What takes information entered into a given system and sends it automatically to all upstream systems and processes?

Answers

Answer 1

Forward Integration takes information entered into a given system and sends it automatically to all upstream systems and processes.

Any system that transmits data to the Collaboration Server system is considered an upstream system. A system that receives data from the Collaboration Server system is referred to as a downstream system.

A corporation moving up the supply chain engages in a sort of vertical integration known as forward integration. A farmer selling his crops directly to a neighborhood grocery store as opposed to a distribution centre that manages the allocation of products to multiple supermarkets would be a good example of forward integration.

Learn more about upstream system here

https://brainly.com/question/13576583

#SPJ4


Related Questions

is the earth circle or flat​

Answers

Answer:

circle

Explanation:

duh

A group of ______ opposed president grant's reelection and broke with the rest of the party to nominate horace greeley.

Answers

A group of  Liberal Republicans opposed president grant's reelection and broke with the rest of the party to nominate Horace Greeley.

The Liberal Republican party became an American political party that was prepared in may additionally 1872 to oppose the reelection of President Ulysses S. Grant and his Radical Republican supporters in the presidential election of 1872.

The party emerged in Missouri underneath the management of Senator Carl Schurz and shortly attracted other opponents of furnish; Liberal Republicans decried the scandals of the furnish management and sought civil service reform. The celebration opposed provide's Reconstruction rules, particularly the Enforcement Acts that destroyed the Ku Klux Klan. It lost in a landslide and disappeared from the national level after the 1872 election.

The Republican party had emerged as the dominant party inside the aftermath of the Civil war, but many original Republicans have become disenchanted with the leadership of President furnish.

Learn more about the Civil war here: https://brainly.com/question/24992590

#SPJ4

The next great civilization in the Americas was probably the Maya. In fact, archaeologists considered them the first for a long time. They were farming people who lived on the Yucatan Peninsula between 300 and 900 CE. The Maya bore a lot of similarities to the Olmec.

Most Mayan men lived in villages and were advanced agriculturalists. We know this because they practiced intercropping, where certain crops are planted together, using one to stimulate the growth of the other.

The Maya also built huge cities. Some archaeologists estimate that one such municipality, Tikal, now found in Guatemala, was home to as many as 100,000 residents at one time. There were more than 3,000 buildings there, some towering high over the jungle.

The Mayans were very advanced in mathematics, astronomy, and engineering. In Tikal, this manifested in their construction of reservoirs to hold water for the city. The water moved between man-made lakes using gravity in such a manner that they must have had a deep knowledge of mathematics.

According to the passage, we know the Maya were good agriculturalists because there is evidence that

A
they studied planets and stars.

B
they built over 3,000 buildings.

C
they practiced intercropping.

D
they build huge cities.

Answers

They practiced intercropping

how are story elements and a story plot different?

Answers

Answer:

Basic Story elements. Setting: A story's setting refers not only to the physical location, but also the time the action takes place. ... Plot: The plot relates to the events that happen in a story. Plot can be further divided into sub-elements such as: introduction, rising action, climax, falling action, and resolution.

Story plot- the most important element of a story. It is literally the sequence of events and, in that sequence, we learn more about the characters, the setting, and the moral of the story. In a way, the plot is the trunk from which all the other elements of a story grow.

Story elements- The parts of a story consist of five main elements: characters, setting, plot, and conflict along with theme.

~ItsOniiSama ❤

Hope this helps.

two christian teachings about the incarnation?

Answers

Answer:

Explanation:

1. God took on the full limitations of the human condition when he became Jesus 'the Word became flesh and lived among us– which shows how much he loves the human race. 2. Jesus went through the whole cycle of human life – showing Christians that God understands their needs.

one study testing chodorow’s theory found that, when playing:

Answers

One study testing Chodorow's theory found that when playing, children's gender-role behavior was significantly influenced by the gender of the toys they played with.

Chodorow's theory is a psychological theory developed by the psychologist Nancy Chodorow that explores the socialization of gender and how it affects individuals' behavior and personality. According to Chodorow, children form their gender identity through their relationships with their parents, especially with their mothers.

The study involved observing children as they played with different toys and examining how they interacted with them. It was found that boys and girls showed different preferences for toys and played differently with them, and that these preferences were related to their gender-role behavior.

To read more about psychology, visit- https://brainly.com/question/10980588

#SPJ11

15.Psychologists Kenneth and Mamie Phipps Clark foundthat doll testsA)demonstrated that observational learning can promote aggressive as well as nurturing behavior in children.B)showed that most people are willing to obey authority figures, even if those orders conflict with their own personal values.C)confirmed that behavior can be modified based on a system of positive or negative reinforcements.D)exposed internalized racism in African-American children, particularly among children attending segregated schools

Answers

Answer:

D)exposed internalized racism in African-American children, particularly among children attending segregated schools

Explanation:

Pychologists Kenneth and Mamie Phipps Clark were very famous in the psychological field as they have done various researchers and experiments. Kenneth Clark (conducted research on the "impact of racial segregation on children") was the husband of Mamie Phipps Clark (researched on "development of self-consciousness in black children"). They both were mainly famous for their experiment in which they've utilized dolls to study "children's attitude" towards race.

They concluded that the majority of the "black children" tends to prefer white dolls instead of the black dolls because children  described black dolls as bad.

In the question above, the correct answer is D.

Choose the word or phrase that best completes each sentence.
People studied Greek and Roman classics that had been preserved by
.
They hoped to build on the ideas and achievements of the
.
Humanism is a way of thinking about life that is centered on the
.
The philosophy of humanism led to the study of
, or subjects dealing with people.

Answers

Answer:

People studied Greek and Roman classics that had been preserved by- Muslim Scholars

They hoped to build on the ideas and achievements of the- Classical Period

Humanism is a way of thinking about life that is centered on the- interests of people

The philosophy of humanism led to the study of- humanities - , or subjects dealing with people.

Explanation:

I did it and got it right!!

Greek and Roman classics have been preserved by the Muslim scholars in the hope to build on the ideas and remarkable achievements of the classical period. On the other hand, humanism is a way of thinking about life that is centered on the interests of the humans. This philosophy has led to the study of humanities.

What is the study of humanism?

The study of the Greek and Roman culture during the renaissance period in the regions, where more stress was given on the importance of humans in the society over any other aspects.

This study was made possible by the efforts of the Muslim scholars who preserved and passed the stories of the achievements made during this period.

Hence, the significance of humanism is aforementioned.

Learn more about humanism here:

https://brainly.com/question/14448541

#SPJ2

elp them to gain power in the Americas.
after the Louisiana Purchase?
1. Using Source 1, which of the following statements explains what happened to the size of the United States
B
ural
A. It doubled in size and gained access to more resources,
It tripled in size and caused Spain and France to start fighting
C. It quadrupled in size and opened a water route to the East.
D. It decreased in size making the land less interesting for France.
jer

elp them to gain power in the Americas.after the Louisiana Purchase?1. Using Source 1, which of the following

Answers

D. It decreased in sizw making land

How does the government of Charles Towne exemplify the move toward self-rule?

Answers

The correct answer to this open question is the following.

Although there are no options attached, we can comment on the following.

The government of Charles Town exemplified the move toward self-rule in that the form of government of Charles Town, South Carolina in colonial America functioned at the provincial level. The Grand Council was the first legislative institution or body in colonial Charles Town. People elected local representatives to be part of that legislative chamber in August 1671. Albermarle Point was the official location for the legislative meetings. That could be an example of how the government of Charles Town exemplified the move toward self-rule.

What was the biggest accomplishment of the articles of confederation?

Answers

The biggest accomplishment of the articles of confederation is that it enabled the country to prosecute the Revolutionary War.

The enactment of the Northwest Ordinance of 1787, which organized the colonization of the Northwest Territories, was one of the major successes of the Congress under the Articles of Confederation. The US government was successful in resolving problems linked with the colonization of western areas.

Peace was reached between Britain and the colonies, bringing the Revolutionary War to a close. The first planned government was formed. The thirteen colonies were linked together to create a union.

The Articles-created system has numerous successes to its name. Here are a few examples: First, during this time period, the United States not only claimed independence, but also defeated the world's strongest military power. Second, it negotiated an advantageous peace accord.

For more questions on articles of confederation

https://brainly.com/question/13152253

#SPJ4

Select all that apply.

History is the story of the interactions of people forming _____.

states
cities
societies
civilizations
cultures

Answers

Civilizations because through history we have documentation of many civilizations rather than just cities or states

Answer:

cultures, civilizations, and societies

Explanation:

1. why are clockwise and counterclockwise referred to as"senses," rather than directions?
2. describe the effects of taking the mass of the meterstickinto account when the balancing position is not near the 50 cmposition.

Answers

1. Clockwise and counter-clockwise is considered as a sense instead of a course since it is just a view point where its development of heading is continuously evolving. The term can only be used to describe an object-observer system, not a specific direction.

2.When the balancing position is not close to the 50 cm mark, taking into account the meterstick's mass can affect the accuracy of your measurements.

An in-depth explanation follows:

Place the meterstick on a balance point or fulcrum. The mass is not evenly distributed along the meterstick if the balancing position is not close to the 50 cm mark. The position of the meterstick's center of gravity is influenced by its mass. Assuming the adjusting position is a long way from the 50cm imprint, it demonstrates that the focal point of gravity isn't at the midpoint of the meterstick.. For this situation, any estimations you take utilizing the meterstick may be impacted by the lopsided mass conveyance.You should adjust your measurements to account for the meterstick's mass in order to ensure accurate measurements.

In conclusion, taking into account the mass of the meterstick when the balancing position is not close to the 50 cm mark helps you keep your measurements accurate and precise.

Learn more about "meterstick":

https://brainly.com/question/29690562

#SPJ4

All members of a family work as farmers on a very small pece of land. They use tools and techniques that have been passed down for generations rather than any modern technology As a result, they rarely produce more food than they need for themselves during the year.

A.market economy

B.Traditional economy

C.command economy

D.capitalist economy​

Answers

B) Traditional economy

Answer:

traditional econ

Explanation:

a pex

Explain the various dimensions of urban and rural poverty in India

Answers

Answer:

Three-fourths of India's population lives in rural areas and earns its livelihood through agricultural and allied occupations. Rapid growth

Explanation:

hope this helped have a great day

a ________ predicts a relationship between or among variables.

Answers

Hypothesis predict relationships between variables.

When forming a hypothesis, researchers typically identify variables of interest, which are measurable quantities or characteristics that can influence each other. This hypothesis suggests possible relationships or patterns between these variables. Depending on the type of research, it can take many different forms, including:

This type of hypothesis proposes causal relationships between variables. This suggests that changes in one variable lead to changes in another. Example: "Increasing the amount of fertilizer increases crop yields."

To know more about  hypothesis visit :

https://brainly.com/question/32562440

#SPJ4

Government
34. (a) In the caption of this cartoon, what does "convicted by the
media" mean? (b) How can this kind of conviction affect a trial?
35. What do you think the cartoonist feels about the right of a free
press versus the right to a fair trial?

Government 34. (a) In the caption of this cartoon, what does "convicted by themedia" mean? (b) How can

Answers

34. In the caption of this cartoon,  "convicted by the media" means that media have already declared the person to be guilty of a criminal offense.

35. The cartoonist believe that the conflict between "free press vs. fair trial" is a fundamental inconsistency in the U.S. Constitution because the First Amendment of the Constitution expressly protects the right of free speech, and the Sixth Amendment calls for a swift trial by an impartial jury.

What is right of free press?

The essential tenet of freedom of the press or freedom of the media is that expression and communication through a variety of media, including written and electronic media, especially published information, should be seen as a right to be freely practised.

A democracy where the people are the government's ultimate arbiters depends on press freedom, which is safeguarded by the First Amendment. A free press serves as a watchdog that can look into and report on misconduct by the government.

Therefore, there is a contradiction between right to free press and right to free trail.

To learn more about right of free press, click here:

https://brainly.com/question/22451

#SPJ1

What are the 4 types of borders?

Answers

Additionally, there are four sub-categories of fortified borders: fenced, fenced and walled, walled, and militarized borders.

What are Borders?

Physical borders and political borders are two different types of geographic boundaries. Geographical boundaries can be either natural or man-made. Political boundaries by definition include borders, which divide nations, states, provinces, counties, cities, and towns. Borders are political boundaries, as stated in the definition, and these limits are frequently patrolled. When crossing a border, we seldom ever witness border control within Europe or the EU. The border between the US and Canada is one instance outside of Europe/the EU where a person, and maybe their vehicle, will be scrutinized by customs officials when crossing. Borders are not static; they are subject to change.

To learn more about Borders  visit;

https://brainly.com/question/408056

#SPJ4

what is republican in usa

Answers

Answer:

A political party that holds traditional Christian values as a way to live and act.

Explanation:

The republican party traditionally believes in the Christian and constitutional values of their political party.

Answer the following question. a) Who are called Martyrs?
Ans-The people who died for the welfare of the country and people are called martyrs.

Answers

Answer:

Explanation:

I always thought martyr was a religious term, but looking up the definition in a dictionary it says that it is anyone who is killed for their beliefs and that expands the definition quite a bit.  But your definition leaves out that a martyr will die willingly for their beliefs.

Answer:

a person who willingly suffers death rather than renounce his or her religion. a person who is put to death or endures great suffering on behalf of any belief,

Explanation:

plss mark me brainlist

Redacta un articulo de opinion con enfasis partucular en estos 3 puntos 1 la forma en que los pobladores del titicaca se han relacionado con su naturaleza para lograr sostenibilidad. 2 como se relaciona la poblacion en tu region con su naturaleza. 3 el abora una propuesta para lograr desarrollo sostenible utilizando los recursos de tu region.

Answers

La respuesta correcta a esta pregunta abierta es la siguiente.

La forma en que los pobladores del Titicaca se han relacionado con su naturaleza para lograr sostenibilidad es que han actuado de manera muy responsable para combinar las actividades agropecuarias, con la pesca, y han agregado el desarrollo turístico del área para generar mayores ingresos. La parte de sustantibilidad radica en que los pobladores del lago Titicaca cultivan de manera responsable, sin hacerle daño a la tierra y cuidan el lago para las aguas no se contaminen. Lo mismo le piden a los turistas. Que visiten pero sean muy cuidadosos con la naturaleza y el manejo de la basura.

Sucede algo parecido con la población en mi región y la relación con la naturaleza. Yo vivo muy cerca de dos volcanes y uno está activo en este momento. Es una zona turística por excelencia que recibe a muchos visitantes en su reserva ecológica y a muchos escaladores y montañistas que suben al otro volcán que no está activo. A todos se les pide que sean cuidadosos y no hagan fogatas para evitar incendios y que recojan su basura para no contaminar las áreas naturales.

Una propuesta interesante para lograr desarrollo sostenible utilizando los recursos de tu región es que el gobierno municipal pueda apoyar a la gente de esta localidad para que puedan instalar hostales, restaurantes, mercados, centros de descanso y enfermerías para atender mejor a los visitantes. De esta manera se fomentaría el consumo local ayudando a los pobladores de la región y se incrementarían los turistas porque saben que el área ya tendría más y mejores servicios.

Select the correct chronological order for the below battles.

A. Battle of Trenton, Battle of Kings Mountain, Battle of Yorktown, Battle of Cowpens

B. Battle of Yorktown, Battle of Cowpens, Battle of Kings Mountain, Battle of Trenton

C. Battle of Trenton, Battle of Kings Mountain, Battle of Cowpens, Battle of Yorktown

D. Battle of Kings Mountain, Battle of Trenton, Battle of Cowpens, Battle of Yorktown

Answers

Answer: A.

Explanation:

Answer:

C. Battle of Trenton, Battle of Kings Mountain, Battle of Cowpens, Battle of Yorktown

Explanation:

Battle of Trenton-----December 26, 1776

Battle of Kings Mountain-----October 7, 1780

Battle of Cowpens-----January 17, 1781

Battle of Yorktown-----Sep 28, 1781 – Oct 19, 1781

P.S Please put me the brainliest, it really helps me out, I really need to level up

To enjoy a safe visit in the outdoors it's important to: a. plan ahead b. know site-specific regulations before you go c. buy a GPS A & B

Answers

Plan ahead: Research your destination, including the weather, terrain, and any potential hazards. Make sure you have the necessary gear and supplies, including a map and compass, adequate clothing and footwear, and a first-aid kit.

Check site-specific regulations: Regulations can vary by location, so make sure you know the rules before you go. This can include regulations related to campfires, fishing, hunting, and wildlife viewing, among other things.

Leave no trace: When you are in the outdoors, it's important to minimize your impact on the environment. This means packing out all of your trash, not disturbing wildlife, and avoiding damaging vegetation and other natural resources.

Stay on designated trails: Following established trails can help protect the natural environment and prevent accidents. If you do go off-trail, make sure you know how to navigate using a map and compass.

learn  more about adequate here :

https://brainly.com/question/30749698

#SPJ11

5. Name three examples of state power:​

Answers

collect taxes , building of roads , borrow money

Here is an Isenberg entrepreneurship ecosystem. Discuss, with examples, how Markets and culture can support the growth of international new ventures in Nepal. At least 1k words

Answers

The Markets and culture in Nepal can both be great supporters of the growth of international new ventures.

The culturally broad diversity of Nepal—with multiple languages, religions, and ethnicities—provides unique networking opportunities for entrepreneurs to acquire new customers and enter new markets. Additionally, the developing markets of Nepal make it an attractive market for international business, with a thriving investment climate and a large pool of diverse industry sectors.

Furthermore, the country's resources in hydroelectricity, tourism, and minerals offer a variety of avenues to develop and launch global businesses. Finally, the supportive government initiatives for foreign investments, such as tax breaks, subsidies, and monetary incentives, further facilitate entrepreneurial investment and international new venture development in Nepal.

To know more about Markets , click here:

https://brainly.com/question/30591900

#SPJ4

This morning, a very loud clap of thunder right outside your window startled you. For the rest of the day, any kind of loud sound—a car backfiring, a dropped dish—causes you to jump out of your chair. This is an example of

Answers

Question options :

A) sensory adaptation.

B) habituation.

C) associative learning.

D) sensitization.

Answer:

D) sensitization

Explanation:

sensitization in psychology occurs as a result of repetitive or excessive exposure to a particular stimulus. It happens when a person's neurological response to that particular stimuli is as a result of how the stimuli had affected him initially(secondary stimuli). For instance in the question here, the person responds to every other sound during the day because of his response to the thunder strike

how can you determine if the news is true or fake ? ​

Answers

Answer:

You can determine if news is fake by looking at the source , are the creators of the source apart of a group that wants change in something ? , does the site look sketchy, is the site popular , do the creators us proper spelling ? you can even look it up.

Explanation:

WILL GIVE BRAINLEST!
3) Write the expression: nine divided by the quantity x plus y. 9 CON A) X + Y X + Y B) 0 KIN 05 D DI MO

Answers

The expression "nine divided by the quantity x plus y" can be written as 9/(x + y).

In this expression, "x" and "y" represent variables or values that can be substituted into the expression. The quantity inside the parentheses, "x + y," refers to the sum of the variables "x" and "y." The division symbol "/" indicates that we are dividing the number 9 by the sum of "x" and "y."

By simplifying the expression, you can perform calculations or further manipulate it based on the context of the problem or equation you're working with.

Know more about expression here:

https://brainly.com/question/28170201

#SPJ11

"As the teen walked along the beach with his mother, he knew he had to tell her the truth. He realized she may never forgive him for the deception, but that she deserves to know. He thought that to recover her trust, he would need to demonstrate responsibility now for what he did and be honest about it." (5 points)

First person
Second person
Third-person limited
Third-person objective
Third-person omniscient

Answers

This is a third-person limited narrative sample. As a result, Option (C) is the appropriate response.

What is third-person limited?

When the narrator is an unidentified, unseen voice, the third-person limited narration is used. He or she will narrate the tale from his point of view and be able to discern the thoughts and feelings of all the characters.

The narrator is able to understand the emotions and ideas of other people based on the passage that is given. Inferring the mother's thoughts, he adds that "she may never forgive him for the deception." Readers can learn about the story from all of the perspectives due to this kind of narration.

Additionally, pronouns like "he," "she," and other similar forms are used to address every character.

Therefore, the correct choice is option (C).

Learn more about the third-person limited narration, from:

brainly.com/question/28919406

#SPJ1

Answer:

5. Third person omniscient

Explanation:

The passage is based on feelings

Hope this helps! :))

Excessive conflict can erode organizational performance becauseof:A.missed deadlines.B.indecision.C.lack of creativity.D.apathy.E.lack of teamwork.

Answers

Option (e), Excessive conflict can indeed erode organizational performance.

One of the ways in which excessive conflict can hurt organizational performance is by causing missed deadlines. When team members are focused more on fighting with each other than on getting their work done, they may fail to meet important deadlines and deliverables. This can have ripple effects throughout the organization, causing delays and bottlenecks that can hinder progress.

Another potential consequence of excessive conflict is indecision. When team members are in conflict, they may struggle to come to a consensus on important decisions. This can lead to delays and a lack of direction, which can hurt the organization's overall performance.

In addition, excessive conflict can also stifle creativity. When people are focused on arguing and defending their positions, they may be less willing to listen to new ideas or try out innovative approaches. This can lead to a lack of innovation and stagnation within the organization.

Apathy is another potential consequence of excessive conflict. When people are constantly fighting with each other, it can be demotivating and disheartening. This can lead to a lack of engagement and enthusiasm, which can hurt organizational performance.

Finally, excessive conflict can also lead to a lack of teamwork. When people are focused on their own interests and agendas, they may be less willing to collaborate and work together effectively. This can result in a breakdown of communication and coordination, which can hinder overall performance.

Learn more about organizational performance: https://brainly.com/question/28044123

#SPJ11

Other Questions
an uber-commissioned study claims the firms impact on the us economy tops $____________ a year. Renal failure will almost always result in the development ofbone disorders. Briefly describe the reasons for renalosteodystrophy. HELp please!!!!!!!!!!!!!!!!!!!!!!11 What is the role of government in supporting entrepreneurs? Two positive consecutive odd integers are such that the sum of their squares is 394. what is the second consecutive odd integer? Our voice is an instrument within our own bodies. True False how do i solve this please help me This is the pre-mRNA of a mammalian gene. Mark the splice sites, and underline the sequence of the mature mRNA. Assume that the 5' splice site is AG/GUAAGU and that the 3' splice site is AGGN. Use / to mark the 5'splice site(s) and to mark the 3' splice site(s). There may be more than one 5 site and 3 site. N means any nucleotide. (In this problem, there are no branch point As, polyY tracts or alternate splice sites. Problem from Voet, Voet & Pratt, Fundamentals of Biochemistry, 1999) Answer Format PLEASE MARK THE SPLICE SITES AS DEFINED ABOVE WITH THESE MARKS: 5'=/ and 3'=. UNDERLINE THE MATURE mRNA SEQUENCE ON THE PRE-mRNA SEQUENCE BELOW. DO NOT WRITE OUT THE mRNA SEQUENCE WITHOUT THE INTRONS. Your answer should look like this: NNNNAG/GUAAGUNNNNNNNNNNNAGGNNNNNNN exon / intron exon 5-AGCUUCGCGUAAAUCGUAGGUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAGGGCUUUGG ACCGAUAGAUGCGACCCUGGAGGUAAGUAUAGAUAAUUAAGCACAGGCAUGCAGGGAUAUCCU CCAAAUAGGUAAGUAACCUUACGGUCAAUUAAUUAGGCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAGGUAAGUCUGAU-3 Si comprimes un globo hasta reducir su volumen a un tercio de su valor originalcuanto aumenta la presion en su interior? In Frankenstein How is Elizabeth typical of other female characters of the Romantic Movement? Find the distance between the points.(-4,2), (-4,-5)The distance is _ . A pinch of salt hasapproximately 3.29x1021 formula units of NaCl. Howmany moles of NaCl are in a pinch of salt? A patient with a productive cough and parenchymal infiltrates on x-ray is demonstrating symptomology ofa. bacterial pneumonia.b. viral pneumonia.c. tuberculosis.d. acute respiratory distress syndrome 3. How did the Hays Code help studios and audiences? Please help I cant find the right answer for this question most cognitive psychologists recognize that there are two modes of thought. which term is used to denote an easier, everyday mode of thinking? find a piece of text evidence that shows where bilbo is shifting from wanting to go on the adventure to feeling would be better to stay at home Atoms of which elements form bonds without satisfying the octet rule?SCIENCE BTW Convert the following rectangular coordinates into polar coordinates. Always choose 0 Scientists theorize that impacts from comets caused proteins to form DNA. True or false and why Besides religion, which resources also cause conflict in the Middle East?Question 25 options:Solar EnergyWater and OilIrrigation Pumps and SedimentFarming Land and Crop Rotation