Stimulating a receptor has an immediate result. Option number four is the most accurate. When a receptor is stimulated, the cell will experience a change in its membrane potential.
This change can then bring about a modification of the receptor's shape. This adjusted shape thusly can influence the receptor's capacity to answer further stimulation.
The changes can likewise prompt a decline in the force of the improvement or make the receptor unresponsive.
In this way, the prompt consequence of animating a receptor is an adjustment of layer potential, which can eventually prompt changes in the receptor's shape, a reduction in the power of the improvement, and a decline in the responsiveness of the receptor.
Learn more about the receptors:
https://brainly.com/question/11985070
#SPJ4
Which statement about diamond is correct? - Each carbon atom is bonded to three other carbon atoms in a single layer - Each carbon atom is bonded to four other carbon atoms - Layers of carbon atoms with no covalent bonds between the layers - Carbon ions held together by strong electrostatic forces - Pairs of carbon atoms with no covalent bonds between the molecules
Answer: option b
each carbon atom is bonded to four other carbon atoms creating a rigid and compact structure.This makes diamond the hardest known substance
Explanation:
i hope it will help you
what type of bonds hold the nitrogenous bases together in dna
Answer:
Glycosidic bondExplanation:
The glycosidic bond in DNA is the nitrogen-carbon coupling in between the 9′ nitrogen of purine bases (Adenine/Guanine) or the 1′ nitrogen of pyrimidine bases (Cytosine/Thymine) as well as the 1′ carbon of the deoxyribose sugar group. The synthesis of nucleoside arises from the binding of the nitrogenous base to the deoxyribose sugar via N-glycosidic linkage.
pls pls pls pls pls pls pls pls pls pls pls pls pls pls pls pls
Answer:
B
Explanation:
Uracil replaces thymine so when you translate it you put each bases pair so for RNA uracil would replace adenine and guanine would replace cytosine.
Answer:
bbbbbbbbbbbbbbb
Explanation:
b
b
b
b
b
b
Please answer thanks
grass goes first then insects then Meerkats
briefly explain natural selection
Answer:
Explanation:
Natural selection is the process through which populations of living organisms adapt and change. Individuals in a population are naturally variable, meaning that they are all different in some ways. This variation means that some individuals have traits better suited to the environment than others.
10. in humans, the rh factor is inherited as a dominant gene (r). individuals with this allele are referred to as rh positive. two (2) heterozygous individuals (rr) decided to reproduce
75% of the offspring would be Rh positive (RR or Rr) and 25% would be Rh negative (rr).
When two heterozygous individuals with the dominant rh factor gene (r) reproduce, there is a 75% chance that their offspring will be rh positive (rr or Rr genotype) and a 25% chance that their offspring will be rh negative (rr genotype). This is because each parent has a 50% chance of passing on the dominant r allele, and if both parents pass it on, the offspring will be rh positive. However, if both parents pass on the recessive r allele, the offspring will be rh negative. It is important to note that being rh positive or rh negative has implications for blood transfusions and pregnancy, as an rh negative individual can have an adverse reaction to rh positive blood or the fetus of an rh positive mother if proper precautions are not taken.
Hi! I'd be happy to help with your question. In humans, the Rh factor is inherited as a dominant gene (R). Individuals with this allele are referred to as Rh positive. When two heterozygous individuals (Rr) decide to reproduce, the possible genotypes of their offspring would follow a Punnett square with the following distribution:
- RR (Rh positive): 25%
- Rr (Rh positive): 50%
- rr (Rh negative): 25%
So, 75% of the offspring would be Rh positive (RR or Rr) and 25% would be Rh negative (rr).
Learn more about offspring here:-
https://brainly.com/question/26287597
#SPJ11
Why are temperatures more moderate around the fall & spring equinoxes?
Answer:
Explanation:
Neither end of Earth's axis is tilted toward the Sun.
Two short-tailed cats are bred together. They produce three kittens with long tails, five short tails, and two without any tails. a. From these results, how is tail length in these cats inherited? b. Write out the genotypes paired with the matching phenotypes for the offspring to support your answer.
Answer:
a) Cats show incomplete dominance which means the kitten can be born with full length tails, short length tails and without tails.
b) The genotype of the parent will be heterozygous (Tt ) and the kittens will be:
Genotype | Fenotype
-TT | (long tail)
-Tt | (short tail)
-tt | (no tail).
What are sigins of anxiety?????
Give two of them
ty
and don't give links as answers .
How many stages of development take place in incomple metamorphosis? A.two B.three C.four D.five
Answer: isnt it C. four
Explanation:
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
What is the maximum volume of blood that can be collected form a 110-lb donor, including samples for processing? A 450mL. B 500mL. C 525mL. D 550mL
The maximum volume of blood that can be collected from a 110-lb donor, including samples for processing, is typically limited to around
c. 525mL, or slightly less than 2 pints called maximum blood volume
This is known as the "maximum blood volume" or "maximum blood draw" limit, and it is established to minimize the risk of adverse effects, such as lightheadedness, fainting, or low blood pressure. The maximum blood volume is calculated based on various factors, including the donor's weight, height, and overall health. The amount of blood that can be collected also depends on the specific procedures being performed, as well as the presence of any underlying medical conditions that may affect the donor's ability to tolerate the blood draw. Overall, it is important to follow established guidelines and protocols when collecting blood from donors to ensure the safety and well-being of the donor.
Learn more about maximum blood volume here:
https://brainly.com/question/30328660
#SPJ4
Someone please help me wit thisss ! i’ll give brainlist
Answer:
1. Carbohydrates - provide immediate burst of energy - monosacharrides
2. Lipids - provide source of energy - glycerol or fatty acids
3. Proteins - provide growth and development for our body - amino acids
4. Nucleic Acids - store and pass on genetic information - nucleotides
Create a scavenger hunt in your backyard or local park. Get together a team of four other people and break them into two groups. Have them complete the scavenger hunt. How creative were they in completing each part? How did their perceptions differ from each other in order to complete each task in the hunt? 75 points also
Which of the following is NOT a part of MALT (mucosa-associated lymphoid tissue)?
A. lymph nodes
B. tonsils
C. appendix
D. Peyer's patches
The correct answer is A. Lymph nodes are not a part of MALT. MALT, or mucosa-associated lymphoid tissue.
It is a type of specialized tissue found in mucous membranes throughout the body, including the respiratory, digestive, and urogenital tracts. It plays a vital role in the immune system, providing a first line of defense against invading pathogens. The tonsils, appendix, and Peyer's patches are all examples of MALT. The tonsils are located in the throat and help to trap and remove bacteria and viruses.
The appendix is found in the lower right abdomen and is believed to play a role in the immune system. Peyer's patches are found in the small intestine and are responsible for detecting and eliminating harmful microorganisms. Understanding the components of MALT is important in understanding how the immune system functions to protect the body from infection and disease.
Learn more about Lymph nodes here:
https://brainly.com/question/29829253
#SPJ11
what is the main neurotransmitter used by preganglionic neurons in the autonomic nervous system?
The main neurotransmitter used by preganglionic neurons in the autonomic nervous system is acetylcholine (ACh).
Preganglionic neurons are the first set of neurons in the autonomic nervous system, and they originate in the spinal cord or brainstem and synapse onto ganglionic neurons in the autonomic ganglia. At these synapses, preganglionic neurons release ACh, which binds to nicotinic acetylcholine receptors on the postganglionic neurons.
This causes a depolarization of the postganglionic neuron and the subsequent release of either ACh or another neurotransmitter, such as norepinephrine or epinephrine, depending on the specific division of the autonomic nervous system involved.
Learn more about neurotransmitter
https://brainly.com/question/9725469
#SPJ4
A student wants to know the effect a mutation might have on a species' survival. The change causes a rabbit to have mottled brown fur. The student runs a computer simulation for ten generations. What possible conclusions can you draw? Choose ALL that apply
Answer:
A) Evolution occurred because the allele frequency changed over time.
C) The rabbits with mottled brown fur have a selective advantage that gives them more camouflage from predators.
E) The mutation had a positive effect, allowing those rabbits with the mottled brown fur to survive and reproduce better than those with the brown or white fur.
Explanation:
Based on the data, you can conclude:
Evolution occurred because the allele frequency changed over time.
The rabbits with mottled brown fur have a selective advantage that gives them more camouflage from predators.
The mutation had a positive effect, allowing those rabbits with the mottled brown fur to survive and reproduce better than those with the brown or white fur.
The possible conclusions that can be drawn are
evolution that occurred due to the allele frequency.Rabbits with mottled brown fur have a selective advantage.The mutation had a positive effect.What is mutation?The mutation is a change in the DNA sequence that results from the copying mistakes that tke place during the cell division and the exposure to the radiating agent, exposure to virus and chemicals also leads to the cases of gene mutation.
Find out more information about the mutation.
brainly.com/question/17031191
What factors do you think have contributed to the growing wolf populations?
Hope this helped, have a great day <3
Explain how the processes of photosynthesis and cellular respiration support the Law of Conservation of Mass.
Answer:
The relationship between photosynthesis and cellular respiration is such that the products of one system are the reactants of the other. Photosynthesis involves the use of energy from sunlight, water and carbon dioxide to produce glucose and oxygen. Cellular respiration uses glucose and oxygen to produce carbon dioxide and water.
Explanation:
3. The diversity of organisms present on Earth is the result of--
a.Ecosystem stability
b. Homeostasis
c. Direct harvesting
d. Natural Selection
BRAINLIEST TO HOWEVER GETS IT RIGHT :)
___ - When an organism has a heterozygous genotype, there is a chance that both gene features will show up in the offspring’s phenotype. That means both genes are equally dominant, or codominant.
What is the word that goes in the blank? I was thinking incomplete dominance but that was already used as a vocabulary word above, I’m a little confused.
Answer:
This type of relationship between alleles, with a heterozygote phenotype intermediate between the two homozygote phenotypes, is called incomplete dominance.
Answer:
specific genes, physical manifestation of a genetic trait
The energy found in the sugar started from the light energy and it was transformed to chemical energy. This statement shows the Law of what??
a.Conservation of energy or Thermodynamics
b.Centrifugal Force
c.Relativity
d.Perpetual motion
Kendra is studying the energy pyramid shown. Which statement is supported by the energy pyramid?
A) The ecosystem can support fewer foxes than grasshoppers.
What is energy pyramid?An energy pyramid is also called ecological pyramid. It is a graphical representation of the energy that are found within the trophic levels of an ecosystem. The largest level of the pyramid is the producers that is present at the bottom and the shortest level is present on the top of the pyramid which is tertiary consumer that have very low in population. This make the structure like a pyramid. We know that the size of the fox is bigger than grasshopper so more energy is needed by the fox which causes fewer foxes can survive in the ecosystem.
So we can conclude that the ecosystem can support fewer foxes than grasshoppers.
Learn more about energy here: https://brainly.com/question/13881533
#SPJ1
What are some differences of a protoctist cells and virus cells
Answer: Most protozoan-like protists are larger than bacteria. They are single- celled organisms, as are viruses and bacteria
Answer:
Protists such as algae and protozoans are microscopic eukaryotic organisms. Viruses are infectious agents of small size and simple composition that can multiply only in living cells of animals, plants, or bacteria.
Explanation:
Which model below shows a prokaryotic cells?
Answer:
Modle two as it is singular, simple with a flagellum
Explanation:
what is leucocytes?
Answer:White blood cells, also called leukocytes or leucocytes, are the cells of the immune system that are involved in protecting the body against both infectious disease and foreign invaders. All white blood cells are produced and derived from multipotent cells in the bone marrow known as hematopoietic stem cells. Leukocytes are found throughout the body, including the blood and lymphatic system.
Explanation:
Which hemisphere is usually dominant regardless of what hand one writes with?
The half of the globe of the cerebrum that is typically prevailing paying little mind to hand one's message is the left side of the equator.
Studies have demonstrated that the majority of right-handed individuals have left hemisphere dominance for language functions such as speech and writing.
despite the complex relationship between handedness and brain hemisphere dominance.
On the other hand, people who are left-handed may have dominance of the left hemisphere, dominance of the right hemisphere, or even a pattern of brain activity that is more evenly distributed between the two hemispheres.
It's important to remember that brain hemisphere dominance isn't a one-size-fits-all phenomenon; rather, it can be different for different tasks and functions.
In addition, individual differences in brain organization and functional lateralization may defy generalizations regarding hemisphere dominance and handedness.
Therefore, The half of the globe of the cerebrum that is typically prevailing paying little mind to hand one's message is the left side of the equator.
To know more about the dominant hemisphere:
https://brainly.com/question/6032778
The hemisphere that is usually dominant regardless of what hand one writes with is the left hemisphere.
How is left dominant over right in case of our brain?
The hemisphere that is usually dominant regardless of what hand one writes with is the left hemisphere. The left hemisphere of the brain is typically dominant for language processing, logical reasoning, and analytical tasks, even if an individual is left-handed or ambidextrous. This is because the left hemisphere of the brain is typically responsible for language processing and fine motor control, both of which are important in writing. However, it is important to note that there are exceptions to this generalization, as some individuals may have a dominant right hemisphere or may exhibit more balanced hemispheric function.
To know more about Brain:
https://brainly.com/question/6032778
#SPJ11
How do the sizes of planets, solar systems, galaxies, and the universe relate to one another?
Answer:
Our Solar System consists of our star, the Sun, and its orbiting planets(including Earth), along with numerous moons, asteroids, comet material, rocks, and dust. Our Sun is just onestar among the hundreds of billions of stars in our Milky Way Galaxy. ... Theuniverse is all of the galaxies – billions of them!
Explanation:
I hope this answer is Wright, So mark as brainlist
Set of 25 green plants and 25 mushrooms were put in a cool, dark room for two weeks. Each set was watered daily with 50 mL of a 0.1% fertilizer solution. Which statement best explains why the green plants died and the mushrooms survived?
Answer:
This question lacks options, however, it can be answered based on general understanding.
The green plant died because of absence of LIGHT
Explanation:
Plants (green) are autotrophic organisms i.e. organisms that are capable of synthesizing their own food via a process called PHOTOSYNTHESIS. However, on the other hand, mushrooms (kingdom FUNGI) are heterotrophic organisms i.e. rely on other organisms for energy source and cannot make their own food.
Green plants strictly require light energy from the sun in order to perform the process of photosynthesis. According to this question, a set of 25 green plants and 25 mushrooms were put in a cool, dark room for two weeks and watered daily with 50 mL of a 0.1% fertilizer solution. The green plants, despite the nutrients and regular watering dies because they were not exposed to LIGHT in order to make their food via photosynthesis. However, since light is not a requirement for mushrooms to obtain food, they will surely survive.
1) What would happen to the amount of carbon dioxide in a closed terrarium if most of the plants were
removed?
2) What would happen to the amount of carbon dioxide in a closed terrarium if the number of grasshoppers doubled?
3) What would happen to the amount of oxygen in an aquarium if more fish were added?