what kind of environment does wild rice grow best in?

Answers

Answer 1
gently flowing waters with a mucky or organic bottom and in areas with relatively stable water levels during the growing season.

Related Questions

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Regulating unconscious biological functions is a function of the __________. A. Medulla B. Pons C. Cerebrum D. Cerebellum.

Answers

Answer:

Regulating unconscious biological functions is a function of the medulla

Answer:

A. Medulla

Explanation:

Edge 2022

Regulating unconscious biological functions is a function of the __________. A. Medulla B. Pons C. Cerebrum

The condition which is known to have been caused by brain damage that might be moderated or reversed is referred to as what type of vegetative state?

Answers

Persistent

The condition which is known to have been caused by brain damage that might be moderated or reversed is referred to as persistent type of vegetative state.

What is persistent vegetative state?A coma is a severe or profound condition of unconsciousness, often known as persistent vegetative state. Brain death does not occur in persistent vegetative state. A person who is unconscious yet still conscious is unable to move or react to their surroundings.

What is considered to be a persistent vegetative state?According to our definition, a persistent vegetative state is one that develops one month after a traumatic or nontraumatic acute brain damage or that lasts for at least one month in patients with metabolic or degenerative diseases or congenital anomalies.

What is the duration of persistent vegetative state?After three months, a persistent vegetative state in adults and children with nontraumatic injuries might be regarded as irreversible; recovery does happen, but it is uncommon and, at best, is accompanied by moderate or severe handicap.

To learn more about persistent vegetative state visit:

https://brainly.com/question/10543007

#SPJ4

one intriguing biological hypothesis to explain schizophrenia is that the brains of people with the disorder may harbor either a biochemical imbalance or a abnormality.

Answers

One intriguing biological hypothesis to explain schizophrenia is that the brains of people with the disorder may have a biochemical imbalance or abnormality.

Schizophrenia is a complex psychiatric disorder characterized by a range of symptoms, including hallucinations, delusions, disorganized thinking, and social withdrawal. While the exact cause of schizophrenia is still not fully understood, researchers have proposed various biological hypotheses to explain the disorder.

One hypothesis suggests that schizophrenia may be associated with a biochemical imbalance in the brain. This imbalance involves neurotransmitters, which are chemical messengers that transmit signals between brain cells. Specifically, abnormalities in the dopamine and glutamate systems have been implicated in schizophrenia. It is believed that an overactivity of dopamine or dysfunction in glutamate signaling can contribute to the symptoms observed in individuals with schizophrenia.

Overall, the hypothesis of a biochemical imbalance or abnormality in the brain provides a framework for understanding the biological basis of schizophrenia. However, it is important to note that schizophrenia is a complex and multifactorial disorder, and other factors such as genetic, environmental, and psychosocial influences also play a role in its development and progression. Further research is needed to fully elucidate the underlying mechanisms and develop effective treatments for schizophrenia.

Learn more about biological here

https://brainly.com/question/15562516

#SPJ11

What term is used to describe the crust and uppermost part of the mantle?

Answers

The LITHOSPHERE is the rocky outer part of the earth , is is made up of the brittle crust an top of the mantle.

Answer:

Answer down below!

Explanation:

The term is called the Asthenospehere. The Lithosphere is the layer of air surrounding it.

Hope this helps!

What is “the cloud”? Topic: Digital Technology.

Answers

Answer: Cloud computing technology gives users access to storage, files, software, and servers through their internet-connected devices: computers, smartphones, tablets, and wearables. Cloud computing providers store and process data in a location that's separate from end users.

Centrioles are cell structures involved primarily in

Answers

Answer:

In the cell, centrioles aid in cell division by facilitating the separation of chromosomes. For this reason, they are located near the nucleus. Apart from cell division, centrioles are also involved in the formation of cilia and flagella and thus contribute to cell movement.

Explanation:

PLEASE MARK ME AS BRAINLIEST

In the cell, centrioles aid in cell division by facilitating the separation of chromosomes. For this reason, they are located near the nucleus. Apart from cell division, centrioles are also involved in the formation of cilia and flagella and thus contribute to cell movement.

which part of the dna nucleotide determines genetic characteristics?

Answers

Nitrogenous bases store the genetic info in DNA

name the vertebral projection oriented in a median plane.

Answers

Answer: The vertebral projection oriented in a median plane is called the spinous process

hope this helped!

The vertebral projection oriented in a median plane is called the spinous process. The spinous process is a bony projection that extends posteriorly from the vertebral arch in the midline of the spine. It is a prominent structure that can be felt and seen along the back when running fingers down the spine.

The spinous process serves several important functions. Firstly, it provides attachment points for muscles and ligaments that support and stabilize the spine.

Various muscles and tendons attach to the spinous processes, helping to maintain proper posture and allowing for movements of the spine. The spinous processes also serve as points of origin and insertion for muscles involved in movement and support of the back.

Additionally, the spinous processes contribute to the protection of the spinal cord and the nerves that branch off from it. Together with the vertebral arches and the vertebral bodies, the spinous processes help to form the vertebral canal, which houses and protects the spinal cord. They also contribute to the structural integrity of the spine, assisting in load-bearing and shock absorption.

The size and shape of the spinous processes vary along the length of the spine. In the cervical (neck) region, the spinous processes are generally short and bifid (split into two branches), allowing for better movement and flexibility of the neck. In the thoracic (chest) region, the spinous processes are relatively long and point downward, overlapping with the spinous processes of the adjacent vertebrae.

In the lumbar (lower back) region, the spinous processes are typically shorter and more robust, providing attachment points for the powerful muscles of the lower back.

To know more about the spinous process:

https://brainly.com/question/6957757

#SPJ6

to increase the number of cell in an organism what need to happen to a single cell

Answers

It needs to go through CELL DIVISION

how many different types of trna are there each with a unique anticodon

Answers

A cell contains a wide variety of tRNAs, each of which has a unique anticodon and corresponding amino acid. In fact, depending on the species, there are typically 40 to 60 multiple kinds.

The ribosome's codons, where tRNAs bind, are where amino acids are delivered to be added to the protein backbone.

tRNA isoacceptor groups are determined by the variety of tRNAs carrying various anticodons. These 51 tRNA types are organized into groups that correspond to the 21 amino acid residues. There are various amounts of isoacceptor groups for each amino acid.

Transfer RNA, also known as tRNA or soluble RNA, is a converter molecule made of RNA that is typically between 76 and 90 nucleotides long (in eukaryotes)

Learn more about “Transfer RNA   ” visit here;

https://brainly.com/question/278398

#SPJ4

The two major components of the Earth's atmosphere are _____ and _____.

oxygen
carbon dioxide
nitrogen
water vapor

yall can c h a t here :)


If you think you are too small to make a difference,
try sleeping with a mosquito. -Dalai Lama.

Answers

Answer:

nitrogen

oxygen

Explanation:

Answer:

Los principales gases que la componen son: el oxígeno (21 %) y el nitrógeno (78 %)

Explanation:

What are some ways to prevent the spread of zebra mussels?.

Answers

Zebra mussels are the invasive species of the molluscan phylum and are freshwater organisms. Proper washing and cleaning of the boats and vessels should be done.

What is the effect of the Zebra mussels?

Zebra mussels are invasive and non-native species that spreads very quickly in the water bodies. There increased population affects the native species of the water bodies as it affects the food resources.

Some of the ways by which the spreading of the mussels can be prevented are by washing the boats and the vessels before reentering them in other water bodies. Another way is to dispose of the water containing baits and catches on lands instead of emptying them into other water sources.

Therefore, the spreading of zebra mussels can be prevented.

Learn more about zebra mussels here:

https://brainly.com/question/9371236

question 92 51) which of the following large biological molecules will self-assemble into a bilayer when mixed with water? a) proteins b) triacylglycerols c) cellulose d) phospholipids

Answers

The large biological molecule that will self-assemble into a bilayer when mixed with water is phospholipids.

Phospholipids are the large biological molecule that will self-assemble into a bilayer when mixed with water. The main feature of a phospholipid is the presence of two hydrophobic fatty acid chains and a hydrophilic head.

These molecules are amphipathic, with a polar (charged) hydrophilic head and nonpolar hydrophobic tail. They can self-assemble into a bilayer due to the hydrophobic effect when mixed with water. The correct option is d) phospholipids.

Learn more about biological

https://brainly.com/question/28584322

#SPJ11

which of the following choices describes the role of hydrochloric acid in protein digestion?

Answers

Hydrochloric acid plays a crucial role in protein digestion by denaturing proteins and activating pepsinogen.

In the stomach, hydrochloric acid (HCl) is secreted by specialized cells called parietal cells. Its main function in protein digestion is to denature proteins, which involves breaking down their tertiary structure and unraveling them. This denaturation exposes the peptide bonds in the protein, making them more accessible for enzymatic cleavage.

HCl also plays a role in activating pepsinogen, an inactive precursor enzyme secreted by chief cells in the stomach. When HCl is present, it converts pepsinogen into its active form called pepsin. Pepsin is a proteolytic enzyme that breaks down proteins into smaller peptides by cleaving peptide bonds.

Additionally, HCl creates an acidic environment in the stomach, which helps to provide an optimal pH for the activity of pepsin and other enzymes involved in protein digestion.

Overall, hydrochloric acid is essential in protein digestion as it denatures proteins, activates pepsinogen into pepsin, and creates an acidic environment necessary for proper protein breakdown.

Know more about protein digestion here:

https://brainly.com/question/6211547

#SPJ11

many proteins are secreted from the cell following the process of translation. list two organelles involved in protein secretion, and briefly explain their contributions.

Answers

many proteins are secreted from the cell following the process of translation.the two organelles involved in protein secretion and their contribution are  The rough endoplasmic reticulum modifies the proteins. The Golgi apparatus is involved in sorting, modifying, and packaging proteins. Vesicles transport the proteins to the plasma membrane and release them from the cell.

The endoplasmic reticulum is, in essence, the transportation system of the eukaryotic cell, and has many other important functions such as protein folding. It is a type of organelle made up of two subunits – rough endoplasmic reticulum, and smooth endoplasmic reticulum.here the Golgi apparatus, also known as the Golgi complex, Golgi body, or simply the Golgi, is an organelle found in most eukaryotic cells. Part of the endomembrane system in the cytoplasm, it packages proteins into membrane-bound vesicles inside the cell before the vesicles are sent to their destination.

to know more about Golgi apparatus click here

brainly.com/question/12233980

#SPJ4

Why is air temperature above land warmer than the air temperature above water in the same location during the summer?

Answers

Answer:

Sea breezes happen during the hot, summer days due t the unequal heating rate of land and water

Explanation:

Solar heating of the Earth’s surface is uneven because land heats faster than water, and this causes air to warm, expand and rise over land while it cools and sinks over the cooler water surfaces.

hope it is useful

testable question?
hypothesis?

independent variable?
dependent variable?
three controlled variables:

Answers

During an experiment, the researcher asks a question that can be tested to answer it. The researcher makes a hypothesis to explain what is expected to occur, and what is the relationship between variables.  

Note: Since I could not find the complete question, I will provide definitions of the exposed terminology as a guide for you to find the answers.

What are testable question, hypothesis, and variables?

Testable questions are the questions the researcher makes before conducting an experiment, and for which there is no answer yet.

It is a question the investigator can test to find its answer.

The hypothesis is a prediction the researcher makes as a potential explanation of what is going on or what is expected to occur. It expresses a direct relationship between the involved variables.

There are three types of variables in an experiment,

Independent variables are the ones that affect or influence other variables. The researcher modifies these variables on purpose to observe the changes they produce in other variables.

Dependent variables are the ones affected by all the changes in the independent variables. They also change as the independent variable is modified.

Controlled variables are all the other variables in which the researcher is not interested. They must be controlled and kept constant because they might affect the results.

You can learn more about testable questions, hypothesis, and variables at

https://brainly.com/question/6139379

https://brainly.com/question/11032489

https://brainly.com/question/3434920

https://brainly.com/question/1479694

https://brainly.com/question/17344045

#SPJ1

Which chemical is a compound ?
A. Hydrogen
B. Helium
C. Nitrogen
D. Hydrochloric acid

Answers

Answer:

It is D

Explanation:

All A,B, and C are a element so D.

The answer is D, Hydrochloric acid.


-Hydrogen (H), a colourless, odourless, tasteless, flammable gaseous substance that is the simplest member of the family of chemical elements.
- Helium is a chemical element with symbol He and atomic number 2.
-Nitrogen is an element, not a compound. It is found in nature as nitrogen gas, also called dinitrogen, with the chemical formula N2 , and makes up 78% of the atmosphere.

Biological characteristics determine __________, while __________ is socially constructed.

Answers

Answer:

Biological characteristics determine sexuality while sex is socially constructed.

Explanation:

I hope it's help.

Next > Pretest: Organization of Organisms Su Drag each tile to the correct location. Match the characteristics to the correct phylum. organisms lack symmetry adult forms are sessile organisms have specialized stinging cells two types of body plans exist-polyp and medusa organisms obtain food by filtering water phenomenon of alternation of generation is observed Cnidaria Porifera​

Next > Pretest: Organization of Organisms Su Drag each tile to the correct location. Match the characteristics

Answers

Answer:

Cnidaria

Organisms have specialized stinging cells

→ Two type of body plans exist - polyp and medusa

Porifera

→ Organisms lack symmetry

→ Adult forms are sessile

→ Organisms obtain food by filtering water

→ Phenomenon of alternation of generation is observed.

Explanation:

Cnidaria, also known as the coelenterata, is a phylum of mostly marine animals having about 9,000 living species. Some of them include the corals, hydras, jellyfish, sea anemones, sea whips, etc. They possess specialized cells known as cnidocytes ( also known as “stinging cells”).  These cells can seen around the mouth and tentacles cnidarian. They immobilize their prey with toxins. These Cnidaria have two body plans and which are polyp and medusa.

The phylum Porifera are known as the pore bearers. It has about 5000 species. Their adult forms are sessile. They live permanently attached to rocks. They can under alternation of generation. They possess no organs in their bodies. Also, they lack symmetry. They can be referred t as filter feeders because they obtain food by filtering water.

How do you pronounce the full scientific name of DDT?

Answers

The full scientific name of this chemical compound is quite lengthy, like most scientific compound names..

(Dichlorodiphenyltrichloroethane)

The easiest way to pronounce it is to use this

dahy-klawr-oh-dahy-fen-l-trahy-klawr-oh-eth-eyn

I need help on this ASAP!! Cellular respiration and photosynthesis

I need help on this ASAP!! Cellular respiration and photosynthesis

Answers

Answer:

1 and 3

Explanation:

What is an antibiotic? Which class of antibiotics works best for Bordetella pertussis?

Answers

You can download answer here

tinyurl.com/wpazsebu

What characteristics of an electromagnetic can be controlled by varying currents of electricity? Explain in detail.

Answers

Answer:

Strength and quantity.

Explanation:

Strength and quantity of electromagnetic can be controlled by currents of electricity because it depends on the electric current. Electromagnets is to be controlled by controlling the electric current. If the current is turn on, also turns the magnetic field on while on the other hand, If the current is turn off, also turn off the magnetic field. The quantity of current flowing through the coil can also control the strength of the electromagnetic field around that coil.

The transformation of a human from one to several billion cells requires the process of?

Answers

The transformation of a human from one to several billion cells requires the process of mitosis. Mitosis helps in growth and repair by producing more number of identical cells.

Mitosis helps in genetic stability through spindle assembly checkpoint (SAC), the main checkpoint in mitosis, it becomes active and keeps acting until each chromosome is properly attached to the mitotic spindle, ensuring faithful segregation of the chromosomes. Mitosis is primarily involved in the division of the parent cell to produce two identical daughter cells. Mitosis divides the nucleus of the cell along with its chromosomes into two daughter cell nuclei, each inheriting the same chromosome number as its parent cell. It is primarily involved in growth.

To learn more about Mitosis, here

https://brainly.com/question/26678449

#SPJ4

Draw the structures of the precursors to (r)-2-methylbutanenitrile, including stereochemistry, for this synthesis

Answers

The structure of the (r)-2-methyl-butane nitrile is attached below.

Butyronitrile is a colorless liquid with a sharp choking odor. Used as pharmaceutical intermediate chemical and poultry medicine. Nitriles are organic compounds in organic chemistry, also called cyano compounds. This class of organic compounds contains cyanide as a functional group with the formula -C ≡ N. Inorganic compounds with -CN groups are called cyanides. Nitriles are organic chemicals containing a cyano functional group (subunit) CN- in which carbon and nitrogen atoms share a triple bond. H. C≡N-. The general formula for nitriles is RCN, where R is an organic group. 

Learn more about the nitrile in

https://brainly.com/question/29376772

#SPJ4

Draw the structures of the precursors to (r)-2-methylbutanenitrile, including stereochemistry, for this

Does someone know the answer to this question? Having difficulties on it.

Does someone know the answer to this question? Having difficulties on it.

Answers

Based on the diagram above which shows a model of the water cycle, letter X represents: A. the water table.

What is a water cycle?

A water cycle is also referred to as hydrologic cycle and it can be defined as a biogeochemical process that is used to describe the continuous movement of water on land, in the atmosphere, and below the surface of planet Earth.

In Science, a water table is also referred to groundwater table and it simply describes the topmost portion of the underground zone on planet Earth that is usually saturated with water.

Based on scientific research and experiments, we can reasonably infer and logically deduce that the water table is represented by letter x in this diagram which shows a model of the water cycle

Read more on water cycle here: brainly.com/question/267126

#SPJ1

Complete Question:

The diagram below shows a model of the water cycle. Letters A through F represent some processes of the water cycle. Letter X indicates the top of the underground zone that is saturated with water.

What does letter X represent?

answer choices

the water table

a flood plain

sea level

impermeable rock

what dose the Sixth and Ninth commandment ask us to do?​

Answers

Answer: To not take a life and to not lie

Explanation: The sixth commandment tells us to not take a life. And the ninth commandment tells us to not lie/ bare false witness.

Hope this helps! Please mark me brainliest!

as pressure increases in lymphatic capillaries, fluid is allowed to regurgitate back into the tissues, true or false?

Answers

True. The lymphatic capillaries are very thin-walled vessels that transport lymph (a clear fluid containing immune cells and waste products) from the interstitial spaces of tissues back into the bloodstream. The capillaries have one-way valves that prevent the backflow of lymph, but they can be overwhelmed by high pressure within the capillaries.

What happens If the pressure in the lymphatic capillaries increases?

If the pressure in the lymphatic capillaries increases, due to increased volume or decreased drainage capacity, the one-way valves may not be able to close completely, and fluid can regurgitate back into the tissues. This can result in the accumulation of interstitial fluid and edema (swelling), which can cause discomfort and impair tissue function.

The regurgitation of fluid back into the tissues can also occur if the lymphatic vessels are damaged or removed, such as during surgery, radiation therapy, or infection. In such cases, the lymphatic system may be unable to drain fluid effectively, leading to chronic edema and tissue damage.

To know more about lymph, visit:

https://brainly.com/question/29894403

#SPJ1

Other Questions
Please help I don't understand! How much simple interest is earned in 9 months on a deposit of $7,000 at 4%simple interest. (Hint I=Prt where P is in dollars, r is the rate as a decimal, and t istime in years.) * which of these planets is Earth explain your answer Problem Print Ama groundhog really? Well, no but I've always felt a connection to Punxsulawney Phil because my birthday is on February 2nd, the same day folks watch to see if Punxsutawney Phil sees his siadow!! had fun connecting what I know about geometry to use my height, Phil's height and my shadow length to find what the length of Phil's shadow would be at the same time of day Here's the information I used Phil's height = 51.2 cm Suzanne's height = 5'4" Suzanne's shadow length at Gobbler's Knob = 762 cm 34" 51.2 em 76.2cm Question: What did I find as the length of Phil's shadow? The digit 3 in which number represents a value of 3 tens? Choose 1 answer:A. 732.9 B. 6,300C. 8.35 Will give brainliest if your rightA scientist conducts an experiment to observe the half-life period of the radioactive element barium. He starts the experiment with 200 grams of barium and records the mass at the end of every thirteen day. After how many days is the mass of barium closest to 1.5 grams? Rewrite the following sentences changing all singulars into plural.the child broke his tooth solve for k k/6 = 4/3 if four times of a number is added to seven the result is 92 -3(3 - 10x) please help, distributive property. The Lake Grove Corporation pays employees on the first day of each month for the hours they worked in the prior month. If Lake Grove has a December 31 year-end and the total of all employee hours worked in December was $63,000, then the adjusting journal entry at year-end would include:Debit Wages Payable for $63,000Credit to Wages Expense for $63,000Debit to Wages Expense for $63,000Credit to Cash for $63,000 in this scene from the drama Antigone, how does Sophocles use a historical and virtual setting to establish the conflict and develop characters? in your response, cute textual evidence and specific dramatic elements to support your analysis Auslogic registry Cleaner ?One paragraph Summary of the utilityDid you discuss the primary importance and use of the software?Your evaluation of the utilityThis includes a short narrative to answer each of the questions:Was it easy to install?Did you find the utility easy to use?Any problems?Was the utility worth your use? A limit of 10 scenes can be added to a tour. simplify 5to the negative power of 3 Why were the Europeans and Americans so keen to gain influence in China during the 19th century? Need help ASAP.... what is number 8Also #9And 10-14 Swola Company reports the following annual cost data for its single product. Normal production level 75,000 units Direct materials $ 1.25 per unit Direct labor $ 2.50 per unit Variable overhead $ 3.75 per unit Fixed overhead $ 300,000 in total This product is normally sold for $25 per unit. If Swola increases its production to 200,000 units, while sales remain at the current 75,000 unit level, by how much would the company's income increase or decrease under variable costing Ricky is testing soil for a contaminant at a building site,He'll take action to stop construction if there's strongevidence that the soil has more than 400 parts permillion (ppm) of the contaminant. He plans on using soilfrom n = 30 randomly selected locations at the buildingsite. His hypotheses are H, :p < 400 ppm andH:u > 400 ppm, where u is the mean amount of thecontaminant in the soil at this site,Suppose that in reality, H, is actually true,Which situation below would result in the lowestprobability of a Type Il error? identify whether the given pairs of events in a roulette game are mutually exclusive. Drag the items on the left to the correct location on the right.mutually exclusive events1 to 12 and rednot mutually exclusiveevents1 to 12 and 25 to 361 to 18 and oddblack and redeven and black