What is peer review? Why is it important? (Site 1)

Answers

Answer 1

Answer:

it's a quality control measure for medical research

Explanation:

its a process in which professionals review each other's work to make sure that it is accurate, relevant, and significant. Scientific researchers aim to improve medical knowledge and find better ways to treat disease.


Related Questions

How does a change in the DNA sequence affect the amino acid produced during translation?

A) A change in the DNA sequence sometimes changes the RNA sequence, which could lead to a different amino acid during translation.
B) A change in the DNA sequence does not affect the RNA sequence, but may lead to a change in the amino acid sequence.
C) A change in the DNA sequence changes the RNA sequence, which sometimes leads to a change in the resulting amino acid
D) A change in the DNA sequence results in a change to the RNA sequence, but does not change the amino acid created.

Answers

When the DNA or RNA sequences are altered, the resultant amino acid can occasionally change as a result. A completely new sequence of amino acids may be produced as a result of how the ribosome interprets the mRNA sequence.

The amino acid sequence of the protein that the gene codes for can be altered by changes to the DNA sequence of that gene, a process known as mutation. A single DNA letter can change in a point mutation. They can be divided into three categories: Missense mutations alter a protein's single amino acid. DNA sequence modifications are known as mutations. Viral infection, mutagen exposure, or errors in DNA replication during cell division can all lead to mutations.

As a result, option C, which reads: "A change in the DNA sequence affects the RNA sequence, which occasionally results in a change in the resultant amino acid," is the right statement.

LEARN MORE ABOUT MUTATION HERE:

https://brainly.com/question/17130462

#SPJ1

HELP Unit 8 lesson 3 Investigating Water Quality Lab Portfolio Item/Water Quality Analysis Lab Report.
Using the Water Quality Testing activity, you will be collecting data about the Chesapeake Bay, the Great Lakes, and the Gulf of Mexico over many years. Explore the program to learn about the four measures of water quality at different times. Determine how to collect data about a single body of water over time in a table format. While it is important that you become familiar with the variability of the data over a single water body, for the purposes of further analysis, in your tables cite the means for pH, temperature, and turbidity. For dissolved oxygen data, cite the area of the "dead zone." Complete the tables, including headings.

Answers

Answer:

To collect data about a single body of water over time in a table format, you can create a table with the following headings: Date, Time, pH, Temperature, Turbidity, and Dissolved Oxygen.

Under the pH, Temperature, and Turbidity columns, you can cite the means for each of these measures over time. For example, you can calculate the mean pH, temperature, and turbidity for each month or year, depending on how often you are collecting data.

For dissolved oxygen data, you can cite the area of the "dead zone" where dissolved oxygen levels are below 2 mg/L. You can indicate the size of the dead zone and the location where it was observed.

By creating a table with these headings and including the means for pH, temperature, and turbidity, as well as the area of the "dead zone" for dissolved oxygen data, you can track changes in water quality over time and identify trends that may require further analysis.

Hope this helped :)

Answer:

I don't have access to the Water Quality Testing activity or the tables you need to complete. Can you please provide more details or share the relevant documents or links so I can assist you better?

Explanation:

How the model in the image supports this statement: The body carries critical life functions through systems specialized cells

Answers

Some cells in the body have special jobs they are really good at doing. They are called specialized cells.

What is the specialized cells?

The human body has lots of tiny cells, and each of them is different and has a special job to do.  This group helps with important things needed to survive.

One type of cells carry oxygen and another type send electrical signals in our body. Specialized cells help the body do important things. Tissues: Groups of similar cells form tissues, such as muscle tissue, connective tissue, and epithelial tissue.

Learn more about   specialized cells from

https://brainly.com/question/7869758

#SPJ1

can chemical energy from food
be converted to electrical energy

Answers

The body converts the chemical energy in food into mechanical energy and heat. The chemical energy in coal is transformed into electrical energy at a power plant.

so the answer to your question is yes.

Yup it can be converted to electrical energy

5. I am liquid water that is currently precipitating. Where am I?
MULTIPLE CHOICE
In the atmosphere
On Earth's surface
In the ground/rock layers
In the Earth's oceans

Answers

On earth’s surface ………

ANSWER ASAP

Charles Darwin’s findings were pivotal to the formation of the theory of evolution. He noted that the Galapagos Islands, which are located about 1,000 kilometers away from South America, were made up of different types of finches. These species were all believed to have evolved from a species on the mainland, but they developed different adaptations to survive in their environment. Based on this information and the image, answer the following questions.

ANSWER ASAPCharles Darwins findings were pivotal to the formation of the theory of evolution. He noted

Answers

Answer:

What is the Galapagos Islands in Ecuador the site of Darwin's note on?

Darwin first came to the Galápagos in 1835, on a ship called the HMS Beagle. His observations of wildlife on the island inspired his theory of evolution by natural selection

A generator converts mechanical energy into_____ energy

Answers

Answer:

electrical

Explanation:

A generator converts mechanical energy into electrical energy.


hope it helps!

Answer: Electric energy

Explanation: When a Generator moves it uses mechanical energy then while it moves it creates Electrical energy. Btw Your Welcome :D

Mark and Nancy both take three measurements of the length of a pencil that is 15.1 cm. Mark records 15.0, 15.0, and 15.1 cm. Nancy records 15.1, 15.2, and 15.2 cm. Which of the following statements is true about Mark and Nancy's measurements?
A. Mark's measurement is more precise.
B. Nancy's measurement is more accurate.
C. Mark's measurement is more accurate.
D. Both sets of measurements are equally accurate and precise.​

Answers

The true statement on Mark and Nancy's measurements is D. Both sets of measurements are equally accurate and precise.

How accurate are the measurements ?

The closeness of a measurement to its exact value is known as accuracy, while the degree of reproducibility or repeatability pertains to precision. Mark and Nancy's measurements closely mirrored the fundamental value of 15.1 cm; however, Mark deviated slightly below while Nancy stood above it.

Their sets of measurements are similar in this regard, thus rendering them equally accurate. Notably, their range of values displays a counterpart pattern with Mark's readings differing by just 0.1 cm and that of Nancy ranging from 0.1-0.2 cm. Hence, both sets share a similar level of precisions too.

Find out more on accuracy at https://brainly.com/question/14523612

#SPJ1

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

A crime scene has the following blood splatter against a wall 2 feet from where the victim was standing what type of impact would have caused this pattern 

Answers

Answer:How It’s Done. Bloodstain Patterns that May be Found. Bloodstains range in both amount of blood and type of pattern—from pools of blood around a body to obvious spatter patterns on the walls to microscopic drops on a suspect’s clothing.

Explanation:

Some types of muscular dystrophy are X-linked recessive disorders. A mother who is a carrier for muscular dystrophy has children with a father who doesn’t have muscular dystrophy.
a. What percentage of their sons will have the disease, and what percentage of their sons will be carriers?
b. What percentage of their daughters will have the disease, and what percentage of their daughters will be carriers?

Show your work with a Punnett Square, using XD to represent the allele not associated with muscular dystrophy and Xd to represent the allele associated with muscular dystrophy. You can copy/paste the blank table below or create a table in the submission box to complete the Punnett square.

Some types of muscular dystrophy are X-linked recessive disorders. A mother who is a carrier for muscular

Answers

D gene is an X-chromosome-linked gene. a) 100% will have the disease, XdY // 0% will be carriers. b) 0% will have the disease // 100% will be carriers, XDXd.

What are the séx-linked genes?

These are genes that can be found only in the X-chromosome. The inheritance pattern expressed by these genes varies from the one expressed by genes located in autosomal chromosomes.

In the exposed exampe,

- muscular dystrophy are X-linked recessive disorders

- woman ⇒ carrier for muscular dystrophy ⇒ heter0zyg0us ⇒ XDXd

- man ⇒ doesn’t have muscular dystrophy ⇒ X-chromosome with the dominant allele ⇒ XDY

- XD ⇒ chromosome rarrying the dominant allele

- Xd ⇒ chromosomes carrying the recessive allele

Cross: Man x Woman

Parentals)   XDY     x      XDXd

Gametes) XD   Y           XD   Xd

Punnett square)       XD           Xd

                      XD   XDXd       XDXd

                      Y      XdY           XdY

F1) 1/2 = 50% of the progeny will express the normal phenotype,  XD-

    1/2 = 50% of the progeny will have muscular dystrophy, Xd-

    100% of the girls will be normal and carriers,  XDXd

    100% of the boys have muscular dystrophy, XdY

a. What percentage of their sons will have the disease, and what percentage of their sons will be carriers?

Considering only boys,

100% of them will have the disease, XdY0% will be carriers.

b. What percentage of their daughters will have the disease, and what percentage of their daughters will be carriers?

Considering only girls,

0% of them will have the disease, 100% will be carriers, XDXd

You will elarn more about séx-linked genes at

https://brainly.com/question/15570

https://brainly.com/question/786413

4. Which of the following terms describes a disturbance that transfers energy from
one point to the other
a. A vacuum
b. A medium
c. A wave
d. None of the above

5. Which of these is not true about gamma rays ? a. They can travel through a medium b. The energy of the wave increases as the frequency increases The energy of the wave increases as the length of the wavelength increases d. They can travel through spacel a vacuum

6. X rays are called ionizing radiation because a. The radiation removes electrons from atoms b. The radiation does not disrupt chemical bonds The radiation keeps living tissues in tact d. The radiation has low frequency

Answers

Answer:

4. A

5. They can travel through a medium

6. The radiation removes electrons from atoms

Explanation:

Hope this helps:)

4. The ATP yield from 2 moles of mitochondrial NADH under aerobic conditions in a eukaryotic cell would be: which option is correct a) 1 mole of ATP b) 2 moles of ATP c) 3 moles of ATP d) 4 moles of ATP e) 6 moles of ATP​

Answers

The ATP yield from 2 moles of mitochondrial NADH under aerobic conditions in a eukaryotic cell is approximately 4 moles of ATP.

During oxidative phosphorylation, each mole of NADH can generate around 2.5 to 3 moles of ATP. Therefore, for 2 moles of NADH, the total ATP production would be in the range of 4 to 6 moles of ATP. While the more precise estimate falls within the 4 to 6 moles range, the closest option provided is 4 moles of ATP. It is important to note that the exact ATP yield can vary depending on factors such as the efficiency of the electron transport chain and the specific conditions within the cell.

Since there are 2 moles of mitochondrial NADH, the total ATP yield would be around 4 to 6 moles of ATP. However, the most accurate option among the given choices is 4 moles of ATP.

For more questions on ATP yield:

https://brainly.com/question/15543060

#SPJ8

How is Sexual Reproduction is more successful than sexual reproduction

Answers

Answer:

The offspring of sexually reproducing organisms are all genetically unique. Because of this, sexually reproducing organisms may have more successful survival of offspring in environments that change than asexually reproducing organisms, whose offspring are all genetically identical.

Explanation:

Looked it up. I'm sorry if it's wrong.

The production, use, and disposal of synthetic materials can have various impacts on individuals, society, and the .

Answers

Answer:

Environment

Explanation:

I think of it as cars driving around running on fuel/gas, and polluting the air with CO2 (Carbon Dioxide) in which has various impacts on [NOT ONLY individuals, and society] but, the environment.

Source: Quiziz - MATERIALS SCIENCE

What contributes to cell membrane fluidity? Proteins and lipids exist as separate but loosely attached molecules that can move around Protein enzymes create the fluidity. The cell is bathed in water. The transport of substances through the membrane makes it fluid.

Answers

Answer:

Proteins and lipids exist as separate but loosely attached molecules that can move around

Explanation:

Cell membranes are mainly composed of lipids, proteins, and also carbohydrates. Phospholipids are the most abundant type of lipid and the main constituent of the cell membranes. Membrane proteins are divided into two types according to their interactions with the cell membrane: 1-integral (intrinsic) and peripheral (extrinsic) proteins. These peripheral proteins are loosely attached by ionic bonds or calcium bridges with the phosphate heads of the phospholipids; whereas integral membrane proteins contain side chains that interact with fatty acyl groups of the phospholipids. Cell membrane fluidity indicates how easily lipids (e.g., phospholipids and cholesterol) and proteins (e.g., intrinsic proteins) diffuse laterally in the cell membrane. This fluidity is affected by the amount of cholesterol, temperature, and the ratio of unsaturated to saturated fatty acids. Saturated fatty acids have no double bonds in the hydrocarbon chain, whereas unsaturated fatty acids have at least one double bond (these double bonds increase fluidity). Moreover, higher temperatures increase membrane fluidity, whereas cholesterol molecules function to regulate membrane fluidity: at high temperatures cholesterol molecules stabilize the membrane, whereas at low temperatures intercalate between phospholipids, thereby preventing them from clustering together.

Marking as brainliest

Marking as brainliest

Answers

Answer:

Z = 2 and A = 4

Explanation:

A child uses her hand to measure the width of a tabletop. Her hand has a width of 8.3 cm at its widest point, and she finds the tabletop to be 15.5 hands wide.

Answers

Answer:

see below

Explanation:

To find the width of the tabletop in cm, we can multiply the number of hands by the width of one hand.

Width of tabletop = 15.5 hands x 8.3 cm/hand

Width of tabletop = 129.45 cm

So, the width of the tabletop is 129.45 cm.

Which two options are examples of making inferences from scientific
observations?
A. Predicting when it will rain based on satellite images of the
atmosphere
B. Using video footage to measure the speed of a running cheetah
C. Counting the number of black bears in a location
D. Describing the diet of a dinosaur based on the study of its
fossilized droppings
SUBMIT

Answers

Answer: ITS B

Explanation:

Answer:

A. Describing the diet of a dinosaur based on the study of its fossilized droppings.

D. Predicting when it will rain based on satellite images of the atmosphere.

Explanation:

answer A and D

define the term chylomicron​

Answers

Fat found in blood and lymphatic fluid
Chylomicrons are large triglyceride-rich lipoproteins produced in enterocytes from dietary lipids—namely, fatty acids, and cholesterol.

1 point
We all started as a single cell (zygote). This cell undergoes cell division
(mitosis) and over time becomes a fetus. This is an example of this
characteristic of life... *
We have evolved over time
We have grown and developed
We have DNA
We respond to our environment

Answers

Answer:

We have grown and developed

Explanation:

Two lizards with different coloring exist within the same ecosystem. One lives in the trees, and the other prefers hiding among rocks. They are separate species because

they behave differently
they have different characteristics
they cannot successfully reproduce
they exist within the same ecosystem

Answers

they have different characteristics

Answer:

ITS D

Explanation:

i took the test. live long friends ^w^

Monomers linked together to form a polymer could be described as beads in a multicolored necklace. Which statement about monomers is true with respect to the above analogy?

A. Monomers in a polymer could be linked in various ways.
B. Monomers in a polymer are of different types.
C. Monomers in a polymer look different but are structurally similar.

Answers

The answer is B

Monomers linked together to form a polymer could be described as beads in a multicolored necklace because monomer in a polymer are of different types.

Why is it more important to check for errors during DNA replication than
during protein synthesis?
A. Errors in DNA do not have any negative effects.
B. Errors in DNA replication affect only one cell.
C. Proteins function correctly even with errors.
D. An error in transcription affects only one cell.

Answers

Answer:

D. An error in transcription/transportation affects only one cell.

Explanation:

I hope this helps.

Have a good rest of your day.

2. During which phase would the cell undergo anaphase? *
A. Phase A
B. Phase B
C Phase C
D. Phase D

2. During which phase would the cell undergo anaphase? *A. Phase AB. Phase BC Phase CD. Phase D

Answers

Anaphase occurs during the M phase (mitosis) of the cell cycle and is not represented by any of the provided options (A, B, C, or D).

Anaphase is a critical stage in cell division, specifically in mitosis or meiosis. It occurs after metaphase and before telophase. During anaphase, the sister chromatids, which are replicated chromosomes held together by a centromere, separate and move towards opposite ends of the cell.In the context of the cell cycle, anaphase takes place during mitosis. The cell cycle consists of four phases: G1 (gap 1), S (synthesis), G2 (gap 2), and M (mitosis). Mitosis is the M phase, which further consists of four stages: prophase, metaphase, anaphase, and telophase.

Therefore, the correct answer is not provided in the given options. Anaphase occurs during the M phase or mitosis and is not associated with any specific phase (A, B, C, or D) mentioned in the question.

For more such questions on Anaphase:

https://brainly.com/question/29399008

#SPJ8

Cystic fibrosis (CF) is one of most common recessive disorders among Caucasians it affects 1 in 1,700 newborns. What is the expected frequency of carriers of the CF gene? What proportion of matings in the population could produce a child with CF? What is the expected incidence of CF among the offspring of two parents who are both carriers?

Answers

Answer: The expected frequency of carriers is P(Aa)=0.046.

The proportion of childs with CF is P(aa)=0.024.

25% of having a child with CF (aa).

Explanation:

Hardy-Weinberg's principle states that in a large enough population, in which mating occurs randomly and which is not subject to mutation, selection or migration, gene and genotype frequencies remain constant from one generation to the next one, once a state of equilibrium has been reached which in autosomal loci is reached after one generation. So, a population is said to be in balance when the alleles in polymorphic systems maintain their frequency in the population over generations.

Given the gene allele frequencies in the gene pool of a population, it is possible to calculate the expected frequencies of the progeny's genotypes and phenotypes. If P = percentage of the allele A (dominant) and q = percentage of the allele a (recessive), the checkerboard method can be used to produce all possible random combinations of these gametes.

Note that p + q = 1, that is, the percentages of gametes A and a must equal 100% to include all gametes in the gene pool.

The genotypic frequencies added together should also equal 1 or 100%, and all the equations can be summarized as follows:

\(p+q=1\\(p+q)^{2} = p^{2} +2pq+q^{2} = 1\\P(AA)=p^{2} \\P(aa)=q^{2} \\P(Aa)=2pq1\)

So, there are 1700 individuals and only one is affected. Since it is a recessive disorder, the genotype of that individual must be aa. So the genotypic frequency of aa is 1/1700=0.000588.

Then, \(P(aa)=q^{2}=0.000588\). And with that we can calculate the value of q,

\(P(a)=q=\sqrt{0.000588}=0.024\)

And since we know that p+q=1, we can find out the value of p.

\(p+0.024=1\\1-0.024=p\\p=0.976\)

Next, we find out the genotypic frequency of the genotype AA:

\(P(A)=p=0.976\\P(AA)=p^{2} = 0.976^{2}=0.95\)

Now, we can find out the genotypic frequency of the genotype Aa:

\(P(Aa)=2pq=2 x 0.976 x 0.024 = 0.046\)

Notice than:

\(p^{2} + 2pq + q^{2} = 1\\x^{2} 0.976^{2} + 2 x 0.976 x 0.024 + 0.024^{2} = 1\)

Then, the expected frequency of carriers is P(Aa)=0.046

The proportion of childs with CF is P(aa)=0.024

If two parents are carriers, then their genotypes are Aa.

Gametes produced by them can only have one allele of the gene. So they can either produce A gametes, or a gametes.

In the punnett square, we can see that there genotypic ratio is 2:1:1 and the phenotypic ratio is 3:1. So, there is a probability of 25% of having an unaffected child, with both normal alleles (AA); 50% of having a carrier child (Aa) and 25% (0.25) of having a child with CF (aa).

Cystic fibrosis (CF) is one of most common recessive disorders among Caucasians it affects 1 in 1,700

explain why the nucleus of the ovum was removed​

Answers

The nucleus could be removed from the ovum for the purpose of Reproductive Cloning.

Nucleus in the ovum

To establish a recipient cell that can accept the nucleus from another cell, usually a somatic cell (body cell) of the same or different organism, the nucleus is removed from an ovum in the context of reproductive cloning.

The resulting rebuilt ovum with the transplanted nucleus can then be artificially induced to develop into an embryo, possibly leading to the birth of a cloned organism.

Learn more about ovum:https://brainly.com/question/15189522

#SPJ1

The reason why the nucleus of the ovum was removed​ was that  that it will read and duplicate the DNA of the donor cell.

What is cloning?

The technique of creating unique organisms with identical genomes, either through artificial or natural means,  can be described as cloning.  However the Cloning is the method of constructing cloned creatures from DNA fragments and cells in the realm of biotechnology.

It should be noted that this is a variety of procedures that can be used to create biological copies that are genetically identical to the original. A clone is a copy of a substance that shares the same genetic make-up as the original.

Learn more about  nucleus at;

https://brainly.com/question/9376695

#SPJ1

Is a iguana a secondary consumer?

Answers

Answer: no

Explanation:

Yes - they eat primary consumers

1. Earth's atmosphere is divided into layers based on
a. Density
b. Pressure
c. Composition
d. Temperature
6th Grade Science
PLS HELP ITS DUE TOMORROW

Answers

D.Temperature


Explanation-The atmosphere can be divided into layers based on its temperature, as shown in the figure below. These layers are the troposphere, the stratosphere, the mesosphere and the thermosphere. A further region, beginning about 500 km above the Earth's surface, is called the exosphere

Euglena are protists commonly found in lakes and other bodies of water. The diagram shows a Euglena.
cell
membrane
flagella
eyespot
chloroplast
nucleus
How does the structure of a Euglena compare with the structures of members of Kingdom Bacteria and Kingdom Plantae?
This protist has a flagellum for movement like some bacteria but also has an eyespot to sense light like some plants.
This protist has a cell membrane like bacteria but also has a chloroplast to squeeze out excess water like some plants.
This protist has a nucleus to control cell activities like some bacteria but also has an eyespot like some plants.
This protist is single-celled like some bacteria but also has chloroplasts to perform photosynthesis like some nlanti

Euglena are protists commonly found in lakes and other bodies of water. The diagram shows a Euglena.cellmembraneflagellaeyespotchloroplastnucleusHow

Answers

The protist is single-celled like some bacteria but also has chloroplasts to perform photosynthesis like some plants.

According to this question, the structure of an euglena is given. The euglena is a protist that contains the following organelles: cell membrane, flagella, eyespot, chloroplast, and nucleus.

The euglena as a protist is similar to some bacteria by the possession of a single cells but similar to plant cells by possession of chloroplast for photosynthesis.

Learn more about euglena at: https://brainly.com/question/5186929?referrer=searchResults

Other Questions
Geographers call regular alterations of flow rates of energy or matter of a flow system _____________. Answers: A. time cycles B. inflows C. outputs D. equilibrium states According to Kant, theft might be justified in extreme circumstances. Group of answer choices False True Convert the following rectangular coordinates to Polar form: a. (5,8) b. (-6, 1) c. (2,-3) Convert the following Polar coordinates to rectangular form: a. (5,220) b. (-2, 1959) c. (6, 1459) What is the period of the function y = - 3 sin 2x? a. 2 b. - 3 C. d. e. 2A I 2 Consider Line 1 which is given by the equation:6x+3y=0Give the equation in slope-intercept form of the line parallelto Line 1 which passes through(8,5) : _____ Give the equation in slope-i the length of a rectangle is increasing at a rate of $4$ inches per second while its width is decreasing at a rate of $3$ inches per second. at what rate, in square inches per second, is the area of the rectangle changing when its length is $23$ inches and its width is $18$ inches? En los Juegos Olmpicos de Invierno de 2022, un pas gan un total de 150 medallas. Se muestra un grfico circular de las medallas. un grfico circular titulado Medallas Olmpicas de Invierno 2022, con tres secciones etiquetadas como oro 20 por ciento peavey enterprises purchased a depreciable asset for $30,000 on april 1, year 1. the asset will be depreciated using the straight-line method over its four-year useful life. assuming the asset's salvage value is $3,600, what will be the amount of accumulated depreciation on this asset on december 31, year 3? Van der waals interactions are electrostatic interactions.a. true b. false (c) (0.5 pts) assign each reaction (the one under standard conditions and the one in yeast mitochondria) as being exergonic or endergonic. explain your reasoning Question 8 of 10Fill in the blank in the following sentence with the appropriate indirect objectpronoun below.A nosotrosgustaba jugar en el csped.A. nos B. lesC. te D. los 1 point) solve the following initial value problem: tdydt 9y=2t with y(1)=1. (find y as a function of t .) Find the area of the region described. The region bounded by y = 4(x + 1), y = 5(x + 1), and x = 7 The area of the region is _______ (Type an exact answer.) There are 1.6 million shares in the company on the market, costing 6.4 Euros (per share). Greeneco's debt amounts to 42.4 million euros. The cost of its debt is 5.5%. Greeneco is taxed at a rate of 36.0%.If the cost of equity is 18.3%, what is Greeneco's weighted average cost of capital? 5. What do the other Cyclopes think Polyphemus is saying when he says,"Nohbody's tricked me"? Can you think of a way to explain Hubble's Law other than thestandard Big Bang idea, which includes the concept of a Universewith no center and no edge? Given a 10.0 mL sample of the unknown Ba(OH)2 solution, calculate the concentration of the solution if it took 12.08 mL of a 0.0980 M H2SO4 to reach the equivalence point.suppose that for the same 10.0 ml sample above, the mass of the crucible with precipitate was 17.550 g, and the mass of the empty crucible (tare weight) was 17.410 g. calculate the concentration of the Ba(OH)2 solution from this data. Explain how you would solve a triangle given two sides and the included angle. Name and explain two factors that contribute to detrimental relationships Find the value of X in the equation below. Please explain step by step and I will mark you brainliest.xm=x+z