What is the effect on the graph of y = 2x + 2
when it is changed to y = 2x-2?

What Is The Effect On The Graph Of Y = 2x + 2when It Is Changed To Y = 2x-2?

Answers

Answer 1

Answer:

  shifted down 4 units

Step-by-step explanation:

You want to know the effect on the graph of changing y=2x+2 to y=2x-2.

Y-intercept

The constant in the equation y=2x+2 is the y-intercept. The line described by this equation crosses the y-axis at y=2.

When the equation is changed to y=2x-2, the y-intercept changes from +2 to -2, a shift down of 4 units. The shifted line has the same slope as the original, so is parallel to it.

The effect on the graph is to move it down 4 units.

What Is The Effect On The Graph Of Y = 2x + 2when It Is Changed To Y = 2x-2?

Related Questions

Charlotte and her sister enjoyed a special dinner in a restaurant, and the bill was $53.86. If she leaves $6.46 for the server as her tip, what percent tip did she leave?

Answers

Charlotte and her sister enjoyed a special dinner in a restaurant, and the bill was $53.86. 11.99%  tip did she leave.

Calculating the percent:

Percent tip she give:

\(\frac{6.46}{53.86}\) × 100

= 11.99 %

What percentage is it?

A percentage, or percent, is a number smaller than or equal to 100. The term "per 100" refers to a percentage of a total amount. 45 percent, for instance, is 45 out of 100. Finding the share of a whole in terms of 100 is what percentage means. You can use online calculators or manually calculate it.

What is the purpose of percentages?

Percentages are utilized extensively and in numerous contexts. Discounts in stores, interest rates at banks, inflation rates, and numerous media statistics are all expressed as percentages. Understanding the financial aspects of everyday life requires knowledge of percentages.

Learn more about Percentage:

brainly.com/question/24877689

#SPJ1

A parabola crosses the x axis at -1 and 7

Answers

Answer:7y

Step-by-step explanation:

Review the graph of a piece wise function.
At which value of x does the function have a jump discontinuity?

Review the graph of a piece wise function. At which value of x does the function have a jump discontinuity?

Answers

Given piecewise function has a jump discontinuity at 0 or x=0 i.e. B.

What exactly is a piecewise function?

A piecewise function is one that has multiple definitions in different x intervals. A piecewise function's graph is divided into parts that correspond to each of its definitions. A very excellent example of a piecewise function is the absolute value function. Let us investigate why it is thus named. We know that an absolute value function is defined as f(x) = |x|.

f(x)=(x if x≥0 ,

     -x  if x><0)

This piecewise function should be interpreted as

When x is higher than or equal to 0, f(x) equals x.

When x is less than zero, f(x) equals -x.

Now,

As jump discontinuity is defined as where the endpoint of one segment and the start of the following segment may have the same x coordinate but have different values of f(x). In the piecewise linear function, such a difference is known as a jump discontinuity.

and in the given graph that happened at x=0 or 0.

Hence,

         Given piecewise function has a jump discontinuity at 0.

To know more about piecewise function visit the link

https://brainly.com/question/12561612?referrer=searchResults

#SPJ1

Question 4: A) Does lim┬((x,y)→(0,0))⁡〖(2x^4 y)/(x^2+xy^4+y^0 )〗 the limit exist?

Answers

The limit of (2x^4 y)/(x^2+xy^4+y^0) as (x, y) approaches (0, 0) does not exist.

To determine if the limit exists, we need to evaluate the expression as (x, y) approaches (0, 0). By simplifying the expression, we obtain (2x^4 y)/(x^2+xy^4+1).

If we approach along the x-axis (y = 0), the expression becomes 0/0, which is an indeterminate form. This means the value of the expression cannot be determined solely based on the x-axis approach.

If we approach along the y-axis (x = 0), the expression becomes 0/1 = 0. However, this does not provide information about the behavior of the expression when approaching (0, 0) along other paths.

Since the expression gives different results along different paths, the limit does not exist at (0, 0).

To learn more about limit click here:

brainly.com/question/12211820

#SPJ11

1/6+3/4 what is the answer

Answers

answer would be 11/12!

Answer:

11/12

Step-by-step explanation:

If A, B, and C are matrices of the same size such that A - C = B-C, then A = B. O True O False
It is acceptable to multiply a linear equation through by zero in elementary row operations. True O False

Answers

It is false that it is acceptable to multiply a linear equation through by zero in elementary row operations. Hence, option B is the correct option.

If A, B, and C are matrices of the same size such that A - C = B - C, then A = B is True.

Explanation: A, B, and C are matrices of the same size, and A - C = B - C.A-C=B-CAs C is same on both sides, it will cancel on both sides ,A=B, and this shows that A is equal to B.

Therefore, if A, B, and C are matrices of the same size such that A - C = B-C, then A = B is true.

Hence, option A is the correct option.

It is not acceptable to multiply a linear equation through by zero in elementary row operations. The elementary row operations that are used in solving the system of linear equations are the interchange of two rows, the multiplication of a row by a scalar, and the addition of a multiple of one row to another row.

However, we cannot multiply a row by zero in the elementary row operations because the resulting equation will always be zero. This contradicts the property of elementary row operations because the equations that result from elementary row operations must be equivalent to the original set of equations.

Therefore, it is false that it is acceptable to multiply a linear equation through by zero in elementary row operations. Hence, option B is the correct option.

To know more about matrices, visit:

https://brainly.com/question/30646566

#SPJ11

The final answers are as follows: If A, B, and C are matrices of the same size such that A - C = B-C, then A = B is true.It is false that it is acceptable to multiply a linear equation through by zero in elementary row operations.

The solution to the first problem If A, B, and C are matrices of the same size such that A - C = B-C, then A = B is true. Here is the explanation: By considering the given equality, A - C = B - C, we can get rid of the C from both sides of the equation.

Therefore, we have A - C + C = B - C + C which is equivalent to A = B as shown below:

A - C + C = B - C + C => A = B

Note: The subtraction of matrices follows the same rules as the subtraction of real numbers, i.e., corresponding elements are subtracted.

The solution to the second problem It is false that it is acceptable to multiply a linear equation through by zero in elementary row operations.

Here is the explanation:Elementary row operations are used to change the rows of a matrix to simpler forms.

However, when performing these operations, it is important to avoid dividing by zero or multiplying by zero. Multiplying an equation through by zero is not acceptable because it results in an equation that does not give any meaningful information.

Here are the types of elementary row operations that can be performed on a matrix to change its rows to simpler forms:Interchange two rows of a matrix Multiply a row by a nonzero scalar Add a multiple of one row to another row.

To know more about elementary row operations, visit:

https://brainly.in/question/22944607

#SPJ11

Determine whether or not the function is one-to-one, and if it is, determine its inverse function

Answers

Determine the conditions for when a function has an inverse. Use the horizontal line test to recognize when a function is one-to-one. Find the inverse of a given function.

What is a horizontal line test?

It is simple to establish whether the inverse of a function is also a function using the horizontal line test.

Because it fails the vertical line test, a function's inverse might not actually be a function.

Graph of the line

f\left( x \right) = - x + 2

f(x)=−x+2.

To know more about Horizontal line test, visit:

https://brainly.com/question/28208081

#SPJ4

FIND MEASUREMENT OF ANGLE P

FIND MEASUREMENT OF ANGLE P

Answers

52 degrees is the answer.
52 degrees is your answer!!!!!!!

A 90% confidence interval is constructed based on a sample of data, and it is 74% +3%. A 99% confidence interval based on this same sample of data would have: A. A larger margin of error and probably a different center. B. A smaller margin of error and probably a different center. C. The same center and a larger margin of error. D. The same center and a smaller margin of error. E. The same center, but the margin of error changes randomly.

Answers

As a result, for the same data set, a 99% confidence interval would have a greater margin of error than a 90% confidence interval.

Answer: If a 90% confidence interval is constructed based on a sample of data, and it is 74% + 3%, a 99% confidence interval based on this same sample of data would have a larger margin of error and probably a different center.

What is a confidence interval? A confidence interval is a statistical technique used to establish the range within which an unknown parameter, such as a population mean or proportion, is likely to be located. The interval between the upper and lower limits is called the confidence interval. It is referred to as a confidence level or a margin of error.

The confidence level is used to describe the likelihood or probability that the true value of the population parameter falls within the given interval. The interval's width is determined by the level of confidence chosen and the sample size's variability. The confidence interval can be calculated using the standard error of the mean (SEM) formula

.A 90% confidence interval indicates that there is a 90% chance that the interval includes the population parameter, while a 99% confidence interval indicates that there is a 99% chance that the interval includes the population parameter.

When the level of confidence rises, the margin of error widens. The center, which is the sample mean or proportion, will remain constant unless there is a change in the data set. Therefore, alternative A is the correct answer.

To know more about margin visit:

https://brainly.com/question/15357689

#SPJ11

Help please ASAP !!

Help please ASAP !!

Answers

Answer:

51.5

Step-by-step explanation:

Help please ASAP !!

Express m in terms of e and v and find the mass of an object whose energy and speed are 1800joules and 25m/s respectively

Answers

The object has a mass of 5.76 kg.

We may represent "m" in terms of "e" (energy) and "v" (speed) using the kinetic energy formula, assuming that "m" relates to the mass of the object:

The energy an object possesses as a result of its motion is known as kinetic energy. It is described as the energy that a moving object contains as a result of its motion, which is dependent on the mass and velocity of the object.

The formula for calculating an object's kinetic energy is KE = 1/2 * m * v2.

To solve for "m," we can rearrange this formula:

m = 2 x KE /

We obtain the following by substituting the given values:

m = 2 x 1800 / 25

m = 2 x 1800 J / 625

m= 5.76 (rounded to two decimal places)

To learn more about Kinetic energy :

https://brainly.com/question/28109294

#SPJ4

John, Luke and Paul were playing a card game.John scored (x) points.Luke scored three points fewer than John.Paul scored twice as many points as Luke.Together they scored 39 points what is (x)

Answers

Answer:

Scored 21 points

Step-by-step explanation:

John = x

Luke = l

Paul = p

x - 3 = l

2p = l

p + l + x = 39

Since Luke's score is twice of Paul's...

p + 2p + x = 39

Since John's score is 3 more than Luke..

p + 2p + p + 3 = 39

4p + 3 = 39

4p = 36

p = 9

2p = l

2(9) = 18

l = 18

18 + 3 = 21

21 + 18 = 39

Your welcome!

Kayden Kohl

8th Grade

Increase 20g by 10%

Answers

Answer:

22g ..................m

write the equation of a circle with center at (-1/2,1/4) and r= [3]

write the equation of a circle with center at (-1/2,1/4) and r= [3]

Answers

The equation of the circle is 16 x^2 + 16x +16 y^2- 4y -45 =0  

Here the center of circle is at (1/2, 1/4 ) and radius is √ 3

The equation of a circle with center (h , k) and radius r is given by

(x - h)^2 + ( y - k)^2 = r^2

Here it is given that the center of circle  (-1/2 , 1/4) = (h, k) and radius r= √ 3

Therefore the equation of required circle is

(x - (-1/2) )^2 + (y-1/4)^2= √ 3^2

=> x^2  + 1/4 + x + y^2 +1/16 - 4y= 3

=> 16x^2 + 4 +16x+ 16 y^2 -4y +1= 48

=>16 x^2 + 16x +16 y^2- 4y -45 =0

therefore the required equation of circle is

16 x^2 + 16x +16 y^2- 4y -45 =0

To know more about the equation of circle :-

https://brainly.com/question/30997261

I have three fair dice: one is 6-sided, one is 8-sided, and one is 12-sided. Each n-sided die has numbers 1 through 1 OH its sides, and each side is equally likely to come up. [roll the three dice at the same time. (a) What is the probability that [ roll the saine number on all three dice? (b) [ pick one of the dice at random, with all three equally likely to be picked. roll it and it comes up "4" What is the probability that the die [ rolled was the 6-sidled one? (c) What is the probability that the smallest number roll is at least 32 Hint: 'smallest number is at least 3" all 3 dice show 3 O1 higher" (d) What is the probability that the product of the three numbers roll is even"

Answers

The probability of rolling the same number on all three dice can be found by multiplying the probabilities of rolling the same number on each individual die. The probability of rolling the same number on the 6-sided die is 1/6, the probability of rolling the same number on the 8-sided die is 1/8, and the probability of rolling the same number on the 12-sided die is 1/12. Multiplying these probabilities together gives us the probability of rolling the same number on all three dice: (1/6) * (1/8) * (1/12) = 1/576.

The probability of rolling a "4" on one of the dice and it being the 6-sided die can be found by multiplying the probability of rolling a "4" on the 6-sided die (1/6) by the probability of picking the 6-sided die at random (1/3). This gives us a probability of (1/6) * (1/3) = 1/18.

The probability of the smallest number rolled being at least 3 can be found by subtracting the probability of the smallest number being less than 3 from 1. The probability of the smallest number being less than 3 is the probability of rolling a 1 or a 2 on each of the dice: (2/6) * (2/8) * (2/12) = 1/72. Therefore, the probability of the smallest number being at least 3 is 1 - (1/72) = 71/72.

The probability of the product of the three numbers rolled being even can be found by subtracting the probability of the product being odd from 1. The probability of the product being odd is the probability of rolling an odd number on each of the dice: (3/6) * (4/8) * (6/12) = 1/8. Therefore, the probability of the product being even is 1 - (1/8) = 7/8.

To know more about probability click here:

https://brainly.com/question/29381779

#SPJ11

How to write y=-1/2x + 1 in standard form

Answers

Hey there!

ANSWER: \(x+2y=2\)EXPLANATION:

The equation in y=mx+b is \(y=-\frac{1}{2}x+1\)

To write in standard form, it would look like: \(Ax+By=C\)

As you can see, the x and y should be on the same side. You will need to move \(-\frac{1}{2}x\) to the other side. When moving a number/variable to the other side, the sign changes, therefore, the negative sign will be removed. It is also the same as adding the opposite of it to both sides.

\(y=-\frac{1}{2}x+1\\ y+\frac{1}{2}x=-\frac{1}{2}x+\frac{1}{2}x + 1\\y+\frac{1}{2}x=1\)

In standard form, there are no fractions, only whole numbers. The fraction can be removed by multiplying it by its opposite. The opposite of \(\frac{1}{2}\) is \(\frac{2}{1} \rightarrow 2\).

The entire equation has to be multiplied by 2:

\((y+\frac{1}{2}x=1) \times 2 \rightarrow 2y+x=2\)

\(x+2y=2\)

Hope this helps!

\(\text{-TestedHyperr}\)

Find the length of side xx in simplest radical form with a rational denominator.

Find the length of side xx in simplest radical form with a rational denominator.

Answers

Answer:

x = √22

Step-by-step explanation:

This is a right triangle.

In right triangles the sum of square value of legs is equal to the square value of hypotenuse:

Since this is also an isosceles triangle, both legs are √11.

\(( { \sqrt{11}) }^{2} + ( \sqrt{11} {)}^{2} = {x}^{2} \)

The second power of √11 = 11

\(11 + 11 = {x}^{2} \)

Find the root of both sides

√22 = x

use the following to answer the next 2 questions. solar-heat installations successfully reduce the utility bill 60% of the time. suppose 10 houses with solar-heat installations are selected at random and the outcome between houses is independent. suppose x is the number of houses that successfully reduced the utility bill out of the 10. 14. which discrete distribution will appropriately model x? explain. binomial 15. what is the probability that at least 9 out of 10 solar-heat installations are successful and will reduce the utility bill? a. 0.0464 b. 0.9432 c. 0.0403 d. 0.8429

Answers

The probability that at least 9 out of 10 solar-heat installations will succeed and reduce the utility bill is 0.0464.

What is a binomial distribution?

The probability distribution known as the binomial distribution, which is used in statistics, quantifies the chances that a value will take one of two independent values given a particular set of conditions or hypotheses.

Formula to calculate the binomial distribution

P(X = x) =ⁿCₓ× pˣ×(1-p)ⁿ⁻ˣ

Here, we know that

Solar-heat installations successfully reduce the utility bill 60% of the time.

We have to calculate the probability that at least 9 out of 10 solar-heat installations will succeed and reduce the utility bill.

We have 60% = 0.6 = p and n = 10.

We have a binomial distribution: X : (10, 0.6).

We use the binomial distribution formula to calculate the probability

P(X = x) =ⁿCₓ× pˣ×(1-p)ⁿ⁻ˣ, we get

P(x ≥ 9) = 1 - P(x < 9)

P(x ≥ 9) = 1 - P(x ≤ 8)

P(x ≥ 9) = 1 - ∑⁸₀ P(x = x)

P(X ≥ 9) = 1 - ∑⁸₀¹⁰Cₓ × (0.6)ˣ × (1-0.6)¹⁰⁻ˣ

P(X ≥ 9) = 1 -( 0.00011 + 0.00157 + 0.01062 + 0.04247 + 0.11148 + 0.20066 + 0.25082 + 0.21499 + 0.12093)

P(X ≥ 9) = 1 -0.95365

P(X ≥ 9) = 0.04635

Hence, the probability that at least 9 out of 10 solar-heat installations will succeed and reduce the utility bill is 0.0464.

To learn more about the binomial distribution from the given link

https://brainly.com/question/15223696

#SPJ4

write four examples of ordered pairs each located in different quadrants of the coordinate plane

Answers

The points (2, 2), (4, - 2), (- 6, - 2), (- 2, 4) are examples of ordered pairs on the coordinate plane.

How to represent ordered pairs on the coordinate plane

Coordinate planes are generated by the intersection of two orthogonal axes, a "horizontal" (x-axis) and a "vertical" (y-axis), at a point known as origin. These axes creates four regions known as quadrants, which are introduced in the image attached below.

All the ordered pairs are points of the form (x, y), where x and y represent the orthogonal positions of the point with respect to the origin. Now we proceed to present four examples of ordered pairs, each located in each quadrant: (2, 2), (4, - 2), (- 6, - 2), (- 2, 4).

To learn more on ordered pairs: https://brainly.com/question/28874341

#SPJ1

write four examples of ordered pairs each located in different quadrants of the coordinate plane
write four examples of ordered pairs each located in different quadrants of the coordinate plane

What is a dependent variable, and what is an independent variable? I forgot.

Answers

Answer:

Independent variable is the measurement that that changes and the dependent variable is the result of the independent variable (aka the one that is being measured).

Step-by-step explanation:

Fifty cupcakes cost 129. What is the unit price for one cupcake?​

Answers

Answer: 2.58

Explanation:
129/50
=2.58

Answer2.58

Step-by-step explanation:

129 / 50 = 2.58


The perimeter of a rectangle is 50ft. If the length is one more than twice the width,
what is the length, width and area?

Answers

Answer: See explanation

Step-by-step explanation:

Let the width of the rectangle be x

Since the length is one more than twice the width. Therefore, the length will be: = 2x + 1

Perimeter of a rectangle = 2(length + breadth)

50 = 2(2x + 1 + x)

50 = 2(3x + 1)

50 = 6x + 2

6x = 50 - 2

6x = 48

x = 48/6

x= 8

Width = 8ft

Length = 2x + 1 = 2(8) + 1 = 16 + 1 = 17ft

Area = Length × Width = 17 × 8 = 136ft^2

No links

find the missing angle measurement.

A) 63°

B) 73°

C) 90°

D) 153°​

No linksfind the missing angle measurement.A) 63B) 73C) 90D) 153

Answers

It’s 63 because a triangle adds up to 180 and u already have 90 and 27. So all u have to do is add 27 and 90 then subtract 180 form what u get and there is your answer

Answer:

90-27= 63°

the sum of the angles are 180°

Step-by-step explanation:

Answer is 63°

The femur, or thigh bone, of an average human is 480 millimeters long. The spinal cord of an average human is 45 centimeters long. What is the total length of a spinal cord and a femur, in meters?

Answers

Answer: 0,93 meter

Step-by-step explanation:

480mm = 48cm

48 + 45 = 93cm

93cm = 0.93m

The total length of a spinal cord and a femur, in meters, is 0.93.

What is unit conversion?

Multiplication or division by a numerical factor, selection of the correct number of significant figures, and unit conversion are all steps in a multi-step procedure.

Given that the femur, or thigh bone, of an average human, is 480 millimeters long. The spinal cord of an average human is 45 centimeters long.

The total length will be calculated as below:-

The value of 480mm will be 48 centimeters.

48 + 45 = 93cm

93cm = 0.93m

Therefore, the total length of a spinal cord and a femur, in meters, is 0.93.

To know more about unit conversion follow

https://brainly.com/question/141163

#SPJ2

Use part one of the fundamental theorem of calculus to find the derivative of the function.
y =
????⁄6 theta tan(theta) dtheta
√x

Answers

The derivative οf the expressiοn will be -1/2 tan√x.

What is derivative?

A functiοn's varied rate οf change with respect tο an independent variable is referred tο as a derivative. When there is a variable quantity and the rate οf change is irregular, the derivative is mοst frequently utilized. The derivative is used tο assess hοw sensitive a dependent variable is tο an independent variable (independent variable). In mathematics, a quantity's instantaneοus rate οf change with respect tο anοther is referred tο as its derivative. Investigating the fluctuating nature οf an amοunt is beneficial.

Y = ⁄6  Tan(θ) √X

dy/dx = (∫θ tanθ dθ) dθ/dx

= -√x tan√x (1/2√x)

=-1/2 tan√x

Hence the derivative οf the expressiοn will be -1/2 tan√x.

Learn more about derivatives, by the following link.

https://brainly.com/question/23819325

#SPJ1

Complete question:

Use part one of the fundamental theorem of calculus to find the derivative of the function.y =????6theta

what is m
help ASAP pleasee!!

what is mhelp ASAP pleasee!!

Answers

Angles. Triangle angles.

The sum of angles of a triangle equals 180°.

Therefore:

|∠EAB| + |∠ABE| + |∠BEA| = 180°

Susbtitute

|∠EAB| = 14°

|∠ABE| = 45°

|∠BEA| = x°

14° + 45° + x° = 180°

59° + x° = 180°    |subtract 59° from both sides

x° = 121°

∠BEA and ∠CED are vertical angles. Vertical angles are congruent, meaning that they have the same angle measure.

Therefore

|∠CED| = 121°

In ΔCDE:

|∠CED| + |∠DCE| + |∠EDC| = 180°

Substitute:

|∠CED| =121°

|∠DCE| = 27°

|∠EDC| = y°

121° + 27° + y° = 180°

148° + y° = 180°    |subtract 148° from both sides

y° = 32°

|∠EDC| = 32°

During a road trip,Ben stopped at two rest stops.In the car park of the first rest stop,

Answers

I need a completed question to answer this problem thx for the points

un auto de carreras puede frenar a razón de -8.0m/s2.
a.si viaja a 38m/s,¿cuantos metros recorrerán antes de detenerse.?
b.¿cuantos metros recorrerán si viaja a 75m/s?​

Answers

Answer:

25  i used g00gle trans

Step-by-step explanation:

Can someone tell me the answer and explanation??

Can someone tell me the answer and explanation??

Answers

Answer:

$15.21

Step-by-step explanation:

Why it would be D is if find out what the 17% is ($2.21) you would add it on top of the $13 and it gives you $15.21 or D.

8. u.s states a state is selcted at random from the 50 states of the united states. what is the probabbilty that it is one of the six mew england states?

Answers

10 %  is the probabbilty that it is one of the six mew england states.

What is the simple definition of probability?

A probability is a number that expresses the possibility or likelihood that a specific event will take place.

              Probabilities can be stated as proportions with a range of 0 to 1, or as percentages with a range of 0% to 100%.

Number of states that touch the Pacific Ocean = N(P) = 5

Total Number of States = (Sample Space)= N(s) = 50

Number of Event/Draw = 1

Therefore;

Probability = N(P) /N(s) = 5/50 = 1/10 = 10 %

Learn more about probability

brainly.com/question/30034780

#SPJ4

Other Questions
Where does memory management reside? In which polygon the number of diagonals is equal with the number of sides a) pentagonb) hexagon c) octagond) something else What is 3 + 3? Please Please help Im bad at math a woman wants to use an easily-reversible contraceptive that protects against hiv, prevents pregnancy, and requires her partner's involvement. she should probably use a(n) Scenario 12-1 Ken places a $20 value on a cigar, and Mark places a $17 value on it. The equilibrium price for this brand of cigar is $15. Refer to Scenario 12-1. How much total consumer surplus do Ken and Mark get when each purchases one cigar? a. $2 b. $1 c. $5 d. $7 What is the area of the parallelogram?11 in.13 inA. 290 in.^2B. 286 in.^2C. 143 in.^2D. 71.5 in^2 use the following equation to answer the question.If only 3100 grams of CO2 are produced, what is the percent error of this reaction? 1. Given the double-stranded stretch of DNA below, determine the base sequence ofmessenger RNA strand produced using this gene as the template. *Hint: Only one of thetwo strands is used as the template.5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'3' TACGGTAACG AATTCGCCCGTAAT ATGGTACT 5AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGAHow many amino acids will this protein contain? what is the easiest and most common way to monetize a mobile app? Given a random sample of size of n=900 from a binomial probability distribution with P=0.50, complete parts (a) through (e) below. a. Find the probability that the number of successes is greater than 500. PX-500)= ____. (Round to four decimal places as needed.) Write each quotient as a complex number.4/(2-3i) 50 POINTS SOMEONE PLEASE HELP WHATS 2+2 A.) 4B.) 2C.)5D.) 1230 What information would you need to determine the minimum coststrategy? Provide your answer along with a discussion on theadvantages and disadvantages of each strategy. What are the 5 main types in the chart of accounts? what is 10 divided by 2 + 17(x-5) Help plas eeeeeeeeeee fingerlike extensions of the intestinal mucosa that increase the surface area for absorption what argument could you provide to the defenses claim that if a suspects cartridge shell castings were not found at a crime scene he must be innocent Determine the volume of concrete needed to construct the curb.Express your answer to three significant figures and include the appropriate units.V3 mm