evaluating a character?

To analyze another's character, we must first recognize our own and the other's personality.

We can forecast our and their future reactions, thoughts, and behaviors with a high degree of consistency and likelihood once we know this.

We'll be able to judge character rather accurately.

Thus, the correct options are A, E, and F.

Learn more about evaluating a character

https://brainly.com/question/24132305

Why don't Maya's parents allow her to go to the dance? What do we learn about Maya's parents from this?
Why don't Maya's parents allow her to go to the dance? What do we learn about Maya's parents from this?

Answers

Maya's parents didn't allow her to go to the dance because they are unfamiliar with American culture and customs since they are rigid, new to the country, and are still attempting to strike a balance between Kazakhstan's customs and America's more free-wheeling way of doing things.

What do we learn about Maya's parents from this?

This reveals that they are having a culture conflict with the American way of doing things, hence their reluctance to expose Maya.

Thus, we can summaries to state that Maya's parents didn't allow her to go to the dance because they are unfamiliar with American culture and customs.

Learn more about Maya:
https://brainly.com/question/16039906
#SPJ1

Standing on the snow-covered plain, as if in a pasture amid the hills, I cut my way first through a foot of snow,
and then a foot of ice, and open a window under my feet, where, kneeling to drink, I look down into the quiet
parlor of the fishes, pervaded by a softened light as through a window of ground glass, with its bright sanded
floor the same as in summer; there a perennial waveless serenity reigns as in the amber twilight sky,
corresponding to the cool and even temperament of the inhabitants. Heaven is under our feet is well as over our
heads.
Which best describes the purpose of the imagery in this excerpt?
to illustrate the author's calm, contemplative mood
O to encourage readers to study nature more closely
• to share the author's views on religion and the afterlife
O to demonstrate the complexity of animal behavior

Answers

to illustrate the author's calm, contemplative mood

Walden may be viewed as a narrative essay because it is based on the author's own experience, which he chose to share. Henry David Thoreau captures all of the insights and realizations he had while residing in the natural world in his book. A narrative essay recounts a story about a real-life experience, therefore Walden probably fits this description. Henry David Thoreau, an American transcendentalist author, wrote a book titled Walden. The essay is a meditation on straightforward life in the countryside. The book functions in many ways as a guidebook for independence, satire, social experiment, spiritual quest, and personal declaration of freedom.

To know more about walden refer to https://brainly.com/question/7286841

#SPJ9

THIS IS DUE SOON SO PLEASE ANSWER CORRECTLY!

THIS IS DUE SOON SO PLEASE ANSWER CORRECTLY!

Answers

Answer:

I would think it is the second one or the last one. Sorry not much help there.

Explanation:

Answer:

B

Explanation:

He's talking about how adults usually have boring conversations so he thinks that they are hard to conversate with.

if you want to be succesfull

Answers

You have to be prepared to put in a lot of effort, set objectives, and endure in the face of difficulties if you want to be successful.

Setting definite, defined, and doable goals is a successful person's strategy. Define modest, achievable measures that you can take to achieve your greater goals. Keeping your motivation high throughout the road, aids in maintaining concentration and enables demonstrable improvement.

Hard work, commitment, and self-control are necessary for success. To reach your objectives, be prepared to put in the time and effort required. Prioritize your duties, develop efficient time management techniques, and maintain your commitment to seeing your objectives through. Stop putting things off and keep your behavior consistent.

Learn more about hard work, here:

https://brainly.com/question/30642352

#SPJ1

The complete question is probably

complete the sentence

if you want to be succesfull|_________________________________

According to the informational film about Mississippi, what types of places were segregated?

Answers

In Mississippi during the era of segregation, public places such as restaurants, schools, hotels, theaters, and transportation facilities were segregated based on race.

What was the era of Segregation?

The era of segregation in the United States was a period in American history from the late 19th century to the mid-1960s during which African Americans were subject to racial segregation and discrimination in many aspects of their daily lives. This era was characterized by the implementation of Jim Crow laws, which mandated segregation in public places such as schools, transportation, and restaurants, as well as housing, voting, and other areas.

African Americans were denied equal access to education, employment, and other opportunities, and were subject to violence, intimidation, and political disenfranchisement. This era of segregation and discrimination had a profound and lasting impact on African American communities and played a significant role in shaping the civil rights movement of the mid-20th century.

Learn more about era of segregation: https://brainly.com/question/2161501

#SPJ1

Radio collars like this one help
scientists track a wild animal's
movements. Each collar is
specially designed for a particular
species, or kind, of animal.

In your own words

Answers

Answer:

Radio collars work as tracking devices for scientists to use on whatever animal necessary.

Explanation:

Research suggests that laughter improves people’s emotional and physical well-being. Write a research-based essay to inform the reader about the positive effects of laughter on emotional and physical health. Properly cite research evidence to inform the audience about the topic.

PRE WRITING

Answers

Answer:

Explanation:

Laughter decreases stress hormones and increases immune cells and infection-fighting antibodies, thus improving your resistance to disease. Laughter triggers the release of endorphins, the body's natural feel-good chemicals. Endorphins promote an overall sense of well-being and can even temporarily relieve pain.

PLS MARK AS BRAINLIEST

The story is Miss peregrine please help me I really need your help

The story is Miss peregrine please help me I really need your help

Answers

Answer:

number 3

Explanation:

3. Jacob does not like the place of his employment. He purposely tries to get fired. This simply shows that he despises his job at Smart Aid.

Which sentence best describes the theme of a story?
ОА.
The message that the author wants to convey.
OB.
The idea stated in the opening lines of the story.
OC.
The idea stated
the end of the story.
OD
The author's view of the characters in the story

Answers

Answer:

the answer is OA

Explanation:

Which of the following words best describes "building up" an idea in your paper?
A. Refining
B. Developing

Answers

Answer:

B) Developing

Explanation:

To refine means to remove, and develop means to create or in this case, build up.

This makes B the correct choice.  Hope this helps! :)

Answer: The word that best describes "building up" an idea in your paper is developing.

What is Developing?

Developing means expanding or elaborating on an idea by providing additional information, supporting evidence, and examples. When you develop an idea in your paper, you are making it more clear, detailed, and convincing to your readers.

What is Refining?

Refining means improving the quality or accuracy of something by making small adjustments or corrections. While refining an idea can be part of the process of developing it, refining does not convey the sense of expansion or elaboration that building up an idea implies.

Therefore, the best option is B. Developing.

General studies degree Explain why and how you see things differently?
Offer and support an opinion. ?

Answers

We are able to see things in different ways because we have different backgrounds, which interfere with our worldview.

What is this life history?It's the experiences we've had.It's the moments we spend.It is the concepts to which we are subjected.

Throughout our life, we have very impactful experiences that transform our way of seeing the world around us. As we are different people, these experiences are also different and the way each person goes through them impacts them differently.

Learn more about worldviews:

https://brainly.com/question/29603265

#SPJ1

Which prewriting steps are part of research for an argumentative essay? select three options.

Answers

The prewriting steps that are part of research for an argumentative essay include:

Identifying the topic, This step involves selecting a specific issue or topic for your essay. It should be something that can be debated or argued. Gathering information, This step involves conducting research to gather relevant and reliable sources of information on your chosen topic. It includes reading books, articles, journals, and exploring credible online sources. Evaluating sources, This step involves critically assessing the credibility and relevance of the sources you have collected.

Consider the author's qualifications, the publication or website's reputation, and whether the information aligns with your essay's argument. These three prewriting steps will help you lay a strong foundation for your argumentative essay by identifying a topic, gathering information, and evaluating sources.

Know more about  argumentative essay:

https://brainly.com/question/15727685

#SPJ11

What romantic element is present in this excerpt from “Rip Van Winkle”?

In a long ramble of the kind, on a fine autumnal day, Rip had unconsciously scrambled to one of the highest parts of the Kaatskill mountains. Panting and fatigued, he threw himself, late in the afternoon, on a green knoll, covered with mountain herbage, that crowned the brow of a precipice. From an opening between the trees, he could overlook all the lower country for many a mile of rich woodland. He saw at a distance the lordly Hudson, far, far below him, moving on its silent but majestic course, with the reflection of a purple cloud, or the sail of a lagging bark, here and there sleeping on its glassy bosom and at last losing itself in the blue highlands.

A. The emphasis on individual choice
B. The emphasis on human optimism
C. The emphasis on the beauty of Nature
D. The emphasis on the importance of society
E. The emphasis on scientific discovery

Answers

Answer:

The romantic element present in this excerpt from "Rip Van Winkle" is B. The emphasis on the beauty of Nature.

Explanation:

From the excerpt, Rip is described to have climbed one of the highest parts of the Kaatskill mountains , thrown himself on the floor and sit down to observe the beauty of nature.

Right from the mountain, the green knoll is described, the rich woodland of the lower country, the purple cloud, and the blue highlands are all wonders of nature that Rip was admiring in the excerpt before he fell asleep there.

Romanticism is a genre of literary writing that emphasized the individual, nature, and emotions. The romantic element that is present in this excerpt is;

C. The emphasis on the beauty of Nature

As explained above, romanticism stressed love for nature. This is reflected in Rip Van Winkle's admiration for nature.

He admired the Hudson River from the Catskills Mountain. The adjectives that were used to describe this river (lordly, majestic, etc) demonstrate love for nature.

Therefore, option C is correct.

Learn more here:

https://brainly.com/question/2036550

what is the best introduction type used to discuss a traditional belief​

Answers

Folk...hope it helps

Not subject to taxes?

Answers

Answer:

their no subject to taxes.

Explanation:

your question ❓ is so werid.

what other person said

Exercise 2. Supply suitable adjective clauses: 1. All the passengers ......... had a narrow escape. 2. We should not forget those brave soldiers 3. Water ......... should be boiled and filtered. 4. Such books ......... should be read again and again. 5. I would like to lay down my life for the country ..... 6. The trick ......... made the shopkeeper angry. 7. The prize winners ......... should come to the stage. 8. People ......... should not throw stones at others. *****​

Answers

The suitable adjectival clauses will be:

All the passengers who were on board had a narrow escape.We should not forget those brave soldiers who sacrificed their lives for the country.Water which is contaminated should be boiled and filtered.Such books which provide valuable insights should be read again and again.I would like to lay down my life for the country which has given me so much.The trick that was played by the customer made the shopkeeper angry.The prize winners who have been announced should come to the stage.People who engage in such violent behavior should not throw stones at others

What are adjectival clauses?

Adjective clauses are dependent clauses which give information about nouns.

They allow you to combine two sentences into one by using relative pronouns (who, whom, whose, where, when, which, that, and why) as connectors.

Learn more about adjective on:

https://brainly.com/question/1047465

#SPJ1

Someone please answer this for me in 8-10 sentences :
What universal things make people the same, even though we have different cultures, traditions, and family/social rules?

Answers

Answer:

Easy

Explanation:

The one universal thing that makes people the same is that we all originated in modern day Africa, meaning we are all African. Which means there is no white and black, no lower and no higher. So, everyone is basically the same person here. Even though we have different faces, colors, backgrounds that all doesn't contribute to our distinctive homes. You can't call someone African just because they look brown or black you can call someone African because they were born with you in modern day Africa.

Choose a topic from the following list and write a topic outline or a sentence outline. You may choose your own topic if you
prefer. This topic may be used for an essay or for a speech assigned later in this unit.
Topics
three things your father or mother does on the job
three things to look for in the library
three things your mail carrier must do
three things someone has done for you
the three most important lessons you have learned
three things to avoid while riding a bicycle

Answers

Answer:

Nov 9, 2018 — Redditors revealed the nicest thing anyone has done for them and how ... If you'​ve ever been the recipient of a "pay it forward" moment, you ... and the bus ride would be three hours to work, after changing buses several times.

Explanation:

please help asap! i will give you brainliest!!! :)
tysm!

please help asap! i will give you brainliest!!! :)tysm!
please help asap! i will give you brainliest!!! :)tysm!
please help asap! i will give you brainliest!!! :)tysm!

Answers

Answer:

Answer is B) Future quakes in florida would probably cause only slight damage. If not the try C.

Explanation:

Have a great day

Telluride, Colorado is my favorite tourist destination for skiing, but it is difficult to get to by either plane or car because it is located high in
the San Juan Mountains. If you fly into Telluride Airport, expect a treacherous journey in a two-propeller plane with plenty of turbulence. If you ha
a weak stomach, beware! The plane dips and twists, rocks and rolls throughout the entire one hour and sixteen minute flight. Despite the difficult
journey, flying into Telluride Airport has its positives. The airport is only seven miles to downtown and, if you are adventure-minded, the views
traveling in are also excellent (I especially enjoy flying in between the mountains!). The other air travel option is to fly into Montrose Airport which
one and a half hours away from downtown. The plane ride is more comfortable, but the extra travel time is a turn-off to many visitors. Traveling t
Telluride by car will take you seven hours from Denver and six hours from Colorado Springs. You can expect these travel times to be much longer
during the winter season as you will be traveling up and over the San Juan Mountains; encountering snow and ice on the roads is not only possibl
but practically guaranteed.
Christy has written this passage as a rough draft for an English assignment. She is now ready to proofread and edit her work before she
hands it in for a grade.
Which describes the usage problem she needs to fix?
1. The passage switches from first to second person.
2. The passage uses both an omniscient and third person narrator.
3. The passage has errors in subject-verb agreement.
4. The passage contains multiple misplaced modifiers.

Answers

Answer:B

Explanation:

in act 4 scene 4 of romeo and juliet how does the opening scene juxtapose the surrounding moments in the play?

Answers

Romeo and Juliet's Act 4, sequence 4 opening sequence contrasts the play's earlier scenes in a number of interesting ways.

First of all, it stands in sharp contrast to the scene before it, in which Romeo and Juliet have just tied the knot. They look forward to a bright future together, creating a scenario that is full of love and optimism. Act 4, Scene 4's opening scene, on the other hand, is marked by hopelessness and death.

The play's remaining acts, which are replete with scenes of passionate love and tremendous delight, contrast sharply with the play's opening scene. Romeo and Juliet's tragic fate is highlighted by the Friar's sadness at the prospect of their approaching deaths, which heightens the play's emotional effect.

Overall, Romeo and Juliet's Act 4, Scene 4 opening scene serves to powerfully contrast the play's subsequent events. It acts as a reminder of the tragic nature of Romeo and Juliet's end as well as the divisive nature of prejudice and xenophobia.

To learn more about Romeo and Juliet link is here

brainly.com/question/24058013

#SPJ4

i need both of these answers !!

i need both of these answers !!

Answers

Answer:

All you have to do is reread paragraph 5 again and you will see it

Explanation:

What does the simile "Now we’ll together; and the chance of goodness / Be like our warranted quarrel!" mean in this excerpt?

Malcolm feels that they should focus on being better men rather than fighting against Macbeth.
Malcolm thinks his people should stop thinking about fighting like the other men and instead focus on solutions.
Malcolm feels they should join forces with the other men instead of fighting on their own.
Malcolm believes their reason for fighting is just, and hopes they have a great chance of success because of this.

Answers

The simile "Now we’ll together; and the chance of goodness / Be like our warranted quarrel!" means that Malcolm believes their reason for fighting is just, and he hopes they have a great chance of success because of this. Option D

The meaning of the simile

In this excerpt, Malcolm is rallying his troops and expressing his belief that their cause is righteous. The phrase "the chance of goodness" refers to the favorable probability or opportunity for achieving a good outcome. The simile compares this chance of goodness to their "warranted quarrel," emphasizing that their cause is justified and deserving of support.

By using this simile, Malcolm suggests that their fight against Macbeth is not only morally justified but also has a high likelihood of success. He instills confidence in his troops by highlighting the alignment between their noble cause and their strong chances of achieving a positive outcome.

Learn more about simile at https://brainly.com/question/273941

#SPJ1

Someone pls help . Thank you sm ☄️ .

Someone pls help . Thank you sm .

Answers

Answer:

Certain concepts can translate and help you solve other problems you may face later on in life.

Explanation:

You never stop learning being able to learn is a skill that you can apply anywhere

The speaker of the poem is best described as A. A descendant of a famous photographer B. A historian using photographs as information sources C. A researcher studying a historically important photographer D. A viewer musing on the significance of a specific photograph - R E. A beginner learning the basics of a photographic technique

Answers

The speaker of the poem is best described as a viewer musing on the significance of a specific photograph. So, the correct answer is option D. The poem is centered around the speaker's observation and reflection on a single photograph, and there is no indication that they have any direct connection to the photographer or historical context.

The speaker's musings on the photograph are largely personal and emotional, as they speculate on the thoughts and feelings of the subjects captured in the image. They also contemplate the ways in which the passage of time and cultural shifts may have altered the meaning and significance of the photograph. Overall, the speaker's perspective is that of a curious and reflective viewer, rather than a researcher or expert in the field of photography.

Know more about photography here:

https://brainly.com/question/30685203

#SPJ11

During a speech on the need to limit growth at State University, Leeland states, "According to Mary Sue Kaye, Dean of Students, if State U. does not cap enrollment soon it will be impossible to offer enough classes for students in most majors to graduate in four years." What for of supporting material is he using?

Answers

Answer:

Testimony.

Explanation:

Testimony is defined as 'an account of first-hand experience or a solemn affirmation by a witness' which can be the best evidence or proof to substantiate a claim.

In the given speech, the statement made by Leeland exemplifies a 'testimony' which he employs to support his claim i.e. 'need to limit growth at State University.' It would be considered a testimony as it states a 'first-hand experience of a witness('Mary Sue Kaye, Dean of students') who states that there is a lack of availability of enough classes to be offered to students in most majors.' Since it is a first-hand experience by Dean herself, it can be rely upon easily, and therefore, it not only supports the speaker's point but also persuades the audience to believe it.

Other Questions
the descending limb of the loop of henle is permeable to water so water diffuses out of the descending limb into the interstitial fluid. what happens to this water? Which journalistic practice comes close to crossing the line into plagiarism?A)quoting liberally from a speech delivered by a politicianB)quoting extensively in a reviewC)showing a clip in a movie review on televisionD)institutionalized exchange of stories In two or more complete sentences, describe the transformation(s) that take place on the parent function f(x) = 3x to obtain the graph of f(x) = 3-x + 1 + 5. 1) If a bottle of olive oil contains 1.3 kg of olive oil, what is the volume, in milliliters, of the olive oil? Express your answer to two significant figures and include the appropriate units. 2) A cannon ball made of iron has a volume of 116 cm^3. What is the mass, in kilograms, of the cannon ball? Express your answer to three significant figures and include the appropriate units. 3) A balloon filled with helium has a volume of 6.1 L. What is the mass, in grams, of helium in the balloon? Express your answer to two significant figures and include the appropriate units. Como se le denomina a la estructura formada por adicin de vesculas procedentes de aparato de golgi que permiten la aceptacin durante la citocinesis en las clulas vegetales? In a survey at a local university, 38% of students say that they get less than the recommended eight hours of sleep per night. In a group of 4200 students, how many would you expect get eight or more hours of sleep per night? TIMED TEST in what way does mrs. white have power over her husband in the early parts of this chapter the story is called monkeys paw What are the benefits of reading Rich Dad Poor Dad? Which of the following will lower the prices of a countrys outstanding government bonds?a. An open-market purchase of government bonds by the countrys central bankb. A decrease in the required reserve ratio for the countrys commercial banksc. An outflow of financial capital to other countriesd. A decrease in the countrys government spending please help me friends keeping in step with jesus meaning Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG __ museums are worth visiting, but others aren't. (1) any (2) a lot (3) some (4) much 26 Phenotypic testing involves direct observation of the pure culture under a microscope as well as biochemical testing, True False Rubio, Inc., an accrual basis C corporation, reports the following amounts for the tax year. The applicable income tax rate is 30%.Book income, including the items below $80,000Increase in book allowance for anticipated warranty costs 5,000Interest income from City of Westerville bonds 10,000Bribes paid to Federal inspectors 17,000Rubio's income tax expense is ? and GAAP income for the year is ? could Marcie have found a mineral? explaim why or why not the following selected transactions apply to tiffany jewelers company for november and december year 1. november was the first month of operations. sales tax is collected at the time of sale but is not paid to the state sales tax agency until the following month. cash sales for november year 1 were $55,000, plus sales tax of 8 percent. tiffany jewelers company paid the november sales tax to the state agency on december 10, year 1. cash sales for december year 1 were $110,000, plus sales tax of 8 percent. required: use a horizontal financial statements model to show how each event affects the balance sheet, income statement, and statement of cash flows. more specifically, record the amounts of the events into the model. A survey was conducted to measure the heights of Filipino men. The heights of the respondents were found to be normally distributed, with a mean of 64.2 inches and a standard deviation of 1.7 inches. A study participant is randomly selected. . Find the probability that his height is less than 61.8 inches. [Select] Find the probability that his height is more than 68 inches. [Select] If there were a total of 500 respondents, how many of them are expected to be more than 68 inches tall? [Select] [Select] Find the probability that his height is between 67 and 67.5 inches. How tall is the tallest among the shortest 65% of the respondents? Equivalently, if X is the height of a respondent, find k such that P(X < k) = 0.65. [Select] > Why do plants do PHOTOSYNTHESIS?A. To make food (glucose) for themselves! As a byproduct they makeoxygen that we need!B. To make ATP (cell Energy)! Carbon dioxide and water are alsoproduced as byproducts!C. To make oxygen, carbon dioxide and glucose for themselves!D. To make carbon dioxide and water that animals can use!It's33 E This month Joe spent 1/2 of his salary on food and 1/3 on rent. What part of his salary did he spend? Simplify the fraction if possible.