What is the equation for the line shown, in slope-intercept form?
Question 8 options:

A) y = 2x - 2


B) y = -2x + 4


C) y = -4x - 2


D) y = -2x - 4

What Is The Equation For The Line Shown, In Slope-intercept Form?Question 8 Options:A) Y = 2x - 2B) Y

Answers

Answer 1

Answer: Solution In Photo

What Is The Equation For The Line Shown, In Slope-intercept Form?Question 8 Options:A) Y = 2x - 2B) Y
Answer 2

Answer:

D) y = -2x - 4

Step-by-step explanation:

Use the points:

(-2, 0) and (0, -4)

The y- intercept is  - 4 and the slope is:

m = (-4 - 0)/(0 - (-2)) = -2

The line is:

y = -2x - 4

Correct choice is D


Related Questions

What must be done to categorical variables in order to use them in a regression analysis?
Choose one answer.
a. categorical coding
b. nothing
c. problem coding
d. dummy coding

Answers

d. Dummy coding. Categorical variables need to be converted into numerical variables to be used in regression analysis. Dummy coding involves creating binary variables for each category of the categorical variable.

For example, if the categorical variable is "color" with categories "red," "green," and "blue," dummy coding would involve creating three binary variables: "red" (0 or 1), "green" (0 or 1), and "blue" (0 or 1). These binary variables can then be used in the regression analysis. In conclusion, to use categorical variables in regression analysis, dummy coding is necessary.


In order to use categorical variables in a regression analysis, they must be converted into numerical values. This process is called dummy coding (also known as one-hot encoding). Dummy coding involves creating new binary variables (0 or 1) for each category of the categorical variable. This allows the regression model to incorporate the categorical data while maintaining its numerical nature.

To use categorical variables in a regression analysis, you must apply dummy coding to convert them into numerical values.

To know more about variables visit:

https://brainly.com/question/17344045

#SPJ11

calculate the solar flux density (also known as the solar constant) for mercury using the following information: solar luminosity = 3.865 x 10^26 w distance of mercury from the sun = 5.791 x 10^10 m

Answers

Therefore, the solar flux density for mercury after the calculation is 9.12 x 10⁻³ W/m².

The solar flux density also referred to as the solar constant is the total amount of energy derived from the sun per unit area per given unit of time. It is considered to be equal to solar luminosity divided by the surface area of a given sphere that has a radius equivalent to the distance between the respective planet from the sun.

using the formula for finding the solar flux density,

solar flux density =  solar luminosity /(4 x π x distance between mercury and the sun)

solar flux density =  3.865 x \(10^{26}\) /(4 x π x ( 5.791 x \(10^{10}\)))

solar flux density = 9.12 x 10⁻³ W/m²

Therefore, the solar flux density for mercury after the calculation is 9.12 x 10⁻³ W/m².

To learn more about solar flux density,

https://brainly.com/question/14891737

#SPJ4

Can someone help me with this

Can someone help me with this

Answers

Answer:

Its b

Step-by-step explanation:

The answer is D
Y=2/3x-2

By using formula y=mx+b
And find slope by using rise over run// y2-y1 over x2-x1 to get the slope of 2/3 :)

A company offers four plans for customers who want to rent DVDs and video games. The cost of the plans can be modeled by a linear function that combines a one time membership fee with a per disc rental rate. The table shows the total cost, including membership fees, for a person who rents 1,2 and 5 discs in a month
Discs rented plan A B C D
1. $14. $12. $10. $12
2. $17. $16. $15. $21
5. $26. $28. $30. $48

Answers

The plan with the smallest one-time membership fee is Plan D.

The point-slope formula will be used to determine the equation that models the cost of each plans.

(y - y₁) = [(y₂ - y₁)/(x₂ - x₁)](x - x₁)

where (x₁, y₁) is the coordinates of point 1

(x₂, y₂) is the coordinates of point 2.

For the equation y = mx + b,

let x = number of discs rented

y = total cost

m = rental rate per disc

b = one-time membership fee

Plan A

(y - 14) = [(17 - 14)/(2 - 1)](x - 1)

y - 14 = 3x - 3

y = 3x + 11

Plan B

(y - 12) = [(16 - 12)/(2 - 1)](x - 1)

y - 12 = 4x - 4

y = 4x + 8

Plan C

(y - 10) = [(15 - 10)/(2 - 1)](x - 1)

y - 10 = 5x - 5

y = 5x + 5

Plan D

(y - 12) = [(21 - 12)/(2 - 1)](x - 1)

y - 12 = 9x - 9

y = 9x + 3

Hence, the plan with the smallest one-time membership fee, b, is Plan D.

Your question is incomplete, but most probably you are asking

"...Which plan has the smallest one-time membership fee?"

Learn more about point-slope formula here: https://brainly.com/question/6497976

#SPJ4

Draw a line PQ. Take any point outside it and construct a line parallel to the given line through this point​

Answers

Parallel means same slope, so in the image, line PQ is connected by a line. The other point I made has a line parallel through it.

Draw a line PQ. Take any point outside it and construct a line parallel to the given line through this

A stadium has two sections, A and B.
Tickets for Section A costs Sa each.
Tickets for Section B costs $b each.
John paid $105 for 5 Section A tickets and 3 Section B tickets. Rita paid $63 for 4 Section A
tickets and 1 Section B tickets.
ii)
Write 2 equations in a and b to represent the information above.
Calculate the cost of a Section A and Section B ticket using the Elimination / Addition
Method.

Answers

ANSWER: a=12 b=15
Explanation: (look at work below)

4a + 1b = 63 (eq1)
5a + 3b = 105 (eq2)
-12a + -3b = -189 (subt. eq1 from eq2)
————————-
-7a = -84
a = 12
4(12) + 1b = 63 (plug in the a value)
48 + 1b = 63
b = 15

What is the weight of a 24 square foot 2 inch thick aluminum plate with a unit weight of 15 lbs?

Answers

Weight of a 24 square foot, 2 inch thick aluminum plate will be: 720 lbs.

What is unitary method?

A single unit's value can be determined from the values of multiple units, and multiple units' values can be determined from the values of single units using the unitary method.

Given:

Weight of 1 square foot, 1 inch thick plate = 15 lbs.

To find: weight of a 24 square foot, 2 inch thick aluminum plate

Finding:

By unitary method, we get:

Weight of 1 square foot aluminum plate = 15 lbs.

Weight of 24 square foot aluminum plate = 15(24) lbs = 360 lbs.

Again, by unitary method, we get:

Weight of 1 square foot, 1 inch thick aluminum plate = 15 lbs.

Weight of 24 square foot, 1 inch thick aluminum plate = 15(24) lbs = 360 lbs.

Weight of 24 square foot, 2 inch thick aluminum plate = 360(2) lbs = 720 lbs.

Hence, Weight of 24 square foot, 2 inch thick aluminum plate = 720 lbs.

To learn more about unitary method, refer to the link: https://brainly.com/question/24587372

#SPJ4

Milly wants to examine the relationship between walking distance and BMI in COPD patients. Whether she can go for: Calculate a correlation coefficient or Run a linear regression model or she can do both? Justify your answer

Milly also wants to know if there is a relationship between walking distance and smoking status (with categories 'current' or 'ex-smokers'). Which of the correlation analysis should Milly calculate? Why?

If the β coefficient had a 95% confidence interval that ranged from −5.74 to −0.47. What does this indicate?

Milly decides to use the more detailed assessment of smoking status captured by the variable PackHistory (which records a person's pack years smoking, where pack years is defined as twenty cigarettes smoked every day for one year) to explore the relationship between walking distance and smoking status.
Milly finds: MWT1 best =α+β∗ PackHister χ=442.2−1.1∗ PackHistory
and the corresponding 95% confidence interval for β ranges from −1.9 to −0.25. What does it mean?

Milly decides to fit the multivariable model with age, FEV1 and smoking pack years as predictors. MWT1best =α+β1∗AGE+β2∗FEV1+β3∗ PackHistory Milly is wondering whether this is a reasonable model to fit. Why should she wonder about the model?

Milly has now fitted several models and she wants to pick a final model. What statistic(s) can help her make this decision?

Answers

A model with a lower AIC or BIC value is preferred using linear regression.

She can run a linear regression model or she can do both. A correlation coefficient measures the strength of a relationship between two variables but does not indicate the nature of the relationship (positive or negative) or whether it is causal or not. Linear regression is used to model a relationship between two variables and to make predictions of future values of the dependent variable based on the value of the independent variable(s). Additionally, linear regression analysis allows for statistical testing of whether the slope of the relationship is different from zero and whether the relationship is statistically significant. Milly also wants to know if there is a relationship between walking distance and smoking status (with categories 'current' or 'ex-smokers').

Milly should perform a point-biserial correlation analysis since walking distance is a continuous variable while smoking status is a dichotomous variable (current or ex-smokers). The point-biserial correlation analysis is used to determine the strength and direction of the relationship between a dichotomous variable and a continuous variable.

If the β coefficient had a 95% confidence interval that ranged from −5.74 to −0.47.

The β coefficient had a 95% confidence interval that ranged from −5.74 to −0.47 indicates that if the value of the independent variable increases by 1 unit, the value of the dependent variable will decrease between −5.74 and −0.47 units. The interval does not contain 0, so the effect is statistically significant. Milly finds:

MWT1_best =α+β∗ PackHister

χ=442.2−1.1∗ PackHistory and the corresponding 95% confidence interval for β ranges from −1.9 to −0.25.  

The 95% confidence interval for β ranges from −1.9 to −0.25 indicates that there is a statistically significant negative relationship between PackHistory and MWT1best. It means that for every unit increase in pack years of smoking, MWT1best decreases by an estimated 0.25 to 1.9 units.Milly decides to fit the multivariable model with age, FEV1 and smoking pack years as predictors. MWT1best =α+β1∗AGE+β2∗FEV1+β3∗ PackHistory

Milly is wondering whether this is a reasonable model to fit. Milly should wonder about the model as the predictors may not be independent of one another and the model may be overfitting or underfitting the data. Milly has now fitted several models and she wants to pick a final model.

To pick a final model, Milly should use the coefficient of determination (R-squared) value, which indicates the proportion of variance in the dependent variable that is explained by the independent variables. She should also consider the adjusted R-squared value which is similar to the R-squared value but is adjusted for the number of predictors in the model. Additionally, she can compare the Akaike Information Criterion (AIC) or the Bayesian Information Criterion (BIC) values of the different models. A model with a lower AIC or BIC value is preferred.

To know more about linear regression, visit:

https://brainly.com/question/32505018

#SPJ11

is it possible to choose (2n 1)^2 points in the disc of radius n such that the distance between any two of them is greater than 1?

Answers

Answer: its (4f 5) ^3

Step-by-step explanation:

B
An athlete ran uphill at 3 metres per second for x seconds , downhill
at 6 metres per second for y seconds and covered a total distance
of 375 metres . If the athlete took 5 seconds longer to run uphill than
downhill, calculate the values of xandy.
(5)

Answers

Step-by-step explanation:

- The distance traveled to get to the top of the hill will be equal to the distance traveled to get to the bottom of the hill. Distance down the hill = Distance up the hill = 187.5 meters.

- Only the speed of going up the hill and down the hill will be different.

BAn athlete ran uphill at 3 metres per second for x seconds , downhillat 6 metres per second for y seconds

What number is composed of 6 ones,22 tenths,33 thousandths and 44 thousandths.

Answers

Answer:

8.277

Step-by-step explanation:

Pretty simple, just add up the values but convert the word form into decimals.

\(6+2.2+0.033+0.044=8.277\)

Also, your question said 33 thousandths, so it is what I answered.

Answer:

8.277

Step-by-step explanation:

What do you need to know?

What do you need to know?

Answers

9514 1404 393

Answer:

  A.  One

Step-by-step explanation:

Descarte's rule of signs is used to answer this question. The signs of the coefficients are ...

  + + + -

There is one sign change, hence one positive real root.

express the following ratio in their simplest form 65g:2kg​

Answers

Answer:

we cant express it. only itself can because in 2021 we can talk to anyone and ask them a question

Simplify: 1. Write the prime factorization of the radicand. 2. Apply the product property of square roots. Write the radicand as a product, forming as many perfect square roots as possible.

Answers

The prime factorization of the radicand 2 is 9√15.

A number can be expressed as the product of its prime components through the process of prime factorization. A number with precisely two elements, 1 and the number itself, is said to be a prime number.

As an illustration, let's use the number 30. We know that 30 = 5 × 6, but 6 is not a prime number. The number 6 can further be factorized as 2 × 3, where 2 and 3 are prime numbers. Therefore, the prime factorization of 30 = 2 × 3 × 5, where all the factors are prime numbers.

Given that,

x= 3√135

Solving the equation further using the rule √A*B = √A*√B

x= 3√9*15

x= 3√9*√15

x=3*3*√15

x= 9√15

Therefore, the prime factorization of the radicand 2 is 9√15.

To know more about prime factorization visit: brainly.com/question/29775157

#SPJ4

solve the 2nd degree incomplete equation : 2(x²+x/3)=0

Answers

Answer:

Step-by-step explanation:

Distribute and solve with the quadratic equation:

After simplifying, we get two solutions:

\(x=0\\x=-\frac{1}{3}\)

WILL GIVE BRAINLIST TO BEST ANSWER
Solve for x
3 and 5

WILL GIVE BRAINLIST TO BEST ANSWERSolve for x 3 and 5

Answers

Answer:

Step-by-step explanation:

Sum of all angles in a triangle is = 180

let,

a = 4x + 3

b = 70

c = 75

So, a + b + c = 180

By putting values, we get

4x + 3 + 70 + 75 = 180

4x + 148 = 180

4x = 180 - 148

4x = 32

x = 32 / 4

x = 8

solve this question fast please solve this fast​

solve this question fast please solve this fast

Answers

Answer:

15%

Step-by-step explanation:

RS. 6450 = 15%

6450 percent *15 =

(6450:100)*15 =

(6450*15):100 =

96750:100 = 967.5

Answer:

monthly income=rs14000

annual income =rs14000×12=rs 168000

since it is greater than rs125000

he needed to pay tax=x% let

tax amount =6450

x% of rs (168000-125000)=6450

x/100×43000=6450

x=6450/430=15

therefore required tax %=15%

Question 2 of 6 View Policies Current Attempt in Progress Express the following as a linear combination of u =(3, 1,6), v = (1.-1.4) and w=(8,3,8). (14, 9, 14) = ____ u- _____ v+ _____

Answers

Answer: The given vector can be expressed as a linear combination of u, v, and w as (14, 9, 14) = u - v + 3w.

Question: Express the following as a linear combination of u =(3, 1,6), v = (1.-1.4) and w=(8,3,8). (14, 9, 14) = ____ u- _____ v+ _____

Current Progress: To express the given vector as a linear combination of u, v, and w, we need to find scalars a, b, and c such that (14, 9, 14) = a*u + b*v + c*w.

Step 1: Write the equation in component form:
(14, 9, 14) = (3a + b + 8c, a - b + 3c, 6a + 4b + 8c)

Step 2: Equate the corresponding components and solve for a, b, and c:
3a + b + 8c = 14
a - b + 3c = 9
6a + 4b + 8c = 14

Step 3: Solve the system of equations using any method (substitution, elimination, etc.). One possible solution is a = 1, b = -1, and c = 3.

Step 4: Plug the values of a, b, and c back into the linear combination equation:
(14, 9, 14) = 1*u + (-1)*v + 3*w

Step 5: Simplify the equation:
(14, 9, 14) = u - v + 3w

Answer: The given vector can be expressed as a linear combination of u, v, and w as (14, 9, 14) = u - v + 3w.

Learn more about Express

brainly.com/question/28172855

#SPJ11

 Biologists Stocked A Lake With 400 Fish And Estimated The Carrying Capacity (The Maximal Population For The Fish Of That Species In That Lake) To Be 5100. The Number Of Fish Tripled In The First Year.(A) Assuming That The Size Of The Fish Population Satisfies The Logistic Equation =
Biologists stocked a lake with 400 fish and estimated the carrying capacity (the maximal population for the fish of that species in that lake) to be 5100. The number of fish tripled in the first year.
(a) Assuming that the size of the fish population satisfies the logistic equation=P(1-KP),
determine the constant, and then solve the equation to find an expression for the size of the population afteryears.
,
.
(b) How long will it take for the population to increase to(half of the carrying capacity)?
It will take years.

Answers

(a) By using the logistic equation P' = kP(1 - P/K), where P represents the fish population and K is the carrying capacity, we can determine the constant k. Given that the population tripled in the first year, we can set up the equation 3P = P(1 - kP/K) and solve for k. The value of k is approximately 0.0005833. We can then use this value to solve the logistic equation and find an expression for the population size after t years.

(b) To determine how long it will take for the population to increase to half of the carrying capacity, we set up the logistic equation P = 0.5K and solve for t. The solution to this equation gives us the time it takes for the population to reach half of the carrying capacity.

(a) To find the constant k, we set up the equation 3P = P(1 - kP/K) using the given information that the population tripled in the first year. By simplifying and solving for k, we find k ≈ 0.0005833. Now we can substitute this value of k into the logistic equation P' = 0.0005833P(1 - P/5100) and solve it to find an expression for the population size after t years.

(b) To determine the time it takes for the population to increase to half of the carrying capacity, we set up the equation P = 0.5(5100) using the logistic equation. By solving this equation, we can find the value of t that represents the time it takes for the population to reach half of the carrying capacity.

To learn more about equation click here:

brainly.com/question/29657983

#SPJ11

What is the solution for the system below?
у
4
-2
0
2
4
4
(2,0)
(0-2)
0 (1-1)

What is the solution for the system below?4-20244(2,0)(0-2)0 (1-1)

Answers

Answer:

the solution is (1,-1)

Step-by-step explanation:

the lines meet at (1,-1)

find the equations of the osculating circles of the ellipse 25x2 4y2 = 100 at the points (2, 0) and (0, 5). (2, 0)

Answers

To find the equations of the osculating circles of the ellipse 25x^2 + 4y^2 = 100 at the points (2,0) and (0,5),

we need to find the radius of curvature at these points and use the formula for the equation of the osculating circle.

We start by finding the second derivatives of the ellipse with respect to x and y:

d^2x/dy^2 = -25x/(2y)^3
d^2y/dx^2 = -4y/(25x)^3

At the point (2,0), we have x = 2 and y = 0, so:

d^2x/dy^2 = 0
d^2y/dx^2 = -4/(25*2^3) = -1/50

The radius of curvature at this point is given by:

R = ((1 + (dy/dx)^2)^(3/2))/|d^2y/dx^2| = ((1 + 1/2500)^(3/2))/(1/50) = 50√2501/2500

Therefore, the equation of the osculating circle at (2,0) is given by:

(x - 2)^2 + y^2 = (50√2501/2500)^-1

Simplifying, we get:

(x - 2)^2 + y^2 = 100/2501

Similarly, at the point (0,5), we have x = 0 and y = 5, so:

d^2x/dy^2 = -25/(2*5)^3 = -1/200
d^2y/dx^2 = 0

The radius of curvature at this point is given by:

R = ((1 + (dy/dx)^2)^(3/2))/|d^2x/dy^2| = ((1 + 1/400)^(3/2))/(1/200) = 100√401/401

Therefore, the equation of the osculating circle at (0,5) is given by:

x^2 + (y - 5)^2 = (100√401/401)^-1

Simplifying, we get:

x^2 + (y - 5)^2 = 400/401

Hence, the equations of the osculating circles at the points (2,0) and (0,5) are (x - 2)^2 + y^2 = 100/2501 and x^2 + (y - 5)^2 = 400/401, respectively

Learn more about radius here:brainly.com/question/12923242

#SPJ11

Multiply the sum of 83 and 74 by their difference, and divide the product by 15.
(A. 94.2
B. 10.47
C. 0.6
D. 409.47)

Answers

The calculated answer is 94.2. Thus, Option A is the answer.

The sum of 83 and 74

83 + 74 = 157

Difference between 83 and 74

83 - 74 = 9

By Multiplying 157 and 9

157 * 9 = 1413

Dividing the above result by 15

1413 / 15 = 94.2

Therefore, the calculated answer is 94.2. Thus, Option A is the answer.

To learn more about Multiplication:

brainly.com/question/29793687

Here is my math problem, thanks :) -8+16-9+1222-784

Answers

Answer:

437

Step-by-step explanation:

i just simplified it, but i hope this helps!

have a good day!

and mark me brainliest while your at it! ;D

Answer:

437

Step-by-step explanation:

4. (NO CALC) Consider the differential equation dy/dx = x²-½y.(a) Find d²y/dx² in terms of x and y.

Answers

In summary d²y/dx² in terms of x and y is given by: d²y/dx² = 3/2 x + 1/4 y

Why is it?

To find d²y/dx², we need to differentiate the given differential equation with respect to x:

dy/dx = x² - 1/2 y

Differentiating both sides with respect to x:

d²y/dx² = d/dx(x² - 1/2 y)

d²y/dx² = d/dx(x²) - d/dx(1/2 y)

d²y/dx² = 2x - 1/2 d/dx(y)

Now, we need to express d/dx(y) in terms of x and y. To do this, we differentiate the original differential equation with respect to x:

dy/dx = x² - 1/2 y

d/dx(dy/dx) = d/dx(x² - 1/2 y)

d²y/dx² = 2x - 1/2 d/dx(y)

d²y/dx² = 2x - 1/2 (d²y/dx²)

Substituting this expression for d²y/dx² back into our previous equation, we get:

d²y/dx² = 2x - 1/2 (2x - 1/2 y)

d²y/dx² = 2x - x/2 + 1/4 y

d²y/dx² = 3/2 x + 1/4 y

Therefore, d²y/dx² in terms of x and y is given by:

d²y/dx² = 3/2 x + 1/4 y

To know more about Equation related question visit:

https://brainly.com/question/29657983

#SPJ1

Show 76 as tens and ones two ways how do I figure this problem out to get the answer

Answers

Answer: 7 tens and 6 ones

Step-by-step explanation: 76 is two numbers, with a 7 in the tens place and a 6 in the ones place.

Final answer:

76 can be represented as 7 tens and 6 ones or as 6 tens and 16 ones. This involves understanding the place value of digits in a number and knowing that a ten can be broken down into ones.

Explanation:

The number 76 can be broken down into tens and ones in multiple ways. First, let's understand what tens and ones mean in the context of a number. In the number 76, '7' is the tens place, and '6' is the ones place, meaning there are 7 tens (70) and 6 ones (6) making up 76.

One way to show 76 with tens and ones is to say that there are 7 tens and 6 ones. This is a very direct method where we just count the number of tens and ones in the number.

Another way we could break down 76 is to say there are 6 tens and 16 ones. This method involves taking one of the tens and breaking it down into 10 ones, giving us a total of 6 tens and 16 ones.

Learn more about Place Value here:

https://brainly.com/question/27734142

#SPJ2

5 apples for $6.25 or 8 apples for $9.25. Which is the better deal?

Answers

The option that is the better deal between both deals for apples, is 8 apples for $9.25.

How to find the better deal?

The better deal on the apples would be the deal that gives the lower amount per apple. This means that the deal that leads to each individual apple having a lower price is the deal that should be considered best.

To find the price of an apple, you would need to divide the price of the deal given, by the number of apples in the deal.

The first deal would therefore have a per apple price of :

= Price of deal / Number of apples

= 6. 25 / 5 apples

= $ 1. 25 per apple

The second deal would be :

= Price of deal / Number of apples

= 9. 25 / 8 apples

= $ 1. 16 per apple

The better deal is therefore 8 apples for $9.25.

Find out more on deals at https://brainly.com/question/3021946

#SPJ1

I’ll give Brainly est help. B

Ill give Brainly est help. B

Answers

Answer:

C) 99 + 3x

Step-by-step explanation:

Since it's always going to cost 99, it'll stay like that since it's a constant

Since it's 3 PER person, that means 3 will have a variable: 3x

11, 15, 19,... Find the 46th term.
WILL GET BRAINLIEST!!!!!!!!​

Answers

Answer:

191

Step-by-step explanation:

the rule is +4 so 11+45*4=191 (45 is the number not including the first one)

191 is the answer

Answer:

191

Step-by-step explanation:

First, determine if the sequence is arithmetic or geometric.

If it is arithmetic, the difference between consecutive terms is constant.

If it is geometric, the ratio between consecutive terms is constant.

\(\sf 11 \underset{+4}{\longrightarrow} 15 \underset{+4}{\longrightarrow} 19\)

As we add 4 to each term to get the next term, this is an arithmetic sequence with common difference of 4.

Arithmetic sequence

General form of an arithmetic sequence: \(a_n=a+(n-1)d\)

where:

\(a_n\) is the nth terma is the first termd is the common difference between terms

Given:

a = 11d = 4

Substituting the given values into the formula to find an equation for the nth term:

\(\implies a_n=11+(n-1)4\)

\(\implies a_n=4n+7\)

Therefore, to find the 46th term, substitute n = 46 into the equation:

\(\implies a_{46}=4(46)+7=191\)

(2.4×10−4)+(5.9×10−3)

Answers

Answer:

-36

Step-by-step explanation:

Use PEMDAS to solve

(2.4×10−4)+(5.9×10−3)

([2.4×10]-4)+([5.9×10]-3)

(24-4)+(59-3)

20-56

-36

in a triangle ABC, A= 29°, B=36° and b=15.8cm. Find a, using sine rule.​

Answers

a= (b sin A)/ sinB

a= (15.8 sin29)/ sin36

a= 13.03 cm
Other Questions
What was behind the Klu Klux Klan's confident facade?CA. Americans supportive of changeB. Americans fearful of changeC. Americans fearfut of religionD. Americans supportive of religion ALOT OF POINTS MARKING POEPLE AS BRAINLIST Look at the graph. Explain how the two population are related to each other which of the following are functions of export assistance centers (eacs)? multiple select question. scheduling assistance trade-finance support packaging assistance hands-on exporting assistance one math student john,can solve 6 math problems in 20 minutes while another student,juaquine,can solve the same 6 math problems at a rate of 1 problem per 4 minutes.who works faster? abnormal condition of stiffening of the tiny bones of the ear Answer number 6 asfast as possible pls simplify (3a^2-6a+3)/(a^2-1) if a is not 1 The answer is B Aparthield:) The loan is for $140,000 with a rate of 3.96% for 30 years payable monthly. a. Calculate the Monthly Payment (MP): b. Do a monthly Amortization Table for 4 months using the MP: c. Calculate the Loan Balance (LB) using the formula approach at the end of 4 months. The next census will be conducted in 2020, with a reapportionment completed soon after based on its results. Assuming the Texas population will increase from its 2010 total, as a result of this reapportionment, Texas will most likely;a. gain seats in the U.S. House of Representatives.b. lose seats in the U.S. House of Representatives.c. see no change in its allocation of seats in the U.S. House of Representatives.d. gain seats in the U.S. Senate. A capacitor with capacitance 2.00F stores 12.0 J of electricpotential energy. What is the charge stored on this capacitor? (1F= 1x10-6 F) Although we did not talk about it in lecture, everyone needs to know how to design primers. Presumably you learned this skill in the prerequisite courses. For most applications, primers are on the order of 20 nts in length. For the sake of simplicity and grading, we'll just work with primers that are 5 nts in length for this particular question. Design oligonucleotide primers 5 bps in length that can be used to amplify the underlined portion of the sequence below. 5'- TCTTACGTCAGCTAGATGCATTGTGGTACCTGGTACCTGATCATACGGCA-3' 3'-AGAATGCAGTCGATCTACGTAACACCATGGACCATGGACTAGTATGCCGT-5' Your answers should be written in the 5' to 3' direction (from left to right) The two polygons are similar, find the missing length. (the ?) How a Bill Becomes a LawCreating laws is the U.S. House of Representatives most important job. All laws in the United States begin as bills. Before a bill can become a law, it must be approved by the U.S. House of Representatives, the U.S. Senate, and the President. Lets follow a bills journey to become law.The Bill BeginsLaws begin as ideas. These ideas may come from a Representativeor from a citizen like you. Citizens who have ideas for laws can contact their Representatives to discuss their ideas. If the Representatives agree, they research the ideas and write them into bills.The Bill Is ProposedWhen a Representative has written a bill, the bill needs a sponsor. The Representative talks with other Representatives about the bill in hopes of getting their support for it. Once a bill has a sponsor and the support of some of the Representatives, it is ready to be introduced.The Bill Is IntroducedIn the U.S. House of Representatives, a bill is introduced when it is placed in the hoppera special box on the side of the clerks desk. Only Representatives can introduce bills in the U.S. House of Representatives.When a bill is introduced in the U.S. House of Representatives, a bill clerk assigns it a number that begins with H.R. A reading clerk then reads the bill to all the Representatives, and the Speaker of the House sends the bill to one of the House standing committees."How Laws Are Made, Office of the Clerk20 POINTS HURRY PLEASERead the passage. What is the authors purpose for writing the text?to entertain the reader with amusing facts about the US governmentto argue that the US legislature is the most effective one in the worldto compare US laws with laws of other countriesto explain how laws are made in the United States A picture frame measures 5 inches wide and 7 inches long. What is the perimeter of the frame? "How has airport security traditionally adapted to civil aviationthreats?Is the traditional nature of dealing with such threats beneficialfor the airports? Justify your answer. if I have a 94% in art class and I dont do one of my assignments and get a 68 what will my grade drop down to? In what way was the Scopes trial an example of the cultural conflicts that existed in American society in the 1920s?It represented the conflict between Fundamentalists and supporters of evolution.o It represented the conflict between flappers and women with traditional values.o It represented the conflict between law enforcement and bootleggers. the 3 main similarities between the American and French Revolutions were If function g is defined by the equation y 3x = -14, which equation represents the function in function notation? A. g(x) = 3x 14 B. g(x) = -3x 14 C. g(x) = 3x + 14 D. g(x) = -3x + 14If function g is defined by the equation y 3x = -14, which equation represents the function in function notation? A. g(x) = 3x 14 B. g(x) = -3x 14 C. g(x) = 3x + 14 D. g(x) = -3x + 14