Answer:
In operational research, the term 'model' is usually taken to mean a representation of a situation. This representation is usually expressed in terms of symbols. Such models are used widely in science but are unusual in much managerial decision making.
Which of the following illustrates a positive feedback mechanism?
Multiple Choice
Body temperature control.
Uterine contractions during childbirth.
Maintenance of blood pressure.
Control of blood sugar.
Answer:
(b) uterine contractions during childbirth.
Explanation:
increase in uterine contractions when uterine stretching increases during childbirth
Uterine contractions during childbirth
Explanation:
Positive feedback mechanisms amplify or reinforce changes that have occurred in the body rather than counteracting them. In the case of uterine contractions during childbirth, the initial contractions of the uterus cause the release of the hormone oxytocin, which then stimulates further contractions. This positive feedback loop continues until the baby is born.
In contrast, body temperature control, maintenance of blood pressure, and control of blood sugar are all examples of negative feedback mechanisms, which work to maintain a stable internal environment by counteracting changes that occur in the body.
*IG:whis.sama_ent
Draw a geologic feature with at least three layers that demonstrates the principle of lateral continuity.
A geologic feature with at least three layers that demonstrates the principle of lateral continuity is called a Grand Canyon.
According to the lateral continuity concept, sedimentary rock strata were formerly continuous over wide areas. As a result, any layer discontinuities must be the result of erosion or other geologic processes.
The layers in this sketch are continuous laterally, which means they extend in all directions while holding onto their thickness and makeup. We can presume that the layers go farther in all directions even though we can only see a small section of them in this sketch. This is significant because it enables geologists to link the age and make-up of distinct rock layers.
To know more about lateral continuity, refer:
https://brainly.com/question/31166638
#SPJ1
Compounds pure substances made of two or more types of
and are
A compound has the same composition throughout, which is called
Compounds be separated by physical means. Separating a
compound requires a chemical reaction.
The properties of a compound are usually than the properties
of the elements it contains.
Compounds exist as pure substances created of two or more kinds of atoms bound together. Compounds can even be broken down into easier substances.
What is meant by compound?A compound is a substance created by the chemical fusion of two or more elements. Covalent bonds and ionic bonds are two typical forms of bonds that hold components in a compound together. Any compound will always include each ingredient in a specific ratio.
A compound is a pure material that is created when two or more components are chemically mixed in a specific (or constant) mass proportion (or weight). when at least two elements combine chemically to create a compound, a new substance.
Pure substances known as compounds are created by joining two or more different types of atoms. Additionally, compounds can be divided into more basic components.
To learn more about compounds refer to:
https://brainly.com/question/1396488
#SPJ9
PLEASE HELP WITH SOME BIOLOGY ASAP!! THANK YOU AND GOD BLESS
Scientists often say that structure determines function when discussing biologically important molecules. Enzymes fit this description because...
A. Enzymes are uniformly shaped and versatile. The shape never changes.
B. Enzymes exist in many shapes and sizes. The shape of the enzyme is irrelevant and they are used interchangeably.
C. Enzymes are similar to other molecules and can mimic their functions.
D. Enzymes are a specific shape that helps catalyze specific reactions. Once the shape changes, the efficacy of the enzyme changes.
Answer:
D
Explanation:
the shape of the enzyme helps determine the chemical reaction it will be a part of
Look at the table. Which best describes the current weather conditions in Portland?
Answer:
26°C (79°F)
Explanation:
cold and snowy
Question 1 A heterozygous yellow-seeded plant is crossed with a homozygous yellow seeded plant. i. ii. Question 2 Complete the punnet square and write the genotypic and phenotypic ration for the possible offsprings. (3 marks) Genotypic ration Phenotypic ration What is the probability of having a pure breeding green seeded offsprings (2 marks) What is the probability of having a yellow-seeded plant in F2 generation, when a true breeder from F1 is crossed with a non-true breeding yellow seeded plant? (2 marks)
Answer:
Explanation:
To solve this problem, let's represent the heterozygous yellow-seeded plant as "Yy" and the homozygous yellow-seeded plant as "YY."
i. When crossing a heterozygous yellow-seeded plant (Yy) with a homozygous yellow-seeded plant (YY), we can set up a Punnett square to determine the possible offspring genotypes:
Y Y
y Yy Yy
y YY YY
ii. The genotypic ratio is 2:2 or 1:1 for the possible offspring genotypes: Yy and YY.
The phenotypic ratio is also 2:2 or 1:1 for the possible offspring phenotypes: yellow-seeded (YY and Yy).
Question 2:
To determine the probability of specific outcomes, we need additional information about the parental genotypes and their inheritance patterns. Please provide the genotypes of the true breeder from F1 and the non-true breeding yellow-seeded plant for a more accurate calculation.
Role of cytogenetics in new plants
Cytogenetics plays a crucial role in the study and development of new plants. Here are some of the key roles of cytogenetics in relation to new plants:
1. Chromosome analysis: Cytogenetics involves the study of chromosomes, their structure, behavior, and organization within cells. This analysis helps in identifying and characterizing the genetic makeup of plants, including the number and arrangement of chromosomes. It provides valuable information for plant breeding and genetic improvement programs.
2. Polyploidy induction: Cytogenetics is used to induce and study polyploidy in plants, which involves increasing the number of sets of chromosomes in a plant's genome. Polyploidy can lead to significant changes in plant characteristics, such as increased vigor, larger size, and improved disease resistance. Cytogenetic techniques help in inducing and stabilizing polyploidy in new plant varieties.
3. Genetic mapping: Cytogenetics contributes to genetic mapping, which involves determining the positions of genes on chromosomes. By identifying and mapping genes responsible for specific traits, cytogenetics helps in understanding the genetic basis of plant traits and facilitates targeted breeding efforts for developing new plant varieties with desirable traits.
4. Hybridization and introgression: Cytogenetic techniques, such as chromosome doubling and embryo rescue, are employed in plant hybridization and introgression programs. Hybridization involves crossing different plant varieties or species to combine desirable traits, while introgression involves transferring specific genes from one plant species to another. Cytogenetics aids in analyzing and ensuring the stability and compatibility of hybrid or introgressed plants.
5. Chromosomal abnormalities and mutation breeding: Cytogenetics plays a role in studying chromosomal abnormalities and mutations in plants. It helps in identifying genetic variations and abnormalities that may lead to novel plant traits or contribute to genetic disorders. This knowledge is utilized in mutation breeding programs, where plants with desired mutations are selected and bred to develop new plant varieties.
Overall, cytogenetics provides essential tools and knowledge for understanding the genetic makeup, variation, and inheritance in plants. It contributes to plant breeding programs, genetic improvement efforts, and the development of new plant varieties with improved characteristics.
Draw a flow chart that explains how DNA is used to create an organism. please use the words: DNA, gene, protein, cell, tissue, organ, organism.
Answer:
Please find the flowchart attached as an image
Explanation:
DNA is the genetic material contained in the cells of living organisms. The DNA contains a segment called GENE, which contains information used to produce useful products needed in the cell. The information contained in the gene is expressed to produce PROTEINS.
PROTEINS are responsible for many metabolic activities that occurs in a cell. The CELL functions due to activities of the proteins produced by gene expression. When similar cells come together, they form TISSUES. An aggregation of tissues performing similar functions form ORGAN. Organs functioning similarly come together to form ORGAN SYSTEM. A collection of organ systems in the body forms the ORGANISM.
complete the data table to compare and contrast the different types of dominances.
Complete
incomplete
codominance
The dominances include:
Complete Dominance - expressed in the phenotype, recessive allele is present.Incomplete Dominance - not completely dominant over the recessive allele.Codominance - expressed in the phenotype, phenotype is a combination of the two.What are these dominances?Complete Dominance: The dominant allele is expressed in the phenotype, even if the recessive allele is present. For example, if a person has the genotype for brown eyes (BB) and their partner has the genotype for blue eyes (bb), their children will always have brown eyes (Bb).
Incomplete Dominance: The dominant allele is not completely dominant over the recessive allele, and the phenotype is a blend of the two. For example, if a person has the genotype for red flowers (RR) and their partner has the genotype for white flowers (rr), their children will have pink flowers (Rr).
Codominance: Both alleles are expressed in the phenotype, and the phenotype is a combination of the two. For example, in humans, the MN blood type is determined by the codominant alleles I^M and I^N. People with the genotype I^M I^M have type M blood, people with the genotype I^N I^N have type N blood, and people with the genotype I^M I^N have type MN blood.
Find out more on dominances here: https://brainly.com/question/810479
#SPJ1
Complete question:
complete the data table to compare and contrast the different types of dominances.
Complete
incomplete
codominance
Typesdescriptionexamplethe scottish fold is a breed of cat with a mutation in a gene involved in cartilage development. the result is that each ear of the cat has a crease, so the ears fall forward and lie against the head instead of standing up like the ears of most small cats. the mutation is a dominant allele.
a cat that is heterozygous for the fold allele mates with a cat that is homozygous for the fold allele.
what are the expected percents of offspring that will have each characteristic?
The expected percent of offspring of the Scottish fold with folded ears is 75%.
How to determine offspring?The Scottish Fold is a breed of domestic cat with a natural dominant gene mutation that affects cartilage throughout the body, causing the ears to "fold", bending forward and down towards the front of the head, which gives the cat what is often described as an "owl-like" appearance.
The fold is inherited as an autosomal dominant trait. This means that a cat with folded ears may have either one (heterozygous) or two copies (homozygous) of the dominant fold gene (Fd). A cat with normal ears should have two copies of the normal gene (fd).
If a cat that is heterozygous for the fold allele mates with a cat that is homozygous for the fold allele, the expected percent of offspring that will have each characteristic are:
25% will be homozygous for the fold allele and will have folded ears.50% will be heterozygous for the fold allele and will have folded ears.25% will be homozygous for the normal allele and will have normal ears.Therefore, the expected percent of offspring with folded ears is 75%.
Find out more on expected percent here: https://brainly.com/question/9901869
#SPJ1
Describe the movement of K+ ions into the guard cell based on the model in Figure 1. Scientists crossed plants that were homozygous for the cyclin-dependent kinase-wild type (CDK-WT) allele with plants that were homozygous for the cyclin-dependent kinase-mutant (CDK-Mut) allele. The F1 offspring of this cross were then crossed, producing F2 offspring. Explain how the ratio of phenotypes in the F2 generation would demonstrate that the CDK-Mut allele is recessive.
Answer:
b
Explanation:
What does a carbon atom do during cellular respiration?
Carbon compounds are the energy source of cellular respiration. These molecules are oxidized, that is, they lost their electrons, in order create energy for the cell. For example, we could start with a large lipid chain of 16 carbon atoms, that will experience oxidation in order to create conditions for ATP synthesis, that finally will become one carbon atom. Single carbon atoms are exhaled in respiration as CO2 (Carbon dioxidde). So, carbon atoms are the source of energy in cellular respiration (as carbon molecules), and finally they serve as a mean to exhale the metabolic waste, as CO2.
Ways to calculate an "average" include
A. mean, median, and mode
B. mean, median, and percent
C. mean, percent, and mode
D. percent, median, and mode
Which gas in Earth's atmosphere has increased over time due to burning
fossil fuels?
O oxygent
O nitrogen
C water vapor
carbon dioxide
Answer:
carbon dioxide
mark brailyest please
Answer:
carbon dioxide
Explanation:
because the fossil are burning so its pretty obvious
How does cell volume affect nutrient exchange between the cell and its external environment?
a. Cells with a large volume and small surface area are well-adapted for nutrient
exchange.
b. Very large cells are the best adapted for nutrient exchange.
c. The ratio of cell volume to surface area determines the efficiency of nutrient
exchange.
d. Very small cells are the best adapted for nutrient exchange.
e. Nutrient exchange is not impacted by cell volume.
Answer:
d. Very small cells are the best adapted for nutrient exchange.
Explanation:
The need to be able to pass nutrients and other substances into and out of the cell limits how big cells can get. The larger a cell is, the more difficult it is for nutrients and gases to move in and out of the cell because the volume is larger than the surface area. Smaller cells can exchange nutrients with the external environment more quickly.
D,k❤️hi stendent ok and what is 12x12
Answer: 144
Explanation: Do I really need one?
Answer:
144
Explanation:
I'm dropping out
I'm tired of University, I'm sick of all my professors for treating me harshly especially during these hard times, and I hate taking midterms.
I'm currently a college freshman in the middle of the semester, and things have been pretty tough. I've been procrastinating the whole week because I had everything going on and I couldn't keep up. I'm a biology major (pre-med) and I have to take two science classes. I suck at managing time and I suck at studying. I feel like I cannot do this. Also, whenever I do my assignments, my professors grade so friggen harshly & give me unfair grades even though I work all the way through midnight finishing it.
I'm a good student, it's just that you know some people can be burned out. I am burned out and college has just been draining my soul each day. Should I drop out?
Answer:
Hey do you want to talk about it? Its going to be okay.
Explanation:
Cyanobacteria is a multicellular organism true or false
Answer: False
Explanation:
All bacteria are unicellular organisms.
the extent to which a test, measurement, or classification system produces the same scientific observation each time it is applied
The extent to which a test, measurement, or classification system produces the same scientific observation each time it is applied is called reliability.
The consistency with which a method assesses something is known as reliability. The measurement is regarded as accurate if it can consistently get the same result by applying the same techniques under the same conditions. You repeatedly take temperature readings of a liquid sample while maintaining the same settings.
A product, system, or service's reliability is determined by the likelihood that it will run well in a given environment for a predetermined amount of time or perform as intended. In order to assess the overall validity of a scientific experiment and strengthen the conclusions, reliability is a crucial component.
Reliability is a topic of intense and continuous debate among social and physics scientists.
Learn more about scientific reliability here:
https://brainly.com/question/26809303
#SPJ4
When an inducer is added to a medium containing an organism with a metabolic pathway controlled by a repressor, the inducer then Group of answer choices combines with the substrate and blocks induction. does not combine with, but rather functions as a chaperone molecule for, the enzyme-substrate complex. combines with the repressor and activates the repressor. combines with the substrate and activates induction. combines with the repressor and inactivates the repressor.
Answer:
The correct answer is - combines with the repressor and inactivates the repressor.
Explanation:
The role of inducers is to bind with a repressor in a metabolic pathway and cause them to change their shape. This modification of the shape in the repressor structure prevents them to bind with the DNA and the metabolic pathway continues.
So, inducers inactivate the repressors by binding them. For example in Lac operon lactose, an inducer bindswith the repressor and dissociates it from DNA and inactivates the repressor.
How does the number of chromosomes in an organism's reproductive cells compare to the number of chromosomes in the organism's body cells? A. The reproductive cells have the same number of chromosomes as the body cells. B. The reproductive cells have twice as many chromosomes as the body cells. C. The reproductive cells have four times as many chromosomes as the body cells. D. The reproductive cells have half as many chromosomes as the body cells.
Answer: D. The reproductive cells have half as many chromosomes as the body cells.
1. How has your understanding about race changed since you began learning about it? (2
points)
Children learn to comprehend, respect, and value differences between people when we teach them from an early age that discussing race is acceptable.
Why do we study race?Children learn to comprehend, respect, and value differences between people when we teach them from an early age that discussing race is acceptable. As a result, kids become better equipped to recognize when something in their surroundings seems unfair or unjust and can take action to change it.The definition of race changes based on the society.White, Black or African American, American Indian or Alaska Native, Asian, and Native Hawaiian or Other Pacific Islander are the five minimal classifications required by OMB.Children learn to comprehend, respect, and value differences between people when we teach them from an early age that discussing race is acceptable.To learn more about race refer to:
https://brainly.com/question/27129680
#SPJ1
In performing any given movement, the muscles performing the actual movement are called the prime movers or agonists
true
The given statement "In performing any given movement, the muscles performing the actual movement are called the prime movers or agonists" is true because:
The muscle that is shortening or tightening is referred to as the agonist, whereas the muscle that is lengthening or relaxing is referred to as the antagonist. To help you remember which muscle is the agonist, you might think of it as the one that is "in agony" as you are doing the action because it is the muscle that is responsible for carrying out all of the efforts.
The muscle that supplies the major force that drives the action is referred to as the prime mover, which is also sometimes called the agonist. An antagonist muscle functions in opposition to a prime mover in that it opposes the movement being carried out by the prime mover by either providing some resistance or turning the movement around.
You can also learn about agonist from the following question:
https://brainly.com/question/14286421
#SPJ4
Most articles pass right through the atom, this means that most of the atom is
Most articles pass right through the atom, this means that most of the atom is an empty space.
What is an atom?An atom is described as a particle that consists of a nucleus of protons and neutrons surrounded by a cloud of electrons.
Protons and neutrons make up the core nucleus of an atom, which is encircled by an electron cloud. In relation to the size of the atom as a whole, the nucleus is exceedingly small.
As a result, the electrons surrounding the nucleus are the primary target of interactions when particles or even light pass through an atom. The majority of the atom's remaining space, which includes the nucleus, is vacant.
Learn more about atoms at:
https://brainly.com/question/6258301
#SPJ1
Somewhere, _____ is a place where ______ relationship will be accepted, but for now _____ still searching.
Answer:
There, their, they’re
Explanation:
There- a place or position, or if something is IN there. Ex. Who put that in there.
Their- they need to watch their back.
I can’t explain it without confusion but the internet knows better than me!
They’re - means they are!.Ex.
They are so pretty.
What do all living things have in common?
All have cells with a nucleus.
All have a genetic code.
All are made of two or more cells.
All can perform photosynthesis.
Answer:
All are made up of two or more cells
How is a lake succession different from the succession of an open field?
Answer:
Lake Succession (Research suggests a different model: a lake may undergo hundreds of years with little succession, with brief episodes of rapid change.) 1.An open lake or pond experiences a drought of one or more decades and the water level falls.
Explanation:
1. The following gene sequence appears on one strand of a segment of DNA that is about to go
through DNA Replication. What code will DNA Polymerase build to make the complementary
strand?
TACGGCATATGCAAATGGCGAGCCTATATT
The DNA polymerase will build the complementary strand with the code: ATGCCGTATACGTTTACCGCTCGGATATA.
What is DNA replication?DNA replication is a process by which a DNA molecule makes a copy of itself. During DNA replication, an enzyme called DNA polymerase reads the existing DNA strand and builds a new complementary strand by matching up the appropriate nucleotides.
To build the complementary strand of DNA, we need to use the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
So, for each base in the original sequence, we will pair it with its complement:
Original strand: TACGGCATATGCAAATGGCGAGCCTATATTComplementary strand: ATGCCGTATACGTTTACCGCTCGGATATALearn more about DNA Replication here: https://brainly.com/question/21265857
#SPJ1
The complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
What is gene sequence?A gene sequence is a specific sequence of nucleotides in DNA (or RNA) that encodes the genetic information for a particular trait, function or protein. Genes are the basic unit of heredity and are responsible for passing on traits from one generation to the next.
The complementary strand of DNA will have a sequence that pairs each nucleotide with its complementary base: adenine (A) with thymine (T), and cytosine (C) with guanine (G). Therefore, the complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
During DNA replication, DNA polymerase reads the existing strand from 3' to 5' and builds the complementary strand in the 5' to 3' direction. Therefore, the new strand would be synthesized by adding nucleotides in the following order:
ATA...CGT...TAA...CGC...TGG...ATA
Learn about complementary strand here https://brainly.com/question/1534778
#SPJ1
what are the strengths of fossil evolution
Which is an example that shows evidence of evolution?
1- Gravity
2- Fossils
3-Sea floor spreading
Answer:
2
Explanation:
the fossils are the evidence of evolution
Answer:
Fossils
Explanation:
Fossils:fossils are the traces or impressions of dead plants and animals preserved in the rocks.The study of fossils is the strongedt evidence to support evolution.Nowadays,the age of fossils can also be determined accurately by using carbon dating process.Studying fossils have revealed the organisms in past is different from the present days.It also shows gradual process from simple to complex forms as time passes.Thus the study of fossils support the study of evolution.