what is the sum of 4 and its additive inverse

Answers

Answer 1

Answer:

0

Step-by-step explanation:

additive inverse means any number to make the sum zero. in this case 4 +(-4)=0

Answer 2

Answer: The sum is 0.

Step-by-step explanation:

If two numbers are additive inverses of each other, they add up to 0. So the sum of 4 and its additive inverse, which is -4, is 0.


Related Questions

Select all that apply Which of the following are characteristics of frequency tables? Multiple select question. They can be used for qualitative data. They can be used for quantitative data. No observation can fit into more than one class. The percentage of observations in each class is provided.

Answers

Answer:

They can be used for quantitative dataThey can be used for qualitative data.No observation can fit into more than one class

Step-by-step explanation:

The frequency table refers to the number of times the event occurs and lists the items shown by value and thus is quantitative and qualitative such as graphs and numerical summary.

The following are characteristics of frequency tables:

They can be used for qualitative dataThey can be used for quantitative data.No observation can fit into more than one class

A frequency is the number of times a particular event, category or value occurs. A Frequency table is a grouping or table that lists qualitative data into classes showing the number of observations or occurrence of items or data in each class.

organize raw data into the readable datadisplays the frequency of various outcomes of the sample.count of occurrences of that outcome used for qualitative as well as quantitative data.

Thus, the correct answer is -

They can be used for qualitative dataThey can be used for quantitative data.No observation can fit into more than one class

Learn more about frequency distribution:

https://brainly.com/question/12635271

3 x 2 = 48 what does x equal.

Answers

Answer:

uhm what? from how it looks its a multiplucation sign and 3 x 2 isnt 48 is 6 but 2 times 24 IS 48 and 3 times 16 IS 48

Step-by-step explanation:

Answer:

x = 8

Step-by-step explanation:

3 · x · 2 = 48

3 · 2 = 6

48 ÷ 6 = 8

3 · 8 · 6 = 48

If someone could help me out on these two questions that would be great! ( will mark brainliest if optional )

If someone could help me out on these two questions that would be great! ( will mark brainliest if optional
If someone could help me out on these two questions that would be great! ( will mark brainliest if optional

Answers

Answer:

1.  x = 47°

2.  c = 47°

Step-by-step explanation:

Question 1

Triangle DEF is an isosceles triangle since it has two sides of equal length.

The two equal sides are called the legs and the angle between them is called the vertex angle.  Therefore, the vertex angle of ΔDEF is ∠D.

The side opposite the vertex angle is called the base (EF) and base angles are equal:

⇒ m∠F = m∠E

⇒ x = 47°

Question 2

Triangle STU is an isosceles triangle since it has two sides of equal length.

The two equal sides are called the legs and the angle between them is called the vertex angle.  Therefore, the vertex angle of STU is ∠T.

The side opposite the vertex angle is called the base (SU) and base angles are equal.

As the interior angles of a triangle sum to 180° and the base angles are equal:

⇒ m∠S + m∠T + m∠U = 180°

⇒ c + 86° + c = 180°

⇒ 2c = 94°

⇒ c = 47°

determine the sine and cosine of 90 degrees

Answers

\(\begin{gathered} \text{From the graph} \\ \sin e\text{ (90)=1} \\ co\sin e\text{ (90)=0} \\ The\text{ cosine and sine of 90 is }\mleft(0,1\mright) \end{gathered}\)

What is the perimeter of quadrilateral ABCD?
O 15 units
O 17 units
O 18 units
o 20 units

Answers

Answer:

The perimeter of the quadrilateral ABCD is 20 units.

As, There are 4 angles in the quadrilateral.None of the 3 above options are the perimeter.

a group of fifth graders collected 46 cans of food to donate to three food banks. If each food bank is get an equal number of cans, how many cans do the each receive

Answers

Answer:

about 15.3.

Step-by-step explanation:

46 divided by 3. ig

Use differentiation and/or integration to express the following function as a power series (centered at ).
f(x)=1/((6+x)^2)
[infinity]
f(x)=∑ _________
n=0

Answers

We start by using the quotient rule to find the first derivative of f(x):

f'(x) = -(2(6+x))/((6+x)^2)^2 = -2/(6+x)^3

Next, we can use the formula for the geometric series with ratio r = -(x-(-6))/(-6) = (x+6)/6:

1/(6+x)^3 = (-1/6)(x+6)(-1/6)^n = (-1/6) * [(x+6)/6]^n

Therefore, we have:

f(x) = (-1/6) * [(x+6)/6]^n

Substituting in the value of n, we get the power series representation of f(x):

f(x) = (-1/6) * [(x+6)/6]^n = (-1/6) * [(x+6)/6]^0 + (-1/6) * [(x+6)/6]^1 + (-1/6) * [(x+6)/6]^2 + ...

Simplifying, we get:

f(x) = 1/36 - (x+6)/216 + (x+6)^2/1296 - (x+6)^3/7776 + ...

Therefore, the power series representation of f(x) centered at  is:

f(x) = ∑ (-1/6) * [(x+6)/6]^n, n = 0 to infinity

f(x) = 1/36 - (x+6)/216 + (x+6)^2/1296 - (x+6)^3/7776 + ...

To know more about integration refer here

https://brainly.com/question/31324730

SPJ11

2.8 -3x =12.1 −6x what's x

Answers

X= 3.1 is the answer
The answer is X=3.1!

A person is measuring for new carpet in an auditorium. the angle of elevation from the front to back is 12 degrees and the last row is 15 feet higher than the front row. what is the straight line distance from the front seat to the back? round to the nearest tenth

Answers

The straight line distance from the front seat to the back is approximately 69.7 feet.

What is a straight line distance?

Straight line distance refers to the shortest distance between two points in a straight line, as opposed to the distance that would be traveled along a curved path or following the contours of the terrain.

Let the distance from the front row to the back row be x.

Then, we can use the tangent function to find the height difference between the front and back rows:

tan(12°) = (height difference) / x

Solving for the height difference:

height difference = x * tan(12°)

The problem tells us that the height difference is 15 feet, so we can set up an equation:

15 = x * tan(12°)

Solving for x:

x = 15 / tan(12°) ≈ 69.7 feet

Therefore, the straight line distance from the front seat to the back is approximately 69.7 feet.

Learn more about straight line distance here : brainly.com/question/28604717

#SPJ1

The Perez family went out to dinner. The price of the meal was $39.75. The sales tax was 7% of the price of the meal. The tip was 15% of the meal and the sales tax. How much money did the Perez family pay for the meal, including tax and tip?

Answers

Answer:

$48.91

Step-by-step explanation:

100% is 1 so 7% would be 0.07

times $39.75 by 0.07 to get the amount the tax would add which is $2.78

then add the two $39.75 + $2.78 = $42.53

then remove the tip which as we saw earlier convert the 15% to 0.15

times $42.53 by 0.15 to get the amount the tip would add which is $6.38

then add $6.38 to the total amount which would be $48.91


Alvin picked up a part time job processing medical bills for
a nearby clinic. He earns $0.72 for each bill he processes.
If he processes 80 bills today, how much will he earn?

Answers

80 x .72 = $57.60
Easy peasy

Sal and Jen went to the store together, and each bought the same car stereo.

Sal used a card to make the purchase, and the full amount was immediately withdrawn from his bank account.

Jen used a card to make the purchase, and she received a bill within 15 days of the purchase. She paid $21.30 for the next 18 months until the bill was paid in full. The full payment included $58.60 in interest.

Which statement describes Sal’s purchase?

Answers

Answer: Sal used a debit card and paid a total of $324.80 for the stereo. (I took the test too)

Step-by-step explanation: Multiply $21.30 by 18 months. Then subtract the interest, $58.60, from the product because Sal paid immediately with a card which implies using a debit card. You get $324.80.

can u help pls like pls

can u help pls like pls

Answers

Answer:

E. 16

Step-by-step explanation:

Easy:

Formula: P=2(l+w)

Plug in and solve:

P=2(3+5)

P = 16 (Option E is correct)

The answer is option E 16cm

PLEASE HELP ASAP!

Directions: Define one variable (you may NOT use two), translate into ONE equation

and solve the equation to answer the question. If the scenario has two

unknowns, define the second unknown in-terms of the defined variable.

You may use a calculator.

-------

You are investing your money in two types of stock, CI and AM.

You have $1400 to invest over 5 years. After 5 years, the AM stock

doubles and the CI stock triples in value making your stock worth

$3300, how much did you invest in each type of stock?

Answers

Answer:

AM = 900

CI = 500

I have to be honest, this is the most ridiculously worded question of this type that I have ever seen... ask you teacher, why it was so important to force you to solve it using only one variable?

Step-by-step explanation:

(AM) + (1400-AM) = 1400

2(AM) + 3(1400 - AM) = 3300

2AM + 4200 -3AM = 3300

-AM = -900

AM = 900

CI = 500

What is (-i)^6? I need help please....

Answers

Answer:

Step-by-step explanation:

-i= -i

-i^2= 1

-i^3= -i * 1 = -i

-i^4= 1 * (-1)  = -1

-i^5= -i

-i^6= 1

Answer: -1

Step-by-step explanation:

If f varies inversely as x, and y= 2 when x= 2, find y when x= 1

Answers

The value of y is 4.

What is an inverse function?

The inverse function of a function f in mathematics is a function that reverses the operation of f. If f is bijective, then and only if it is, the inverse of f exists.

Here, we have

Given: If f varies inversely as x, and y= 2 when x= 2, find y when x= 1.

We have to find the value of f.

f ∝ 1/g

f₁ ×g₁ = f₂ ×g₂

Let the required value of f = x and g = y

Inserting in equation (1) and we get

2 ×2 = 1 ×y

4 = y

Hence, the value of y is 4.

To learn more about the inverse function from the given link

https://brainly.com/question/30351075

#SPJ1

Find the value of x.

Find the value of x.

Answers

Answer:

x=17

Step-by-step explanation:

6x+33+45=180

6x+78=180

6x=102

x=17

x is equal to 17
x = 17

Which expression is equivalent to 3^3 + 2^2
a.6^5
b.(3x3)+(2x2)
c.5^5
d.(3 • 3 • 3) + (2 • 2)

Answers

Answer:

d.

3^3 = 3×3×3

2^2 = 2×2

(3×3×3)+(2×2)

"
The irregular component of a time series is caused by cyclical
or seasonal patterns in the data
true or false
"

Answers

The statement "The irregular component of a time series is caused by cyclical or seasonal patterns in the data" is false.

The irregular component of a time series is not caused by cyclical or seasonal patterns in the data. The irregular component represents the random or unpredictable fluctuations in the data that cannot be attributed to any specific pattern or trend. It is also referred to as the residual or random component.

Cyclical patterns refer to longer-term oscillations in the data that are not of fixed frequency or duration. They often reflect economic cycles or other long-term trends. Seasonal patterns, on the other hand, are shorter-term patterns that repeat at fixed intervals within a year, such as quarterly or monthly variations. These patterns are typically associated with regular seasonal factors or events.

The irregular component is the part of the time series that remains after accounting for the systematic components, such as trend, seasonality, and cyclical variations. It captures the random fluctuations, measurement errors, and other unpredictable factors that cannot be explained by the identified patterns.

Therefore, the irregular component of a time series is not caused by cyclical or seasonal patterns. Instead, it represents the residual variability that is not accounted for by the systematic components of the time series.

To learn more about time series refer here:

https://brainly.com/question/29818565

#SPJ11

Solve the equation for all values of x.
(22 – 16)(2x2 + 49) = 0
Help please

Answers

Answer:

7i/sqrt(2)

Step-by-step explanation:

so, if I understand correctly, the equation is

(22-16)(2x² + 49) = 0

6(2x² + 49) = 0

that automatically means

2x² + 49 = 0

2x² = -49

x² = -49/2

x = sqrt(-49/2)

a square root of a negative number has no real solution. the solution is in the world of complex and imaginary numbers, which bases on the sqrt(-1) = i.

so, we get

x = sqrt(49/2 × -1) = (7/sqrt(2)) × I = 7i/sqrt(2)

A store is having a sale where everything is just kind of 30%. Find the discount in the sales price of the customer buys an item that normally sells for $365.

Answers

Answer:

New price: $255.50

Step-by-step explanation:

First you multiply 365x.30

Then you'll get 109.5

Sub that from 365 and you'll get $255.50

365
365 x 0.70
255.5$

How many yards for 15 uniforms?

Answers

Answer: For fabrics with a nap and/or one-way designs, add 1/4 yard for each yard specified. For plaids, add the length of one plaid repeat for each yard specified.

Step-by-step explanation:

14. The maximum capacity for seating in a theater is 500 people. The theater sells two types of
tickets, adult tickets for $7.25 each and child tickets for $4 each. If they sold out on a certain
showtime and made a total of $3,157 in ticket sales, how many of each type of ticket was sold for
that showtime?

Answers

Taking into account the definition of a system of linear equations, the amount of adult tickets sold is 356 and the amount of child tickets sold is 144.

System of linear equations

A system of linear equations is a set of two or more equations of the first degree, in which two or more unknowns are related.

Solving a system of equations consists of finding the value of each unknown so that all the equations of the system are satisfied. That is to say, the values ​​of the unknowns must be sought, with which when replacing, they must give the solution proposed in both equations.

Amount of ticket sold

In this case, a system of linear equations must be proposed taking into account that:

"x" is the amount of adult tickets sold."y" is the amount of child tickets sold.

The maximum capacity for seating in a theater is 500 people. If they sold out on a certain showtime, this is represented by x+y=500.

On the other side, the theater sells two types of tickets, adult tickets for $7.25 each and child tickets for $4 each and the made a total of $3,157. This is represented by 7.25x +4y=3157.

So, the system of equations to be solved is

\(\left \{ {{x+y=500} \atop {7.25x+4y=3157}} \right.\)

There are several methods to solve a system of equations, it is decided to solve it using the substitution method, which consists of clearing one of the two variables in one of the equations of the system and substituting its value in the other equation.

In this case, isolating the variable x from the first equation you get:

x=500 - y

Substituting this expression in the second equation you get:

7.25× (500 -y) +4y=3157

7.25×500 - 7.25y +4y=3157

3625 - 7.25y +4y=3157

- 7.25y +4y=3157 -3625

-3.25y= -468

y= (-468)÷ (-3.25)

y= 144

Substituting this value in the expression x=500 - y you get:

x=500 - 144

x=356

Remembering that "x" is the amount of adult tickets sold and "y" is the amount of child tickets sold, you get that the amount of adult tickets sold is 356 and the amount of child tickets sold is 144.

Learn more about system of equations:

brainly.com/question/14323743

brainly.com/question/1365672

brainly.com/question/20533585

brainly.com/question/20379472

please answer the math question below

please answer the math question below

Answers

The total surface area is π[(4/3)x]² + π(4/3)x². The area of the base is greater than the lateral area.

What is an equation?

An equation is an expression that shows how numbers and variables are related using mathematical operations. Equations can be linear, quadratic, cubic and so on.

Given the cone. The surface area (SA) is given by the equation:

SA = πr² + πrs

where r is the radius of the cone and s is the slant height.

Given that the slant height is x and the radius of the cone is 4/3 the slant height = (4/3)x

Hence:

SA = πr² + πrs

The base area =  πr²; Lateral area = πrs

substituting:

The base area = π[(4/3)x]², the lateral area =  π(4/3)x²

Hence:

SA = π[(4/3)x]² + π(4/3)x²

The area of the base is greater than the lateral area.

Find out more on equation at: https://brainly.com/question/2972832

#SPJ1

On the grid below, draw a right triangle with vertices at E (2,2), F(2,8), and G(10,8). Find the lengths of these three sides. If necessary, round to the nearest tenth

Answers

Answer:

The lengths of the sides are 6, 8 and 10.

Step-by-step explanation:

The vertices of a right angles triangle are E (2,2), F (2,8), and G (10,8)

The distance between the two points is

\(d=\sqrt{(x_{2}-x_{1})^2+(y_{2}-y_{1})^2}\)

So, the lengths of the sides are

\(EF=\sqrt{(8-2)^2+(2-2)^2} = 6 \\\\FG=\sqrt{(8-8)^2+(10-2)^2} = 8 \\\\GE=\sqrt{(8-2)^2+(10-2)^2} = 10 \\\)

What value of x will make these two expression equivalent?

-3/7 and x/21
A X=-3 B x=7 Cx=9 Dx=-9

Answers

Answer:

D.  x = -9

Step-by-step explanation:

We want -(3/7) = (x/21)

Cross multiply:  7x = - 63

x = - 9

Check:

Does (-9/21) = -(3/7)?

(-9/21) reduces to -(3/7)   YES

D because you would cross multiply 7 and x which would give u -63 making x = -9. -9/21 simplifies down to -3/7.

Find the distance d between 21 = (-1+ 8i) and z2 = (-3 – 2i).Express your answer in exact terms and simplify, if needed.d=

Find the distance d between 21 = (-1+ 8i) and z2 = (-3 2i).Express your answer in exact terms and simplify,

Answers

The rule of the distance between two points is

\(d=\sqrt[]{(x_2-x_1)^2+(y_2-y_1)^2}\)

Since the given points are

\(z_1=(-1,8i),z_2=(-3,-2i)\)

Then, let

\(\begin{gathered} x_1=-1,x_2=-3 \\ y_1=8i,y_2=-2i \end{gathered}\)

Substitute them in the rule above

\(\begin{gathered} d=\sqrt[]{(-3-\lbrack-1\rbrack)^2+(-2i-8i)^2} \\ d=\sqrt[]{(-3+1)^2+(-10i)^2} \\ d=\sqrt[]{(-2)^2+(100i)^2} \end{gathered}\)

Remember i^2 = -1, then

\(\begin{gathered} d=\sqrt[]{4+(100i^2)} \\ i^2=-1 \\ d=\sqrt[]{4+100(-1)} \\ d=\sqrt[]{4-100} \\ d=\sqrt[]{-96} \end{gathered}\)

Make the negative number represented by i

\(\begin{gathered} d=\sqrt[]{96}\times\sqrt[]{-1} \\ \sqrt[]{96}=4\sqrt[]{6},\sqrt[]{-1}=i \\ d=4\sqrt[]{6}i \end{gathered}\)

The distance between z1 and z2 is

\(d=4\sqrt[]{6}i\)

2. A printing machine makes 240 books
in 30 hours. Written as a unit rate,
what is the speed at which the printing
machine makes books?
Answer quick plzzz

Answers

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer: 8 books/ hour

Explanation:

240 / 30 = 8 books/ hour

I hope this helped!

<!> Brainliest is appreciated! <!>

- Zack Slocum

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer:

8 books

Step-by-step explanation:

durjddndndnfnenfdndndnfn

hope this helps!

GIVING BRAINLIEST PLEASE HELP!!!

Answers

please give me the brainliest.

Answer:

help you with what?

Step-by-step explanation:

How much is 2/7

of 1 3/4?


3/49

1/2

1 3/14

8/49

Answers

Step-by-step explanation:

\( = \frac{2}{7} \times 1 \frac{3}{4} \)

\( = \frac{2}{7} \times \frac{7}{4} \)

\( = \frac{14}{28} \)

\( \: \)

\( = \frac{14 \div 14}{28 \div 14} \)

\( = \frac{1}{2} \)

Other Questions
how did the american death system work at that time? were there changes to our system after the event? Where is the styloid process wrist? Which cost will increase or decrease with increase in production? A. Marginal Cost B. Fixed Vost C. Fnancial Cost D. All of the Above cul es el primer mes del invierno? cul es el tercer mes del otoo? cul es el segundo mes de la primavera? cul es el primer mes del ao? cul es el octavo mes del ao? cul es el quinto mes del ao? cul es el dcimo mes del ao? cul es el segundo mes del verano? cul es el tercer mes del invierno? cul es el sexto mes del ao? What is the polar form of the equation?x^2 + (y-1)^2 =1 I need to know m 1=m 2= Explain how to use the graph to write an equation to model the gums height. Be sure to identify the pattern of the points in your explanation, and identify the values of a and k. review the timeline of computers at the old computers website. pick one computer from the listing and write a brief summary. include the specifications for cpu, memory, and screen size. now find the specifications of a computer being offered for sale today and compare. did moores law hold true?' What does each of the four historical definitions of art reveal how people thought about where the truth is to be found? How did Micheal Jackson Die?? How do you evaluate a function. What role did Toussaint Louverture play in the 1791 slave revolt that started the Haitian Revolution? WILL GIVE BRANLIEST !Case #28104Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Part TwoCopy the DNA sequences for each suspect into a Word document.Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQuestionsAnswer these following questions in the essay box below.1. Which suspect most likely committed the robbery?2. How do you know? What was one of the Han dynasty's major achievements? O A. Opening trade on the Silk Road O B. Attacking European countries C. Installing running water in all homes D. Inventing electricity Three-fifths of all people in a room havecellphones. If there are 35 people in theroom, how many have cellphones? the population proportion of college students that stated, if given a choice, they would prefer to start their own business rather than work for someone else is 72%. assume you collected a random sample of 100 students and 78 stated they would prefer to start their own business rather than work for someone else, what is the sample proportion? (give your answer as a decimal and round to two decimal places.) during december, maxum company sold 3,900 units of a product that carries a 60-day warranty. december sales for this product total $130,000. the company expects 10% of the units to need warranty repairs, and it estimates the average repair cost per unit will be $18.' Prepare any necessary adjusting entries at December 31, 2013, for Maxum Companys year-end financial statements for each of the above separate transactions and events. Use quadratic formula to find the solutions to the quadratic equation 2x^2-3x+6=0 Please help. 36.In football, a touchdown is awarded 6 points and the team can then try fora point after a touchdown.a. Write an expression that describes the number of points scored ontouchdowns T and points after touchdowns p by one team in a game.b. If a team wins a football game 27-0, write an equation to represent the possiblenumber of touchdowns and points after touchdowns by the winning team.c. If a team wins a football game 21-7, how many possible number of touchdownsand points after touchdowns were scored during the game by both teams? sovereignty is a principle of international relations that holds that final authority over social, economic, and political matters should rest with the legitimate rulers of independent states. t/f