What is a controlled variable in an experiment?
a
b
A factor that is purposely left the same.
A factor that is purposely changed and being measured.
A factor that will be observed and measured.
A factor that is purposely being changed.
С
d A factor that is purposely being changed

Answers

Answer 1

Answer:

A factor that is purposely left the same.

Explanation:

A controlled variable should not be changed throughout an experiment or else it will affect the outcome of each individual trial.

Answer 2
A the factor that is purposely changed

Related Questions

As air is inhaled, which of these four structures is the last to be encountered?
a. bronchiole
b. alveoli
c. capillaries
d. veins

Answers

As air is inhaled, the structure that is last encountered is :

b. alveoli.

As air is inhaled, it first enters the nasal cavity or mouth, then passes through the pharynx, larynx, trachea, bronchi, bronchioles, and finally reaches the alveoli, which are the tiny air sacs in the lungs where gas exchange occurs.

The alveoli are the primary sites of gas exchange in the lungs. Oxygen from the inhaled air diffuses across the thin walls of the alveoli into the surrounding capillaries, while carbon dioxide from the bloodstream diffuses in the opposite direction to be exhaled. This exchange of gases occurs across the alveolar membrane, allowing oxygen to enter the bloodstream and carbon dioxide to be removed.

Thus, the correct option is : (b) alveoli

To learn more about alveoli visit : https://brainly.com/question/28018555

#SPJ11

In a particular diploid organism, somatic cells have 24 chromosomes. How many pairs of homologous chromosomes would be present in the gametes of that organism

Answers

Answer:

12

Explanation:

It says 'pairs'.

1. what is a line of best fit?

2.look at the graph with correlation coefficients of r=0.9 and r= -5. What kind of relationship does each of these values indicate

3. Compare the scatterplot with correlation coefficient of R= 1 and R =0. Use a correlation coefficients to predict how an increase in one variable would affect the other variable for each scatterplot.

1. what is a line of best fit?2.look at the graph with correlation coefficients of r=0.9 and r= -5. What

Answers

A line of best fit is a straight line that is used to describe the relationship between two variables in a scatterplot.

What is a line of best fit?It is the line that best represents the data points on the graph. The correlation coefficient (r) of a line of best fit is a measure of how closely the data points fit the line.For the graph with correlation coefficient of r=0.9, this indicates a strong positive linear relationship between the two variables. This means that as one variable increases, the other variable also increases.For the graph with correlation coefficient of r=-5, this indicates a strong negative linear relationship between the two variables. This means that as one variable increases, the other variable decreases.For the scatterplot with correlation coefficient of R=1, this indicates a perfect positive linear relationship between the two variables. This means that as one variable increases, the other variable increases in the same proportion.For the scatterplot with correlation coefficient of R=0, this indicates no linear relationship between the two variables. This means that an increase in one variable would not affect the other variable.

To learn more about correlation coefficient refer to:

https://brainly.com/question/27842223

#SPJ1

What are the basic units of a chemical element called?
A. Atoms
O B. Solids
O C. Gases
D. Molecules

Answers

your answer is a , atoms .
the answer to this atoms

Two insect groups vary genetically by two genes. When put together, they were able to reproduce and produce offspring that could also breed. Which best describes this insect population?
The insects experienced geographic isolation.
The insects experienced reproductive isolation.
The insects are different species.
The insects are the same species.

Answers

Answer:

The insects are the same species.

Explanation:

The insects are the same species because they interbreed with each other successfully. If the organisms belongs to the same species, they have the ability to interbreed with each other and produce fertile offspring while on the other hand, different species can't interbreed with one another. These two organisms have some genetic variations among each other due to environmental factors that leads to the differences between these two organisms.

The insects are the same species because they were able to reproduce and produce offspring that could also breed.

What are species?

Species are a group of related organisms which are able to interbreed and produce reproductively viable offspring.

The species level of taxonomy is the closest relationship and has the fewest number of organisms.

Since, the two insect groups were able to reproduce and produce offspring that could also breed, they are of the same species.

Learn more about species at: https://brainly.com/question/26125007

I need help idk if it’s a or c please??

If you construct a model that places a cell with an internal salt concentration of 0.02 M in an
aqueous solution that has a salt concentration of 0.015 M, how could the cell lower internal
pressure? (3 points)
Active transport of water against the gradient
Diffusion of water with the pressure gradient
Osmosis of water flowing from where the solute is least concentrated
Passive transport of water with the gradient

Answers

Answer:

As shown

Explanation:

A

Answer:

A

Explanation:

I took the quiz

my fav songs are:
1. er'body but me
2. wishing well
3. smoke my pain
4. politically incorrect
5. Kiss me more

Answers

the doge says i speak  all langos try me

Which action has a positive effect on air resources?
a)using fossil fuels
b)building new homes
c)walking to work or school
d)removing vegetation such as trees

Answers

By walking to work or school everyday, that
has a positive effect on air resources by reducing the amount of pollution in the air.

The action that has a positive effect on air resources Is walking to work or school because it reduce pollution that might occur from exhaust fumes of car.

What is sir resources?

Air resources are materials or gasses or substances that are abundant in the air which replenish itself and don't diminish or is not exhausted which is useful to living things.

Therefore, The action that has a positive effect on air resources Is walking to work or school because it reduce pollution that might occur from exhaust fumes of car.

Learn more about resources below.

https://brainly.com/question/1290230

#SPJ2

Shanika is investigating skeletal remains found in the Adirondack mountains. Dozens of human bones are found near one remote campsite, all mostly intact and all in a space that has about a 10 foot diameter. How long does Shanika believe the body has been there?

A.
about three weeks

B.
about four years

C.
about four months

D.
about 15 years

Answers

The length of the bone shows that the body has been dead about four years. Option B

What is the skeleton?

We know that the skeleton is the part of a person that remains after the individual has died. It is composed of the bones of the deceased. The length of the bone is a determinant of the length of time within which the person died.

This is because, the changes in the length of the bone gives insight into the degeneration of the bone cells which follows the death of the human.

Learn more about bones:https://brainly.com/question/29606469

#SPJ1

for an individual who is heterozygous for two genes, aa and bb, what does independent assortment predict?

Answers

For an individual who is heterozygous for two genes, aa and bb, independent assortment predicts that there will be four possible combinations of alleles that can be passed on to their offspring.

These combinations are AA, Aa, aA, and aa. Independent assortment is the process by which different pairs of alleles are passed on to offspring independently of each other. This is due to the random alignment of homologous chromosomes during meiosis I, which leads to different combinations of alleles in the gametes.

For example, if an individual is heterozygous for the genes A and B, then they have the genotype AaBb. During meiosis, the A and B alleles on homologous chromosomes can align in different ways and end up in different gametes. As a result, the offspring can inherit different combinations of alleles, such as AB, Ab, aB, or ab. This leads to genetic diversity among the offspring, which is a fundamental aspect of the process of evolution.

Learn more about independent assortment at : https://brainly.com/question/28212521

#SPJ4

Mentors are often a very important part of a hero’s journey. Who are our mentors today? How has a mentor helped motivate you or shared important knowledge with you? Who have you mentored?
- mythology

Answers

A mentor is a person who plays the important role of helping another individual to become great person and achieve their potential.

Who is a mentor?

A mentor is an individual or person who plays the role of a guide and tutor to another individual in order to help this person to into a great person.

The individual mentored by a mentor is called a mentee.

Mentors are important in the lives of their mentees and to the society at large, as they help build responsible individuals in the society.

A teacher can serve as a mentor to his/her students.

A religious leader can serve as a mentor to their congregants.

Parents can serve as mentors to their children.

Therefore, a mentor is a person who plays the important role of helping another individual to become great person and achieve their potential.

Learn more about mentors at: https://brainly.com/question/26289842

A mentor is a person who helps another individual to get success in life.

Who is a mentor?

A mentor is a person who guides another individual in order to help him to get success in life and achieve their goals. Teaches, parents and leaders are our mentors in this modern world which guides and helps in achieving our goals.

Mentor helped by motivating the person as well as by sharing important knowledge with him which helps him in achieving his goal so we can conclude that a mentor is a person who helps another individual to get success in life.

Learn more about mentors here: https://brainly.com/question/14327481

Think back about your experience in this lab using a dichotomous key. What might make it hard for someone to use a dichotomous key? Make a list of possible reasons.

Answers

Answer: why it is hard to use dichotomous key in the lab are;

If the organisms you want to use it for are similar.

If you can't see the little characteristics posses by the organisms you are using it for.

If all the pictures does not reveal all the important features of the organisms.

It is very difficult to use it to determine the anatomical structure.

Explanation:

Dichotomous key is an important method that is use in biology to identify organisms by separating or dividing the organisms into two groups. It is a tool created by scientists to help them identify organisms or objects. Once the organisms are group into two, more information is revealed more individually.

Answer:

The person who commented before me was correct. They should get brainliest. Below is the same thing they wrote just in paragraph form.

If the organisms you want to use it for are similar. If you can't see the little characteristics posses by the organisms you are using it for. If all the pictures does not reveal all the important features of the organisms. It is very difficult to use it to determine the anatomical structure.

What is the main function of DNA in a cell?

Answers

The main function of DNA in a cell is that it allows all forms of life to function, grow, and produce

Answer:

DNA is necessary for the production of proteins, the regulation, metabolism, and reproduction of the cell.

Explanation:

for a prokaryotic vector to be propagated in a host bacterial cell, the vector needs

Answers

For a prokaryotic vector to be propagated in a host bacterial cell, the vector needs Origin of replication, Selectable marker, Multiple cloning site,Promoters and regulatory elements and Size considerations.

Origin of replication (ori): The vector must contain an origin of replication that is recognized by the host cell's replication machinery. This allows the vector DNA to be replicated along with the host genome.

Selectable marker: The vector usually carries a selectable marker, such as a gene for antibiotic resistance. This marker enables the selection of bacterial cells that have taken up the vector by growing them in a medium containing the corresponding antibiotic. Only the transformed cells that carry the vector will survive.

Multiple cloning site (MCS): The vector should have a region known as the multiple cloning site or polylinker. This is a specific DNA sequence where various restriction enzyme recognition sites are located. It allows for the insertion of foreign DNA into the vector.

Promoters and regulatory elements: The vector should contain appropriate promoters and regulatory elements that can control the expression of the inserted DNA.

Size considerations: The vector should have a size that is manageable and compatible with the host cell's machinery for DNA uptake, replication, and gene expression.

To know more about prokaryotic click here

brainly.com/question/29054000

#SPJ11

Mitosis is accurately defined as the division of the nucleus (where genetic
material is stored) true or false

Answers

Answer:

True uwu

Explanation:

How does DNA replication in prokaryotes differ from replication in eukaryotes?

Prokaryotic chromosomes have telomeres, and eukaryotic chromosomes do not.
Prokaryotic chromosomes have a single origin of replication, while eukaryotic chromosomes have many.
The prokaryotic DNA had multiple parts to be replicated, compared to one long chromosome in eukaryotes.
The rate of elongation during replication is slower in prokaryotes than in eukaryotes.

Answers

Answer:

Prokaryotic chromosomes have a single origin of replication, while eukaryotic chromosomes have many.

Explanation:

If eukaryotic chromosomes did not have many origins of replications then replication would take insanely long due to how much longer eukaryotic genes are!

what does beorn eat? why do you think he chooses to eat this way? what does it suggest about his inherent character traits?

Answers

Beorn, a character in J.R.R. Tolkien's "The Hobbit," is described as a skin-changer who can transform into a bear. He lives in a wooden house in the middle of a forest and is known for his hospitality towards the dwarves and Bilbo Baggins. In terms of his diet, Beorn is depicted as a hunter and a gatherer, and he mainly eats meat, honey, and bread.

According to the book, Beorn keeps many animals such as horses, cows, sheep, and pigs that he uses for food. He also hunts wild animals such as deer and boars for meat. Additionally, he has beehives from which he collects honey. Beorn is also shown to have an extensive garden where he grows vegetables such as potatoes, carrots, and cabbages. He uses the produce from his garden to make bread.

Beorn's choice of diet can be attributed to his inherent character traits. As a hunter-gatherer, he is self-sufficient and independent. He relies on his own skills to provide for himself and his guests. His love for nature is also evident in his choice of food. By hunting and gathering, Beorn is in tune with the natural world around him.

Furthermore, Beorn's diet reflects his hospitality towards his guests. He provides them with hearty meals that are filling and nutritious. His choice of food also shows his generosity towards others.

When DNA is duplicated during mitosis:

1).two molecules are formed, each with an original "upright"
2).the original molecule thickens and separates into two
3).two completely new DNA molecules are formed
4).one completely new DNA molecule is formed

Answers

Answer:

1).two molecules are formed, each with an original "upright"

Explanation:

Nuclear power is known for producing
large amounts of _?_
pollution.
A. oceanic
B. thermal
C. noise
D. air

Answers

Answer:

B, thermal.

Explanation:

Nuclear power waste a lot of energy through heat.

One Strand of DNA is listed below. Which of the following best
represents the complementary strand of DNA?
DNA Strand: TCGAGGCTAA
A. ACGUCCGAUU
B. GATCTTAGCC
C. AGTCCGAUU

Answers

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

The complementary strand of  the mentioned DNA strand is AGCTCCGATT.

What is DNA?

DNA  is a hereditary material  which is present in human beings as well as all other living organisms.  Every cell which is present in an organism's body has DNA  which is the same. Most of the DNA is situated in the cell's nucleus and small amount of it can be found in the cell's mitochondria as well.

Information which is stored in DNA is stored as codes made up of four chemical bases namely, adenine, thymine , cytosine and guanine.Human DNA consists of 3 billion bases .The order of the bases determines information which is required for building and maintaining an organism.

DNA bases are capable of pairing up with each other. Adenine pairs with thymine and guanine pairs up with cytosine .Each base is also attached to a sugar molecule and a phosphate group. A base, phosphate  sugar are together called as nucleotides.

Learn more about DNA,here:

https://brainly.com/question/2293843

#SPJ2

Your question is incomplete but most probably your full question  was ,one Strand of DNA is listed below. Which of the following best

represents the complementary strand of DNA?

DNA Strand: TCGAGGCTAA

A. ACGUCCGAUU

B. GATCTTAGCC

C. AGTCCGAUU

D. AGCTCCGATT.

Describe a insert mutation

Answers

Answer:

An insertion, as related to genomics, is a type of mutation that involves the addition of one or more nucleotides into a segment of DNA. An insertion can involve the addition of any number of nucleotides, from a single nucleotide to an entire piece of a chromosome.

Hope this helps :)

Pls brainliest...

p53 is a tumor suppressor gene that regulates the cell cycle at the G1 checkpoint. What would be the outcome of a hyperactivation mutation in p53

Answers

A hyperactivation mutation in p53 would result in the excessive and uncontrolled activation of p53, leading to an increased level of cell cycle arrest and apoptosis.

What is apoptosis?

Apoptosis is a natural process of programmed cell death that occurs in multicellular organisms. It plays a crucial role in development, maintenance of tissue homeostasis, and elimination of damaged or unnecessary cells.

What is hyperactivation mutation?

Hyperactivation mutation refers to a genetic alteration that results in the increased activity of a protein or pathway, leading to abnormal cell behavior and potential disease development.

According to the given information:

A hyperactivation mutation in p53 would result in the excessive and uncontrolled activation of p53, leading to an increased level of cell cycle arrest and apoptosis. This would result in the prevention of the formation and progression of tumors in the body, as p53 plays a crucial role in regulating the cell cycle and preventing the growth and division of abnormal cells. However, it is important to note that excessive activation of p53 can also lead to negative effects on normal cells and tissues, resulting in various health problems.

To know more about apoptosis, hyperactivation mutation visit:

https://brainly.com/question/30037744

#SPJ11

Describe the process by which your kidneys conttrol the amount of water in your blood

Answers

The kidneys can adjust the concentration of the urine to reflect the body's water needs, conserving water if the body is dehydrated or making urine more dilute to expel excess water when necessary. ADH is a hormone that helps the body to retain water by increasing water reabsorption by the kidneys.

What causes a greater amount of pressure in the inner core?

Answers

It turns out that many materials can be solid at a higher temperature if the pressure is also higher. so even though it is hotter in the inner core the pressure in the core is also higher and you can have a solid iron nickel instead of liquid
Answer 1: The inner core is indeed hotter than the outer core. However, the PRESSURE on the inner core is greater than the pressure on the outer core and the melting point of iron, the main constituent of the core, INCREASES as the pressure goes up.

Assuming the cross-sectional area of the Earth to be about 1.28×1018 cm2, what is the total annual amount of incoming energy? Express your answer using three significant figures.
_______________ cal/yer

Answers

The Earth gets its energy from the sun, which is transferred by electromagnetic radiation. Thus, the Earth receives the annual amount of energy from the sun. Assuming the cross-sectional area of the Earth to be about 1.28×1018 cm2,  

Expressing your answer using three significant figures:The total annual amount of incoming energy is 1.74 x 1034 cal/year.The formula used to calculate the total annual amount of incoming energy is as follows:

Incoming energy = (energy emitted by the sun/ unit area) x (total cross-sectional area of the Earth).The Earth is spherical, thus the cross-sectional area of the Earth can be calculated as:

A = πr2 Where A is the area of the cross-section, r is the radius of the Earth and π is the mathematical constant pi.

The radius of the Earth is approximately 6400 km, so the area of the cross-section of the Earth can be calculated as:

A = π(6400 km)2A = 1.28 × 1018 cm

2Substituting the value of the cross-sectional area of the Earth in the above equation:

Incoming energy = (energy emitted by the sun/ unit area) x (1.28 × 1018 cm2).

The energy emitted by the sun per unit area is known as solar constant. Its value is approximately 1.37 kW/m2.Therefore,Incoming energy = (1.37 kW/m2) x (1.28 × 1018 cm2) x (10-3 W/kW) x (365 days/year) x (24 hours/day) x (3600 sec/hour) x (4.18 J/cal)Incoming energy = 1.74 x 1034 cal/year.

To know more about  electromagnetic radiation visit:-

https://brainly.com/question/29646884

#SPJ11

this benign tumor of fat cells that clinically appears as a yellowish mass surfaced by a thin layer of epithelium is referred to as a

Answers

The benign tumor of fat cells that clinically appears as a yellowish mass surfaced by a thin layer of epithelium is referred to as a "lipoma."

What is it called?

The most prevalent kind of adipose (fat) tissue-based benign (non-cancerous) soft tissue tumors are called lipomas. Under the skin, they often appear as a soft, slow-growing mass. The presence of fat cells gives lipomas their distinctive yellow color and painless nature. They can appear anyplace on the body where there are fat cells, and the underlying skin is frequently normal or slightly stretched.

It's crucial to remember that a dermatologist or healthcare provider should make the correct diagnosis after performing a clinical examination and potentially other diagnostic testing.

Learn more about epithelium :https://brainly.com/question/29829537

#SPJ1

What is the purpose of a Punnett square?

Answers

Answer:

Punnett square is a chart that allows you to determine the expected percentages of different genotypes in the offspring of two parents

A Punnett square is a chart that allows you to determine the expected percentages of different genotypes in the offspring of two parents. A Punnett square allows the prediction of the percentages of phenotypes in the offspring of a cross from known genotypes.

spongy bone is arranged in a network of needle-like or flat pieces called ________.

Answers

Spongy bone, also known as cancellous bone, is a type of bone tissue that has a spongy or porous appearance.

It is found at the ends of long bones and in the middle of most flat bones in the body, including the skull, sternum, and pelvis. Spongy bone is composed of trabeculae, which are needle-like or flat pieces of bone tissue that form a network of interconnecting plates and struts.

Trabeculae are arranged in a complex pattern that provides structural support and helps to distribute the forces of weight-bearing and movement across the bone. This network of trabeculae also contains small spaces filled with bone marrow, which produces red and white blood cells and platelets.

The structure of spongy bone is important because it allows for the exchange of nutrients and waste products between the blood vessels in the bone and the bone cells themselves. It also provides a large surface area for bone remodeling, which is the process by which old bone tissue is broken down and replaced with new tissue.

In summary, spongy bone is arranged in a network of needle-like or flat pieces called trabeculae. These trabeculae form a complex pattern that provides structural support, distributes forces, and allows for the exchange of nutrients and waste products in the bone tissue.

To know more about Spongy bone visit:

https://brainly.com/question/30891831

#SPJ11

Enzymes can be purified from the Golgi apparatus. The gene for the enzyme can be cloned and fused to the coding sequence of GFP to produce a GFP fusion protein. The GFP fusion protein can then be expressed in cell culture. Antibodies to GFP are readily available. To determine which region of the Golgi apparatus, cis, medial or trans, the protein is located in, the protein can be visualized by

Answers

Enzymes can be purified from the Golgi apparatus. The gene for the enzyme can be cloned and fused to the coding sequence of GFP to produce a GFP fusion protein. The GFP fusion protein can then be expressed in cell culture. Antibodies to GFP are readily available.

To determine which region of the Golgi apparatus, cis, medial or trans, the protein is located in, the protein can be visualized by immunofluorescence. The GFP fusion protein, which is produced by fusing the gene of the enzyme with the coding sequence of GFP, can be expressed in the cell culture. Once the GFP fusion protein is expressed, it can be visualized by immunofluorescence. This technique uses antibodies to GFP that are readily available to locate the protein in the Golgi apparatus.

Immunofluorescence is a powerful technique that is commonly used to localize proteins within cells. It involves the use of fluorescent dyes that are specific for particular molecules. The dye binds to the molecule of interest and emits light when excited by a light source, which allows the molecule to be visualized under a microscope.In conclusion, immunofluorescence can be used to visualize GFP fusion proteins that have been expressed in cell culture. This technique can be used to determine which region of the Golgi apparatus a protein is located in.

To know more about Golgi apparatus, refer

https://brainly.com/question/143804

#SPJ11

How to poop effectively in the toilet poop poop poop poop poop poop poop pooppooppoop poop poop poop

Answers

Few tips for pooping effectively in toilet are relaxing, having adequate time, siting in correct posture, using gravity. Also making sure to intake fiber rich food, while staying hydrated in the key.

To poop effectively in the toilet, follow these tips:

1. Relax: Find a comfortable position and relax your body. Stress or tension can make it difficult to have a bowel movement.

2. Adequate time: Allow yourself enough time in the bathroom. Rushing can interfere with the natural process.

3. Correct posture: Sit on the toilet with your feet flat on the floor or a footstool, slightly elevating your knees. This position mimics a squatting posture, which can help align the rectum for easier elimination.

4. Use gravity: Allow gravity to assist you by leaning slightly forward or placing your hands on your knees. This position helps to straighten the rectum, facilitating the passage of stool.

5. Don't strain: Avoid excessive straining or holding your breath, as it can lead to unnecessary pressure and make elimination difficult.

7. Fiber-rich diet: Maintain a balanced diet that includes plenty of fiber from fruits, vegetables, whole grains, and legumes. Fiber adds bulk to the stool, making it easier to pass.

8. Stay hydrated: Drink an adequate amount of water throughout the day to keep stools soft and easier to pass.
for more questions on pooping
https://brainly.com/question/29630973
#SPJ8

Other Questions
It takes light with a wavelength of 212 nm to break the nh bond in ammonia. What energy is required per photon to break this bond? what is the nh bond strength in terms of kj per mole?. what is the definition of mutual flux? In the sentence, what does the word extracted most likely mean? Find the constant of proportionality. If the equation does not representa proportional relationship, select Not Proportional.Y=x/6 SOMEBODY HELP NO LINKS PLZ AND THANK YOUtwo stores opened on the same day. Both stores have 75 customers by the end of the first week, Store A'S customers doubled each week for six weeks, Store B's customers increased by 200 each week for six weeks. Which store had more customers at the end of week 5 ? A Store A B Store BC They have the same number of customers D Not enough information show work plz and thank you What happens in lactic acid fermentation? What does an unfunded mandate do? autonomous spending rises by $10 billion and real gdp rises by $50 billion. what does the marginal propensity to save equal? Evaluate the integral. (Use C for the constant of integration.)2x^2+ 5x + 2/(x + 1)2 dx The following lines are parallel:y = 3x + 7y = - 1 / 3x - 1 Although the fight will be difficult, we refuse to give up. as long as we are unfairly taxed and denied a voice, we cannot - we will not - stand by. in the second sentence, "as long as" is the , while "and" is the . Is the sentence below a complete sentence or sentence fragment? That instrumental composition in my backpack on the counter. a) complete sentence b) sentence fragment 3. Compare and contrast the role of consumers and producers in allocating resources.Which do you think has the greater power? Why? I Can you be serious and more understanding about the home work 1. A baseball coach graphs some data and finds the line ofbest fit. The equation for the line of best fit isy=0.32x - 20.51, where x is the number of times at bat andy is the number of hits.How many hits should he expect from a player who is at bat175 times?A) 35 hitsB) 49 hitsC) 609 hitsD) 62 hitsABD 10. The ruler that started the time of the Roman Pax Romana wasA. NeroB. Augustus CaesarC. Julius CaesarD. Alexander the Great Health benefits can be really confusing if you are not well educated in them. But once you know the different types, they are actually pretty easy to navigate. Explain the different types of health insurance and the verbiage that goes along with each premium, out of pocket, etc. their advantages and their disadvantages put barrel,bicycle,cancel,caramel,carousel,channel,chuckle,couple,eagle,jewel,kennel,middle,multiple,noodle,parallel,pickle,scramble,towel,vowel,wiggleinanice linelikethis Hermann the Irascible. What purpose could Saki have had for writing about suffrage? Simplify the expression.4(20 + 12) (4 - 3)