Answer:
A
Explanation:
Which best defines soil? (1 point)
Responses
Soil is made up of minerals, air, water, and humus.
Soil is made up of minerals, air, water, and humus.
Soil is made of rock and dirt.
Soil is made of rock and dirt.
Soil is made of natural materials that were never living.
Soil is made of natural materials that were never living.
The soil is dark and brown.
will give brainliest
Soil is best defined as a mixture of minerals, air, water, and humus. So the right option is Soil is made up of minerals, air, water, and humus.
Soil is a mixture of minerals, air, water, and organic matter that provides the necessary nutrients and physical support for plants to grow. It is a living ecosystem that is home to millions of microorganisms, fungi, and other organisms that contribute to its health and productivity.
The minerals in soil come from the breakdown of rocks and other geological materials. Air and water are essential for soil structure and nutrient transport. Humus, or organic matter, is made up of dead plant and animal material that decomposes over time, adding nutrients and improving soil structure.
Soil is an important resource that plays a crucial role in agriculture, forestry, and environmental sustainability. It provides a habitat for many plant and animal species, helps regulate the Earth's climate, and plays a role in the carbon cycle.
However, soil can be degraded through erosion, overuse, and pollution. It is important to protect and manage soil resources to ensure their continued health and productivity for future generations.
For more questions on: minerals
https://brainly.com/question/27737827
#SPJ11
Will give brainlist
The temperature of a substance changes from 120 C to 35 C. Which of the following is true?
The Kinetic Energy of the particles did not change.
The particles of the substance resulted in a high Kinetic Energy.
The particles of the substance initially had high Kinetic Energy.
The particles of the substance initially had high Kinetic Energy.
Does the kinetic energy of a particle change as the temperature changes?Gas particles move quickly in all directions and regularly collide with one another and the container's side. The particles gather kinetic energy and accelerate as the temperature rises. The particles' real average speed is influenced by their mass and temperature.
In liquids, particles are quite close together and move with random motion throughout the container. Due to the closer proximity of the particles, collisions between them happen more frequently than in gases even if particles are moving quickly in all directions.
Learn more about kinetic energy:https://brainly.com/question/26472013
#SPJ1
Many biotic factors affect individuals in a population. An example of an organism being directly affected by a biotic factor is
1. a squirrel cannot find a mate
2. a flood washes away a maple tree
3. a plant is in a dark room
4. a chipmunk finds a rock pile to use for a home
Answer:
1. a squirrel cannot find a mate
Explanation:
Biotic factors are living organisms that shape their environment and interact with each other and with abiotic factors, which are nonliving entities. An example of an organism being directly affected by a biotic factor is a squirrel that cannot find a mate. This is because mating is a biotic interaction between two individuals of the same species that affects their reproduction and survival. A flood that washes away a maple tree, a plant that is in a dark room, and a chipmunk that finds a rock pile to use for a home are examples of organisms being affected by abiotic factors, such as water, light, and rocks.
Pls help me solve this. Preferably ASAP
Answer:
c bone marrow and rbc i think correct me if I'm wrong
Why is NAD+ so important if the cell takes the anaerobic pathway, so glycolysis to fermentation? Does the atp made in glycolysis depend on the NAD+ conversion to NADH in the first step? I am confused on why NAD+ is so important to atp production
Answer:
NAD+ (nicotinamide adenine dinucleotide) is indeed crucial for ATP production, even in anaerobic pathways such as glycolysis followed by fermentation. Allow me to explain the significance of NAD+ and its role in ATP production.
During glycolysis, glucose is broken down into pyruvate, producing a small amount of ATP and NADH. The conversion of NAD+ to NADH occurs during the oxidation of certain molecules, including glucose, in the pathway. This conversion is essential because NADH carries high-energy electrons that can be used in subsequent steps to generate more ATP.
In aerobic respiration, NADH is further utilized in the electron transport chain (ETC) within the mitochondria. The ETC transfers electrons from NADH to oxygen, generating a significant amount of ATP through oxidative phosphorylation. However, in anaerobic conditions where oxygen is limited, like during fermentation, the ETC cannot function.
Here's where NAD+ becomes critical. In order to keep glycolysis running and continue generating ATP, the NADH produced during glycolysis must be converted back to NAD+. This allows glycolysis to continue producing ATP, even without the presence of oxygen. Without a mechanism to regenerate NAD+, glycolysis would halt due to a lack of NAD+, leading to a severe reduction in ATP production.
Fermentation pathways differ depending on the organism, but they all involve the regeneration of NAD+. For example, in lactic acid fermentation, pyruvate is converted into lactate, which involves the transfer of electrons from NADH to pyruvate, regenerating NAD+. Similarly, in alcoholic fermentation, pyruvate is converted into ethanol, again regenerating NAD+.
In summary, NAD+ is essential in anaerobic ATP production because it serves as a coenzyme that accepts electrons and facilitates the conversion of NADH back to NAD+. By regenerating NAD+, cells can sustain glycolysis and continue producing ATP, even in the absence of oxygen.
The model illustrates the relationship between
photosynthesis and aerobic cellular respiration. The
reactants needed by the plant for photosynthesis are
CO₂ and H₂O in the presence of sunlight. How does the plant
acquire the H₂O needed for photosynthesis?
A. From cellular respiration
B. Absorption through the roots
C. Osmosis through all plant parts
D. Transpiration through the leaves
Answer: B Absorption through the roots
Explanation: During photosynthesis plants take in carbon dioxide (CO2) and water (H2O)
What is Hypothesis Driven Research?
PLEASE HELP FAST!
Raising livestock and burning trash are two examples of human activities that have an impact on water resources. Select one and construct an argument about whether its effect on water resources is positive or negative. Support your answer with evidence and reasoning
Answer: Negative Effect of Raising Livestock on Water Resources:
Raising livestock contributes to water pollution. According to the United States Environmental Protection Agency (EPA), animal waste is a significant source of water pollution. When animal waste is not adequately managed, it can contaminate nearby water sources, leaving harmful bacteria and nutrients that can impact aquatic life and human health. The EPA estimates that animal feeding operations produce over 500 million tons of manure per year, which is three times the amount of human waste in the United States.
Moreover, raising livestock involves the use of water resources. The amount of water that livestock requires varies depending on many factors such as animal type, weather conditions, and feed production. According to the Food and Agriculture Organization (FAO), raising a cow requires 9900 gallons of water, while raising pigs and chickens requires 700 and 4300 gallons of water, respectively. This creates a significant strain on water resources, especially in areas that already face a water scarcity issue.
Furthermore, raising livestock also contributes to the degradation of riparian habitats. Riparian habitats are those that exist along the banks of rivers and streams. These habitats play an essential role in stabilizing the banks of rivers, filtering pollutants, and providing a natural habitat for aquatic life. However, raising livestock near these areas can result in the trampling of habitats, the destruction of vegetation, and the accumulation of manure. This can lead to erosion, loss of biodiversity, and reduced water quality.
Conclusion:
In conclusion, raising livestock has a negative effect on water resources. By polluting water sources, using significant amounts of water resources, and contributing to the degradation of riparian habitats, the environmental impact of raising livestock poses a significant threat to aquatic life and human health. Unless farming practices are regulated, and best practices are implemented, raising livestock will continue to pose a severe risk to water resources.
Explanation: I don't need one * don't delete my answer cause its not that complicated!!*
Drag the appropriate labels to their respective targets. Label processes on the right in PURPLE, and all other components on the left.
Starting from the top downward:
Group 1:
TranscriptionRNA processingTranslationGroup 2;
DNAPre-mRNAmRNARibosomePolypeptideThe entire setup represents what happens during gene expression. The process starts in the nucleus with genetic information in DNA being transcribed into mRNA.
The pre-mRNA undergoes some processing before being transported to the cytoplasm where it gets attached to the ribosome and utilized in the synthesis of polypeptides (also known as proteins) in a process known as translation.
More on gene expression can be found here: https://brainly.com/question/10706638
1. Explain the contributions of Robert Hooke and how he helped pave the way for futur knowledge. 2. Explain the contributions of Matthias Schleiden and Theodore Schwann.
Answer:
Robert Hooke main contribution is the discovery of cell.
Explanation:
Robert Hooke (1635-1703) is an English physicist. he was the first man who discovered cell by analyzing the cork. This discovery of cell leads the way for future knowledge about the structure of all living organisms. The contributions of Matthias Schleiden was that he was the first man who analyze the structure of plant cell while on the other hand, Theodore Schwann analyze the animal cell and proposed cell theory from that.
.
.
.
.
Human Population Growth
Objectives: Create a graph of human population growth and use it to predict future growth and identify factors
that affect population growth,
Year
1650
1750
1850
1925
1956
1966
1970
1976
1980
1991
2000
2004
2012
Number of People (in billions)
.60
.70
1.0
2.0
2.5
3.3
3.6
4.0
4.4
5.5
6.0
6.5
7,5
Instructions for creating your graph:
Place time on the horizontal axis. Values should range from 1650 to 2050.
Place number of people on the vertical access. Values should range from 0 to 15 billion.
Make sure that your graph is a full page in size and you have the correct labels for the X and Y axis
Create a title for your graph.
中的质量
ARARIORAT
PARIRATURE
MA
¶¶¶ M
Analysis (use your graph to answer the following):
1. It took 1649 years for the world population to double, going from .25 billion people to .50 billion people.
How long did it take for the population to double once again?
A third time?
2. How long did it take for the population to double a second time?,
3. Use a different color to extend your graph to the year 2015,
In what year will the population reach 10 billion?
1. Based on your graph, how many years will it take for the population of 2000 to double?
The graph illustrates exponential growth. Based on the properties of this graph, what does this term mean?
Exponential growth refers to a rapid and continuously increasing rate of population growth over time, resulting in a steep upward curve on the graph.
It took 1649 years for the world population to double, going from 0.25 billion people to 0.50 billion people. To double once again, it would take the same amount of time, approximately 1649 years. A third doubling would also take approximately 1649 years.
The population doubled for the second time in the year 1950. It took around 100 years for the population to double for the second time.
Extending the graph to the year 2015, you would add data points for that year. The specific values would depend on the available population data for that year.
According to the graph, the population is projected to reach 10 billion around the year 2050.
Based on the graph, it appears that the population of 2000 will double in approximately 40 years. However, since the specific year for the population value of 2000 is not provided, the exact number of years cannot be determined.
The graph illustrates exponential growth. This term means that the population is increasing at an accelerating rate over time. As the population grows, the rate of increase becomes more significant, resulting in a steep upward curve on the graph. This indicates a rapid and continuous growth pattern rather than a linear or constant rate of growth.
Know more about Exponential growth here:
https://brainly.com/question/10284805
#SPJ8
The concentration of the solute in the soltuion is the same as the concentration inside the cell.
a. hypertonic solution
b. isotonic solution
c. hypotonic solution
What is dialog?
A. A special kind of log only found in Scandinavian forests
B. all the words in a story
C. The words characters say
D. the characters in the story
Answer:is b why because take part in a conversation or discussion to resolve a problem.
Explanation:
When most main sequence stars exhaust their hydrogen supply, they become giants. Yet on the diagram, there are not
many stars between the main sequence and the giants. What would explain this fact?
Answer:
Main sequence stars change into giant star by exhausting their hydrogen supply.
Explanation:
This fact explain that main sequence stars change into giant star by exhausting their hydrogen supply. A main sequence star burns due to the presence of hydrogen in its core, because of this burning the main sequence reaching the end of its life cycle. Then the pressure of fusion reaction provides an outward thrust that expands the star many times larger than its original size, that leads to the formation of a red giant.
Answer:
As soon as the hydrogen is used up, the star turns to a giant very quickly, spending little time in the transition.
Explanation:
plato
Select the correct answer. Simplify the following expression. (4x + 7)2 a. 16x2 - 49 b. 16x2 + 56x + 49 c. 16x2 + 28x + 49 d. 16x2 + 49.
To simplify the expression (4x + 7)2, we need to apply the formula for squaring a binomial
Step 1: Identify the values of a and b in the formula\((a + b)2.\)
In this case, a = 4x and b = 7.
Step 2: Substitute the values of a and b into the formula and simplify.
\((a + b)2 = a2 + 2ab + b2(a + b)2 = a2 + 2ab + b2\)
where a = 4x and b = 7.
Substituting these values into the formula, we get:
\((4x + 7)2 = (4x)2 + 2(4x)(7) + 72\)
\(= 16x2 + 56x + 49\)
Therefore, the correct answer is (b) \(16x2 + 56x + 49.\)
To learn more about binomial refer to this link
https://brainly.com/question/13870395
#SPJ4
Which word best describes the extent to which scientists have identified fungi species?
Answer:
does it give you options like a multiple choice or just a word form your head
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt
What is the first branch of the evolutionary tree
The first branch of the evolutionary tree is believed to be the separation between prokaryotes (organisms lacking a cell nucleus) and eukaryotes (organisms with a cell nucleus).
The evolutionary tree, also known as the tree of life or phylogenetic tree, represents the evolutionary relationships between all living organisms on Earth. It illustrates the diversification of life over time, showing how different species are related to one another through common ancestors.
1. The first step in understanding the first branch of the evolutionary tree is to recognize that all life on Earth can be classified into three main domains: Bacteria, Archaea, and Eukarya.
2. Among these domains, Bacteria and Archaea are considered prokaryotes, which are single-celled organisms lacking a membrane-bound nucleus. They are believed to have diverged from a common ancestor.
3. Eukarya, on the other hand, comprises organisms with eukaryotic cells, which possess a nucleus surrounded by a membrane. This domain includes all complex organisms such as plants, animals, fungi, and protists.
4. The separation between prokaryotes and eukaryotes is considered the first major branch in the evolutionary tree. It represents a fundamental divergence in cellular structure and complexity.
5. While the exact details and timing of this divergence are still the subject of scientific investigation, it is generally believed to have occurred billions of years ago, early in the history of life on Earth.
6. This initial split paved the way for the subsequent diversification of life, leading to the vast array of species and ecosystems we observe today.
7. It is important to note that the evolutionary tree is a constantly evolving representation of our understanding of the relationships between organisms. New discoveries and advances in scientific knowledge may lead to revisions and refinements of the tree over time.
For more such questions on organisms, click on:
https://brainly.com/question/17943188
#SPJ8
Which would most affect the health of fish in a Local pond
Answer:
The daily release of hot water into the pond from a local factory.
What are the stages of bee development (eggs,larvae,pupae)
The stages of bee development are egg, larva, pupa, and adult. Eggs hatch into larvae, which then transform into pupae. Finally, adult bees emerge and undergo further maturation.
The stages of bee development are:
1. Egg: The bee life cycle begins when the queen bee lays an egg in a honeycomb cell.
2. Larva: The egg hatches into a larva, which is a legless, grub-like creature. The larva is fed a special diet called royal jelly, which stimulates its growth.
3. Pupa: The larva undergoes metamorphosis and transforms into a pupa. Inside the sealed cell, the pupa undergoes various changes, developing into an adult bee.
4. Adult Bee: After completing the pupal stage, the fully developed adult bee emerges from the cell. The bee then undergoes further maturation, such as its exoskeleton hardening, wings expanding, and adult coloration appearing.
It's important to note that there are three castes of bees: queen, worker, and drone. The development process for each caste is similar, but the diet and size of the cells they are raised in differ, leading to their distinct roles within the colony.
For more questions on bee development:
https://brainly.com/question/28696131
#SPJ8
Which is controlled by a negative feedback loop, blood glucose levels after eating or estrogen levels in the days prior to ovulation?
Answer:
An important example of negative feedback is the control of blood sugar. After a meal, the small intestine absorbs glucose from digested food. Blood glucose levels rise. Increased blood glucose levels stimulate beta cells in the pancreas to produce insulin.
State one difference between the sperm cell and the cells in the developing fetus
Answer:
One significant difference between a sperm cell and the cells in the developing fetus is that a sperm cell is a specialized reproductive cell carrying genetic material from the father, while the cells in the developing fetus are diploid cells containing a combination of genetic material from both the mother and the father. In other words, sperm cells are haploid (containing half the usual number of chromosomes) and are involved in fertilization, while fetal cells are diploid and contribute to the development of the individual.
Ball-and-socket joints allow this gymnast to complete many of the routines that she performs. A gymnast is shown. In which part of the body is a ball-and-socket joint found? wrist elbow hip knee
Answer:
c
Explanation:
There is a ball-and-socket joint in the hip area of the body. So, the correct option is C.
What is Ball-and-socket joint?The hip is home to the ball and socket joint. It is situated where the pelvic bone and femur (the thigh bone) meet. An example of a ball and socket joint is one in which one bone exactly resembles a ball and another bone precisely resembles a hollow or socket into which the first bone would fit.
This facilitates the bone's mobility in all planes. As a result, the hip has a ball and socket joint and can move in all directions. When compared to other joints, which are found in the fingers, knees, elbows, and toes, ball-and-socket joints, such as those in the shoulder and hip, permit only bending and straightening motions.
Therefore, the correct option is C.
Learn more about Ball and Socket joint, here:
https://brainly.com/question/13777636
#SPJ7
Your question is incomplete, most probably the complete question is:
Ball-and-socket joints allow this gymnast to complete many of the routines that she performs.
In which part of the body is a ball-and-socket joint found?
A. Wrist
B. Elbow
C. Hip
D. Knee
Though it occurs naturally in lakes, human activities can increase
A the water table
B eutrophication
C tributaries
D reservoirs
Human activities can increase eutrophication. Option B
What is known as eutrophication?The process through which a body of water, such as a lake or river, gets enriched with nutrients, mainly nitrogen and phosphorus, is what is called eutrophication.
This water enrichmnt can be caused by natural or human activities like agriculture, wastewater treatment plant discharge, or air pollution from fossil fuels
Eutrophication can affect aquatic ecosystems negativly. This can lead to loss of biodiversity, or evn changes in the food web. It is also known to reduced recreational and beauty of of our water bodies.
Find more exercises on eutrophication;
https://brainly.com/question/13232104
#SPJ1
what percent of the acacia trees energy will be transferred to the giraffe?
The giraffe only receives 10% of the energy from the acacia tree because the other 90% was used in cellular respiration.
Each level only retains 10% of the original 100% of energy because no matter what animal species it is, it will use up 90% of the energy for cellular respiration.
Why does natural selection occur more when there is competition for resources?
Natural selection occurs more prominently when there is competition for resources because competition creates selective pressures that drive adaptations and favor certain traits over others.
In any given environment, resources necessary for survival and reproduction, such as food, water, and shelter, are limited. As a result, individuals within a population must compete with one another to obtain these resources.
Competition leads to differential survival and reproductive success among individuals.
Those individuals with advantageous traits or variations that enable them to more effectively acquire and utilize resources have a higher likelihood of survival and producing offspring.
These advantageous traits can be physical characteristics, physiological adaptations, or behavioral strategies that provide a competitive edge.
Through natural selection, individuals possessing beneficial traits are more likely to pass on their genes to the next generation, while individuals with less favorable traits are at a disadvantage.
Over time, this process results in the accumulation of beneficial traits within the population, enhancing their overall fitness and adaptation to the specific environment.
Therefore, competition for resources acts as a driving force for natural selection by selecting for traits that enhance an individual's ability to secure limited resources, survive, and reproduce successfully.
For more such answers on Natural selection
https://brainly.com/question/23929271
#SPJ8
how many milliliters of acetic acid solution (contents of weigh boat C) did you have to add to neutralize the contents of Beaker B, the sodium bicarbonate?
Answer: SDFGHNJMNJHIBUGVFCVGBJHNK
Explanation:DXGNK MBFCHBJKN
What are the six characteristics of living things?(one word for each) 1.have 2.use 3. 4.grow and 5.respond to 6. Blank 1: Blank 2: Blank 3: Blank 4: Blank 5: Blank 6:
Explanation:
1. Have
2. Use
3. Energy
4. Grow
5. Respond to
6. Environment
10 points! please help
Answer:
2,3,4,5
Explanation:
dnnsnsnszjjsnana
Which sex is more likely to have a
recessive, sex-linked trait? Explain your
answer.
Answer:
A male with a mutation in a gene on the X chromosome is typically affected with the condition. Because females have two copies of the X chromosome and males have only one X chromosome, X-linked recessive diseases are more common among males than females.