A patient who receives oxygen via the transtracheal method experiences increased oxygen efficiency and reduced side effects. This method involves a direct administration of oxygen into the trachea.
In the transtracheal method, a small catheter is inserted through a stoma (a surgically created opening) in the patient's trachea, bypassing the upper airway. This approach allows for a more efficient delivery of oxygen, as it directly reaches the lungs, reducing the required oxygen flow rate.
Consequently, patients may experience fewer side effects such as nasal irritation, dryness, or nosebleeds. Additionally, this method allows for increased mobility and comfort, as patients do not need to wear a nasal cannula or mask. However, it's essential to maintain proper hygiene and care for the stoma site to prevent complications like infection. It is important to note that transtracheal oxygen therapy is not suitable for everyone, and a healthcare professional should evaluate its appropriateness on an individual basis.
Know more about the trachea here:
https://brainly.com/question/32152455
#SPJ11
8.96 rounded to the nearest hundredth
Answer:
8.96
Explanation:
Trick question (the hundredths place is bolded) there is no number in the thousandths place (behind the 6) to be rounded.
Tetrodotoxin (TTX) and botulinum toxin (BTX) are two neurotoxins that causes paralysis. What is(are) the underlying mechanism(s)? a) Both block the voltage-gated Na+ channels to inhibit the firing of
Tetrodotoxin (TTX) and botulinum toxin (BTX) are two neurotoxins that cause paralysis. The underlying mechanisms are given below:a) Both block the voltage-gated Na+ channels to inhibit the firing of action potentials.
Both tetrodotoxin (TTX) and botulinum toxin (BTX) block voltage-gated Na+ channels to inhibit the firing of action potentials, which results in paralysis. Tetrodotoxin (TTX) is a potent neurotoxin that is found in pufferfish, whereas botulinum toxin (BTX) is produced by the bacteria Clostridium botulinum.
Both neurotoxins inhibit the release of neuro transmitters from nerve endings in muscles. TTX inhibits the release of acetylcholine (ACh) by blocking voltage-gated Na+ channels in the axons of nerve cells that supply the muscles. Botulinum toxin (BTX) prevents the release of ACh from nerve endings by blocking the docking of vesicles containing ACh with the plasma membrane of the nerve ending. As a result, muscle contraction is prevented, leading to paralysis.
To know more about neurotoxins visit:
https://brainly.com/question/13050036
#SPJ11
Overfishing causes the yellow perch population in the food
web in the diagram to decrease.
Otter
Terrapin
Osprey
Blue
crab
Algae
Snail
Yellow
perch
Shrimp
Cord grass
Which population is most likely to decrease as a result?
Answer:
otter
Explanation:
Answer:
Otter
I hope it helps
Explanation:
2. In unicorns, having a
white horn (W) is dominant
to having a brown horn (w).
Two heterozygous unicorns
are crossed.
What is the probability that
the offspring will have a
white horn?
Please help!!!
Answer:
75%
Explanation:
Heterozygous means that there is two different alleles, one being dominant, while the other is a recessive trait (Ww).
As stated in the question, it is noted that the dominant allele is denoted as a capital W, while a recessive allele is denoted as a lowercase w.
Two heterozygous unicorns are crossed. Create a Punnett Square. The probability for the offspring would be found within the Punnett Square.
\(\left[\begin{array}{ccc}&W&w\\W&WW&Ww\\w&Ww&ww\end{array}\right]\)
Remember, having the dominant trait (W) would result in the offspring obtaining a white horn. In this case, 3 of the 4 offspring has at least one dominant allele (W), or a 75% probability.
75% is the probability that the offspring will have a white horn.
~
Learn more about the Punnett Square, here:
https://brainly.com/question/27984422
This is the pre-mRNA of a mammalian gene. Mark the splice sites, and underline the sequence of the mature mRNA. Assume that the 5' splice site is AG/GUAAGU and that the 3' splice site is AG\GN. Use / to mark the 5'splice site(s) and \ to mark the 3' splice site(s). There may be more than one 5’ site and 3’ site. N means any nucleotide. (In this problem, there are no branch point A’s, poly Y tracts or alternate splice sites.
Here is the marked pre-mRNA with splice sites (/ and ) and underlined mature mRNA sequence:
5'-AGCUUCGCGUAAAUCGUAG/GUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAG\GGCUUUGG ACCGAUAGAUGCGACCCUGGAG/GUAAGUAUAGAUAAUUAAGCACAG\GCAUGCAG/GGAUAUCCU CCAAAUAG\GUAAGUAACCUUACGGUCAAUUAAUUAG/GCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAG\GUAAGUCUGAU-3'
In the given pre-mRNA sequence, we are instructed to mark the splice sites and underline the sequence of the mature mRNA. The splice sites are indicated by the symbols "/" and "", representing the 5' and 3' splice sites, respectively.
Analyzing the sequence, we can identify the locations where the splice sites occur. The 5' splice site is indicated by "AG/GUAAGU" and the 3' splice site is indicated by "AG\GN". Since there may be more than one 5' and 3' splice site, we need to mark all the occurrences.
After marking the splice sites, we underline the sequence of the mature mRNA. The mature mRNA is formed by removing the intron sequences, which lie between the splice sites. In this case, the underlined sequence represents the mature mRNA after splicing. The 5' splice site(s) is marked with a forward slash (/), and the 3' splice site(s) is marked with a backslash ().
The underlined sequence represents the mature mRNA after splicing. In this case, the underlined sequence is:
5'-AGCUUCGCGUAAAUCGUAGGUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAGGCUUUGG ACCGAUAGAUGCGACCCUGGAGGUAAGUAUAGAUAAUUAAGCACAGGCAUGCAGGGAUAUCCU CCAAAUAGGUAAGUAACCUUACGGUCAAUUAAUUAGGCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAGGUAAGUCUGAU-3'
This represents the mature mRNA sequence after removing the intron sequences between the splice sites.
To learn more about pre-mRNA, here
https://brainly.com/question/30583590
#SPJ4
assume the scales of sunfish can be dark (dd), intermediate (dd), or light (dd). if a pond contains 325 dark, 130 intermediate, and 195 light sunfish, how many light sunfish would be expected for the population to be in hardy-weinberg equilibrium?
There will be 104 light sunfish expected for the population to be in Hardy-Weinberg equilibrium.
The Hardy-Weinberg equation enables us to foretell which of them they are. It is feasible to determine p since p = 1 - q and q is known. When p and q are known, it is easy to enter these numbers into the Hardy-Weinberg equation (\(p^{2}\) + 2pq + \(q^{2}\) = 1). This then gives the population's projected frequencies for each of the three genotypes for the chosen characteristic.
In this equation, \(p^{2}\) is the population's anticipated frequency of homozygous dominant individuals (AA), 2pq is the population's predicted frequency of heterozygotes (Aa), and \(q^{2}\) is the population's predicted frequency of homozygous recessive individuals (AA).
Because they lack the dominant characteristic, homozygous recessive individuals, or \(q^{2}\) in the equation, are typically the only ones whose frequency can be determined from observations of phenotypes. Either homozygous dominant (\(p^{2}\)) or heterozygous individuals might exhibit the characteristic in their phenotypic (2pq).
Learn more about the Hardy-Weinberg equilibrium here:
https://brainly.com/question/1365714
#SPJ4
What were the theories for why the moths were changing color?
Genetic Changes
Moths passed their color to the next generation. Eggs from light moths developed into light moths and dark moth eggs turned to dark adults. The dark color was caused by a mutation in the DNA of a single moth, and the mutated gene had been passed to all its offspring.
Answer:
In 1850 There were 23 light moths for each dark one whereas in 1900 the ratio is one light to 23 dark. Thus, if natural selection was responsible for the change in population, according to Darwin's theory, dark moths must have been better adapted to their environment. Gosh humans are destroying the ecosystem.
Why don’t most other types of bacteria produce ulcers?
Choose the best explanation as to why both consumers and producers perform cellular respiration.
Although they may obtain their sugars in different ways, both consumers and
producers rely on cellular respiration to make ATP.
Cellular respiration is a process that both consumers and producers engage in to produce energy for their metabolic processes in the form of ATP (adenosine triphosphate).
Cellular respirationCells release energy through a process called cellular respiration, which breaks down organic molecules like glucose to power cellular functions including growth, movement, and reproduction.Cellular respiration takes place in the cells of consumers, like animals, to break down the organic molecules they eat, including proteins, lipids, and carbs, into smaller molecules that can be utilized to produce ATP. The animal's body temperature, mobility, and other activities are maintained by using this energy to drive cellular operations.Along with photosynthesis, cellular respiration also takes place in the cells of producers like plants.Although photosynthesis is the main way that plants make energy, it does not meet all of their needs; as a result, they also need to engage in cellular respiration in order to manufacture ATP for their cellular functions.Therefore, cellular respiration is a crucial activity in the functioning of living creatures and is carried out by both consumers and producers as a necessary way to generate energy and carry out their metabolic activities.learn more about cellular respiration here
https://brainly.com/question/14158795
#SPJ4
I'm not sure?what it is and im stuck
Answer:
I think it is letter c.
Explanation:
Botulism and tetanus are caused by bacterial endospores commonly found in the soil.
a. True
b. False
Endospores are only found in the environment and are not medically relevant. Endospores can exist in the environment for indefinite periods of time.
Endospores resist boiling and therefore steam must be used to destroy endospores present in food. Endospores can be formed by any genus of bacteria. A bacterial endospore is a structure formed within a bacterium that is resistant and dormant. The purpose of endospores is to protect the bacterium from poor or unfavorable conditions that make it difficult for it to survive. The spores are also resistant to heat and chemicals that would otherwise kill other bacteria. Endospores transmit infectious diseases such as anthrax, tetanus, gas gangrene, botulism, and pseudomembranous colitis to humans. inside the bacteria. They are highly resistant, designed to ensure survival and preserve genetic information under environmental stress.
To learn more about Endospores please click on below link
https://brainly.com/question/13237072
#SPJ4
How is an atom of the metal calcium, which is in group 2 and period 4, most likely to attain a full outermost energy level of electrons?
The atom will share two electrons with another atom to form a covalent bond.
The atom will steal two electrons from another atom to become a +2 ion.
The atom will steal six electrons from other atoms to have a total of eight electrons in its outermost energy level.
The atom will allow its two outermost energy level electrons to be stripped away, resulting in a cation with a charge of +2.
An atom of the metal calcium, which is in group 2 and period 4, will most likely to attain a full outermost energy level of electrons by allowing its two outermost energy level electrons to be stripped away, resulting in a cation with a charge of +2 which is therefore denoted as option D.
What is an Element?This is referred to as a chemical substance that cannot be broken down into other substances.
Elements in group 2 will donate its electron to the other element so as to achieve a stable octet configuration resulting in a cation with a charge of +2 thereby making it the correct choice.
Read more about Element here https://brainly.com/question/6258301
#SPJ1
during exhalation, the ribs become depressed as the intercostal muscle relax - this the lung volume decreases which increases the alveolar pressure. what does this cause
Answer:
The correct answer will be option A.
Explanation:
Exhalation is a mechanism of breathing which exhales out the gases from the lungs to the atmosphere.
During the exhalation process the thoracic volume decreases which decrease the lung volume. This decreases alveolar volume. Due to this decrease in alveolar volume the intra- alveolar pressure increases above atmospheric pressure up to +2 cm of H₂O which results in the release of the gas or air out of the lungs.
Thus, option A is the correct answer.
3 ways how each of the atmosphere, lithosphere and hydrosphere can be damaged by environmental pollutants
The three ways by which the atmosphere, lithosphere, and hydrosphere can be damaged are pollutant emissions, particulate matter, and combustion appliances.
How may environmental pollutants harm the lithosphere, hydrosphere, and atmosphere?Solid, liquid, and certain gases that are suspended in the air are the main contributors to air pollution. These gases and particles can come from factories, dust, pollen, mold spores, volcanoes, wildfires, and vehicle and truck emissions. Aerosols are solid and liquid particles that are suspended in our air.
Pollutant emissions into the atmosphere have the potential to alter the climate.While different types of particulate matter (PM) can either warm or cool the environment, ozone in the atmosphere warms the climate.Common causes of air pollution include motor vehicles, industrial operations, household combustion appliances, and forest fires. Particulate matter, carbon monoxide, ozone, nitrogen dioxide, and sulfur dioxide are pollutants of great public health concern.To know more about environmental pollutants and pollution, visit:
https://brainly.com/question/9522984
#SPJ9
comment on the number of white colonies on your plates: are they more abundant than blue colonies? what determines the ratio of white versus blue colonies on the plate?
To comment on the number of white colonies on your plates and compare their abundance to blue colonies, we need to consider the factors that determine the ratio of white versus blue colonies on the plate.
1. Observe the plates: Count or estimate the number of white and blue colonies present on each plate.
2. Compare the numbers: Determine if white colonies are more abundant than blue colonies by comparing the counts or estimates from step 1.
3. Analyze the determining factors: The ratio of white versus blue colonies on the plate may depend on factors such as the presence of specific selection markers, growth conditions, or genetic modifications in the organisms (e.g., bacteria) present on the plate. If white colonies represent organisms with a specific marker or gene, their abundance compared to blue colonies would depend on the frequency of that marker or gene in the population, as well as any selective pressure or growth advantage it may confer.
In summary, to comment on the abundance of white colonies compared to blue colonies on your plates, observe and compare the number of colonies of each color, and consider the factors that may determine their ratio, such as selection markers, growth conditions, or genetic modifications.
Learn more about genetic modifications
brainly.com/question/30432115
#SPJ11
Match the terms to their definition.
1 .
an animal or insect that is known to transmit a specific disease
immunization
2 .
vaccination, artificially stimulating antibodies to a disease
leukocyte
3 .
white blood cell
pathogenic
4 .
producing disease
vector
To understand how vaccines work, it helps to first look at how the body fights illness. When germs, such as bacteria or viruses, invade the body, they attack and multiply. This invasion, called an infection, is what causes disease. The immune system uses your white blood cells to fight infection. These white blood cells consist primarily of macrophages, B-lymphocytes and T-lymphocytes:
Macrophages are white blood cells that swallow up and digest germs, plus dead or dying cells. The macrophages leave behind parts of the invading germs called antigens. The body identifies antigens as dangerous and stimulates antibodies to attack them.
B-lymphocytes are defensive white blood cells; they can produce antibodies to fight off infection.
T-lymphocytes are another type of defensive white blood cell, that recognizes a familiar germ, if the body is exposed again to the same disease
The first time the body is infected with a certain germ, it can take several days for the immune system to make and use all the tools needed to fight the infection. After the infection, the immune system remembers what it learned about how to protect the body against that disease. If your body encounters the same germ again, the T-lymphocytes recognize the familiar germ and the B-lymphocytes can produce antibodies to fight off infection.
How Vaccines Work
Vaccines can help protect against certain diseases by imitating an infection. This type of imitation infection, helps teach the immune system how to fight off a future infection. Sometimes, after getting a vaccine, the imitation infection can cause minor symptoms, such as fever. Such minor symptoms are normal and should be expected as the body builds immunity.
Once the vaccinated body is left with a supply of T-lymphocytes and B-lymphocytes that will remember how to fight that disease. However, it typically takes a few weeks for the body to produce T-lymphocytes and B-lymphocytes after vaccination. Therefore, it is possible that a person infected with a disease just before or just after vaccination could develop symptoms and get that disease, because the vaccine has not had enough time to provide protection. While vaccines are the safest way to protect a person from a disease, no vaccine is perfect. It is possible to get a disease even when vaccinated, but the person is less likely to become seriously ill.
Types of Vaccines
Scientists take many approaches to developing vaccines. These approaches are based on information about the diseases the vaccine will prevent, such as how germs infect cells, how the immune system responds to it, regions of the world where the vaccine would be used, the strain of a virus or bacteria and environmental conditions. Today there are five main types of vaccines that infants and young children receive in the U.S.:
Live, attenuated vaccines fight viruses and bacteria. These vaccines contain a version of the living virus or bacteria that has been weakened so that it does not cause serious disease in people with healthy immune systems. Because live, attenuated vaccines are the closest thing to a natural infection, they are good teachers for the immune system. Examples of live, attenuated vaccines include measles, mumps, and rubella vaccine (MMR) and varicella (chickenpox) vaccine. Even though they are very effective, not everyone can receive these vaccines. Children with weakened immune systems—for example, those who are undergoing chemotherapy—cannot get live vaccines.
Non-live vaccines also fight viruses and bacteria. These vaccines are made by inactivating, or killing, the germ during the process of making the vaccine. The inactivated polio vaccine is an example of this type of vaccine. Often, multiple doses are necessary to build up and/or maintain immunity.
Toxoid vaccines prevent diseases caused by bacteria that produce toxins (poisons) in the body. In the process of making these vaccines, the toxins are weakened so they cannot cause illness. Weakened toxins are called toxoids. When the immune system receives a vaccine containing a toxoid, it learns how to fight off the natural toxin. The DTaP vaccine contains diphtheria and tetanus toxoids.
Subunit vaccines include only parts of the virus or bacteria, or subunits, instead of the entire germ. Because these vaccines contain only the essential antigens and not all the other molecules that make up the germ, side effects are less common. The pertussis (whooping cough) component of the DTaP vaccine is an example of a subunit vaccine.
Conjugate vaccines fight a type of bacteria that has antigens. These bacteria have antigens with an outer coating of
which of the following enzymes is important for inducing the acrosomal reaction? radio button unchecked choline acetyl-transferase radio button unchecked hyaluronidase radio button unchecked acrosin radio button unchecked corona radiatase radio button unchecked angiotensin converting enzyme
The enzyme that is important for inducing the acrosomal reaction is acrosin.
The acrosomal reaction is a process that occurs during fertilization, where the acrosome of the sperm cell releases enzymes to penetrate the egg's outer layer. Acrosin is an enzyme found in the acrosome of sperm cells and is essential for breaking down the outer layer of the egg.
Choline acetyl-transferase is an enzyme involved in the synthesis of the neurotransmitter acetylcholine. Hyaluronidase is an enzyme that breaks down hyaluronic acid, which is found in the extracellular matrix of animal tissues. Corona radiata is a layer of cells surrounding the oocyte. Coronary radiatase is not an enzyme but a term used to describe the process of removing the corona radiata layer of the oocyte by enzymes released from the acrosome during the acrosomal reaction.
To know more about enzyme , click here.
https://brainly.com/question/31385011
#SPJ4
study of the functions and activities performed by the body’s structures is called
The study of the functions and activities performed by the body's structures is called anatomy.
Anatomy is the branch of biology that deals with the study of the structure and organization of living organisms and their component parts. It encompasses the study of both macroscopic and microscopic structures, including the gross anatomy of major organ systems, the microscopic anatomy of cells and tissues, and the molecular anatomy of biomolecules and organelles. By understanding the anatomy of the body and how its structures are organized and function, scientists and healthcare professionals are able to better diagnose and treat diseases and injuries, as well as gain a deeper understanding of the basic mechanisms that sustain life. The study of anatomy has a long and rich history, with important contributions from ancient civilizations such as Greece and Egypt, and continues to be a critical field of inquiry in modern medicine and biology.
Learn more about Anatomy here:
https://brainly.com/question/21190730
#SPJ4
Which process would bacteria living near a heat vent on the ocean floor use it build carbon-based molecules, such as sugars?A. Light- independent reactions B. Cellular respiration C. Fermentation D. Chemosynthesis
'Chemosynthesis' basically is the process which a bacteria living near a heat vent on the ocean floor use to build carbon-based molecules, such as sugars.
What do you mean by Chemosynthesis?
Chemosynthesis is a process by which some organisms use chemical energy to produce carbohydrates. This process occurs in environments where sunlight is not available, such as deep-sea hydrothermal vents. Organisms such as bacteria and other microbes convert chemicals such as hydrogen sulfide and methane into energy, which they use to produce organic molecules such as glucose.
The bacteria living near hydrothermal vents on the ocean floor use chemosynthesis to build carbon-based molecules, such as sugars, from the hydrogen sulfide and other chemicals that are spewed from the vent. The bacteria use the energy from the chemical reaction to form carbohydrates from the chemical reaction, which are then used as a source of energy for the bacteria. This process is thought to be the first form of energy production for life on Earth, and is seen as an important part of the global carbon cycle.
Hence, option D is correct.
To know more about Chemosynthesis,
https://brainly.com/question/16322013
#SPJ4
Imagine you crossed a smooth-haired Bashkir horse with a curly-haired Bashkir horse. How could you determine the possible outcomes of this cross?
Answer:
To determine the possible outcomes of crossing a smooth-haired Bashkir horse with a curly-haired Bashkir horse, you need to know the inheritance pattern of the curly hair trait in this breed. If a single gene determines the trait with two alleles (curly and straight), the Punnett square can be used to predict the possible genotypes and phenotypes of the offspring.
Assuming that the curly hair trait is dominant over the smooth hair trait and that both parent horses are heterozygous for this trait (Cc for the curly-haired horse and cc for the smooth-haired horse), the Punnett square would look like this:
See attachment:
So, there is a 50% chance that the offspring will have curly hair (either CC or Cc genotype) and a 50% chance that the offspring will have smooth hair (cc genotype).
To confirm the actual genotypes and phenotypes of the offspring, a test cross can be performed by breeding the offspring with a homozygous recessive individual (cc). This would reveal the genotype of the offspring by the ratio of curly to smooth-haired offspring. If all offspring have curly hair, then they must be homozygous dominant (CC); if they have both curly and smooth hair, then they must be heterozygous (Cc); and if all offspring have smooth hair, then they must be homozygous recessive (cc).
Explanation:
Tee wants to win a blue ribbon at the fair this year for the largest tomato plants. He would like to compare two new plant foods on his tomato plants to see if they really make the plants grow larger. Tee needs to design an experiment to see which plant food works better. He has three of the same type of tomato plant and they all receive the same
amount of sunlight and water, and are kept at the same temperature. Tee adds Miracle Grow to plant A, Kate’s Fertilizer to plant B, and he lets plant C grow without any plant food. He measures the growth of the plants every week.
A. What is the independent variable? (1 pt)
B. What is the dependent variable? (1 pt)
C. What would the control group be? (1 pt)
Independent variable is the variable that is changed or manipulated in a series of experiments while the dependent variable is the outcome measured to see the effectiveness of the treatment.
Control group in an experiment is the group of test subjects left untreated or unexposed to some procedure and then compared with treated subjects in order to validate the results of the test.
According to this question, Tee compared two new plant foods on his tomato plants to see if they really make the plants grow larger. He designed an experiment to see which plant food works better.
He has three of the same type of tomato plant and they all receive the same amount of sunlight and water, and are kept at the same temperature (control variables).
The independent variable is the type of plant food used while the dependent variable is the growth of plant.
Learn more about independent variable at: https://brainly.com/question/1479694
#SPJ1
A digestive enzyme turns starch into sugar. This is an example of
A.larger molecules being broken down into smaller molecules.
B. liquid being absorbed and a solid being created.
с.smaller particles joining and forming a larger molecule.
D. a solid being dissolved by a liquid.
Answer:
(A)
Enzymes can break down nutrients into small, soluble molecules that can be absorbed. For example, amylase causes the breakdown of starch into simple sugars.
I hope this helps..
Answer:
A
Explanation:
Had to learn this in college
Please help!
10 points, it’s quick!
I will appreciate it
Question is:
Does friction affect the motion of an object and why?
you would like to see if the gene that you are studying in mouse has a homolog in humans. to do this you decide to do a southern blot. you believe the gene sequence will be not be highly conserved. therefore, you would like to select conditions to hybridize your probe with low stringency to find as many candidates as possible. which condition will you use? select one: a. olignucleotide probe of longer length b. olignucleotide probe of shorter length
For low stringency hybridization in a Southern blot to find as many candidates as possible, an oligonucleotide probe of shorter length would be used.
In a Southern blot, the goal is to identify whether a specific gene sequence is present in the DNA being analyzed. Low stringency conditions are used to allow for less stringent binding requirements between the probe and the target sequence, increasing the chance of detecting related sequences with lower similarity. In this scenario, since it is believed that the gene sequence is not highly conserved between mouse and humans, selecting an oligonucleotide probe of shorter length would be more appropriate. Shorter probes tend to have lower specificity and can hybridize to a broader range of sequences, increasing the likelihood of detecting potential homologs in humans with less sequence conservation.
Learn more about stringency here:
https://brainly.com/question/33276194
#SPJ11
Not all organisms have ______________________ like amoeba and parasites.
Answer:
Same characteristics.
Explanation:
Not all organisms have same characteristics like amoeba and parasites. Amoeba is a unicellular organism in which a single cell perform all necessary functions of life while many other organisms are multicellular in which different cells perform different functions in the body. Amoeba act as parasite because it cause disease in humans and take benefits from it but there are many beneficial organisms such as bacteria also present in human body which helps in digestion of food.
Michael wants to test the effect of stomach acid concentration on the solubility of a particular oral medication. Which experimental design setup would best help him answer his question?
Prepare solutions of different acid concentrations, measure 50 mililiters of each into different beakers, and place the same type of pill of the same mass into the beakers
Explanation:
The experiment design setup that would best help him is preparing solutions of different acid concentrations, measuring 50 milliliters of each into different beakers, and placing the same type of pill of the same mass into the beakers. The correct option is B.
What is stomach acid?Stomach acids are the acid that is present in the stomach. These acids help in the process of digestion. Different acids dissolve different food items. These acids only help in digestion, but do to affect the walls of the stomach or other organs.
Michael is performing an experiment on acids in the stomach by the solubility of oral medication. He should perform by taking different acids on separate beakers to see the different reactions of medication on the acids.
Thus, the correct option is B. Prepare solutions of different acid concentrations, measure 50 milliliters of each into different beakers, and place the same type of pill of the same mass into the beakers.
To learn more about stomach acid, refer to the link:
https://brainly.com/question/8836658
#SPJ6
The question is incomplete. Your most probably complete question is given below:
Allow several pills to soak in different amounts of acid of a single concentration, and then measure the amount of dissolution on each.
Prepare solutions of different acid concentrations, measure 50 milliliters of each into different beakers, and place the same type of pill of the same mass into the beakers.
After allowing a pill to be exposed to one acid concentration, place it in different acid concentrations, and then measure the surface area that is dissolved.
Prepare solutions of different acid concentrations, measure 50 milliliters of each into different beakers, and place different types of pills of the same mass into the beakers.
According to the cladogram, which of the following is the derived characteristic shared by amphibians and reptiles? jaws bony skeleton lungs
Answer:
c
Explanation:
i just did it!
Answer:
c
Explanation:
i don't really know
How weathering, erosion, and deposition constantly change Earth’s surface and landforms?
Answer:
Withering, erosion, and deposition is constantly changing earth’s surface because the system is constantly breaking away slowly and transferring little bits of rock, dirt or other objects to different places.
Explanation:
I’ve had this question before.
When you eat plants like lettuce, the energy that you get originally came from
A
a windmill.
B
nuclear fusion.
C
the sun.
D
a cow.
Answer:
C.the sun has heat energy which can be transferd to plants
Explanation:
The picture below shows a typical structure of....
A:cell membrane
B:ribosome
C:lysosome
D: cell wall
I would answer with A. cell membrane
I know it's not B. ribosome for a fact