What is 6 percent of 200 plz show your work

Answers

Answer 1

Answer: 12

Step-by-step explanation:

Answer 2

Answer:

12

Step-by-step explanation:

200 * 0.06 = 12


Related Questions

Worth five points! Will mark the first person who answered with an actual correct answer brainliest and i don't lie about brainliest!! Please no nonsense answers I just want help :(

Triangle ABC is the right triangle.
m∠A = 42°
What is m∠B?
A. 38°
B. 42°
C. 48°
D. 128°

Worth five points! Will mark the first person who answered with an actual correct answer brainliest and

Answers

Answer:

C   m∠B = 48°

Step-by-step explanation:

The acute angles of a right triangle are complementary which means their sum is 90

m∠A + m∠B = 90

42 + m∠B = 90

m∠B = 48°

what is the solution of the inequality 4+5x<-19

Answers

Answer: x>−3

Step-by-step explanation:

Pull out like factors :

  -15 - 5x  =   -5 • (x + 3)

Divide both sides by  -5  

Remember to flip the inequality sign

Subtract  3  from both sides

           x > -3

Inequality plot for

        -5.000 X  - 15.000  >  0

Answer:

9

Step-by-step explanation:

5. Prolific uses the bike in his trunk to find a nearby gas station with a mechanic to fix his rental
car. He rides 1.5 mi to the first gas station, where they say the next gas station may have a
mechanic. He then rides 1.6 mi to the next gas station, which also has no mechanic. The
following gas stations at 1.8 mi, 2.1 mi, and 2.5 mi away all have no mechanics available, but
confirm that there is a mechanic at the following gas station.

A. Assuming the rate remains constant, what equation will determine the distance of
the N gas station?

B.
If the pattern continues, how many miles will Prolific bike to get to the mechanic at
the 6th gas station?

Answers

Prolific will bike 2 miles to get to the mechanic at the 6th gas station if the pattern continues.

Assuming the rate remains constant, we can use the equation d = rt, where d is the distance, r is the rate, and t is the time. In this case, we want to find the equation to determine the distance of the Nth gas station.

Let's analyze the given information:

The first gas station is 1.5 miles away.

From the second gas station onwards, each gas station is located at a distance 0.1 miles greater than the previous one.

Based on this pattern, we can write the equation for the distance of the Nth gas station as follows:

d = 1.5 + 0.1(N - 1)

B. To find the distance Prolific will bike to get to the 6th gas station, we can substitute N = 6 into the equation from part A:

d = 1.5 + 0.1(6 - 1)

= 1.5 + 0.1(5)

= 1.5 + 0.5

= 2 miles

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ1

Solve the following inequality. 7x-2<10

Answers

Answer:x = < 12/7

Step-by-step explanation:

Add 2 to both sides:

7x - 2 (+2) < 10 (+2)

7x < 12

Divide both sides by 7:

7x/7 < 12/7

X < 12/7

The solution to the inequality 7x - 2 < 10 is x < 12/7.

Given that an inequality 7x - 2 < 10 we need to solve the inequality,

we know that,

Inequality in mathematics refers to a mathematical statement that compares two quantities, expressing that one quantity is greater than, less than, or not equal to the other.

Inequality is denoted using various symbols, such as "<" (less than), ">" (greater than), "≤" (less than or equal to), "≥" (greater than or equal to), or "≠" (not equal to).

To solve the inequality 7x - 2 < 10, we'll isolate the variable x.

Let's start by adding 2 to both sides of the inequality:

7x - 2 + 2 < 10 + 2

Simplifying the expression:

7x < 12

Next, divide both sides of the inequality by 7 to solve for x:

(7x)/7 < 12/7

Simplifying further:

x < 12/7

Therefore, the solution to the inequality 7x - 2 < 10 is x < 12/7.

Learn more about inequality click;

https://brainly.com/question/20383699

#SPJ6

PLEASE HELP ME SOLVE THIS Find all x-values for which f ( x ) = 2 for the function below.

{ ( - 3, 2 ), ( - 1, 0 ), ( - 3, 1 ), ( 2, - 3 ) }

Answers

Answer:

x = -3

Step-by-step explanation:

First let us get the equation of the coordinates

y-y0 = m(x-x0)

Using the coordinates ( - 3, 2 ), ( - 1, 0 )

m = 0-2/-1-(-3)

m = -2/2

m = -1

Substitute m = -1 and (-1, 0) into the formula

y - 0 = -1(x+1)

y = -x-1

f(x) = -x-1

Since f(x) = 2

2 = -x-1

-x = 2+1

-x = 3

x = -3

Hence the value of x is -3

what is the total surface area of the triangular prism in square centimeters?
A 240 cm^2
B 368 cm^2
C 320 cm^2
D 344 cm^2​

what is the total surface area of the triangular prism in square centimeters? A 240 cm^2B 368 cm^2C 320

Answers

Answer:

D

Step-by-step explanation:

base area = (6 · 4)/2 = 24/2 = 12 cm²

half base length = 6 : 2 = 3 cm

leg = \(\sqrt{3^2+4^2} = \sqrt{9 + 16} = \sqrt{25} = 5\) cm

perimeter = (5·2) + 6 = 10 + 6 = 16 cm

lateral area = 16 · 20 = 320 cm²

surface area = (2 · 12) + 320 = 24 + 320 = 344 cm²

In the formula for area of a rectangle A=bh solve for h

Answers

Hi there!  

»»————- ★ ————-««

I believe your answer is:  

\(h =\frac{A}{b}\)

»»————- ★ ————-««  

Here’s why:  

⸻⸻⸻⸻

\(\boxed{\text{Solving for 'h'...}}\\\\A=bh\\----------\\\rightarrow bh = A\\\\\rightarrow \frac{bh=A}{b}\\\\\rightarrow \boxed{h=\frac{A}{b}}\)

⸻⸻⸻⸻

»»————- ★ ————-««  

Hope this helps you. I apologize if it’s incorrect.  

what is the value of 3/2 + 4/2?​

Answers

Answer:

7/2 or 3 1/2

hope this helps

have a good day :)

Step-by-step explanation:

Answer:

7/2

Step-by-step explanation:

3/2 + 4/2 = 7/2

Hope this helps!!

How would we dimension the curved edges on the top of the object, starting with the drawing provided?

Answers

Draw a circle centered at the arc center with the calculated radius and label the dimensions. This will give the dimensions of the curved edges on the top of the object.

The dimensioning of the curved edges on the top of the object can be done by determining the radius of the arcs. First, draw a line from one end of the arc to the other. This is the chord of the arc. Then, measure the length of the chord and divide it by two. This is the radius. After calculating the radius, draw a perpendicular line from the center of the arc to the chord. This is the radius of the arc. The formula for calculating the radius of an arc is R = (c/2), where c is the length of the chord. Finally, draw a circle centered at the arc center with the calculated radius and label the dimensions. This will give the dimensions of the curved edges on the top of the object.

Learn more about dimensions here:

https://brainly.com/question/8286598

#SPJ4

plese help fast please....

plese help fast please....

Answers

Answer:

its b

Step-by-step explanation:

its esay for even a non smart person to know not saying your one!! never mind.IT IS BBBBBBBB!!!!!!

books cost 50¢ and pamphlets 15¢ at the book sale. if mr. jones spent $90 and purchased 15 more pamphlets than he did books, how many pamphlets did he buy ?

Answers

Mr. Jones bought approximately 13 pamphlets.

In this problem, we have two types of items: books and pamphlets. Books cost 50¢ and pamphlets cost 15¢ at the book sale.

Let's use variables to represent the quantities we don't know. Let's say Mr. Jones bought x books and y pamphlets.

We are given two pieces of information:
1. Mr. Jones spent $90 on his purchases.
2. He bought 15 more pamphlets than books.

Now, let's set up the equations based on the given information.

First, let's consider the cost equation. The total cost of the books and pamphlets should equal $90.


The cost of x books is 50¢ * x, and the cost of y pamphlets is 15¢ * y. So, the equation becomes:
50x + 15y = 90

Next, let's consider the second piece of information. Mr. Jones bought 15 more pamphlets than books, which means y = x + 15.

Now, we have a system of two equations:
50x + 15y = 90
y = x + 15

To solve this system, we can use substitution or elimination method. Let's use substitution:

Substitute the value of y from the second equation into the first equation:
50x + 15(x + 15) = 90

Simplify the equation:
50x + 15x + 225 = 90
65x + 225 = 90

Subtract 225 from both sides:
65x = 90 - 225
65x = -135

Divide both sides by 65:
x = -135 / 65
x ≈ -2.08

Since we cannot have a negative number of books, we know that x must be a positive whole number. So, let's round x to the nearest whole number:
x ≈ -2

Now, substitute this value of x back into the second equation to find y:
y = x + 15
y ≈ -2 + 15
y ≈ 13

Therefore, Mr. Jones bought approximately 13 pamphlets.

To know more about pamphlet refer here:

https://brainly.com/question/9186429

#SPJ11

in the book " hope was still here" what information had G.T. found at the tax assessors office​

Answers

Answer:

thta hu yud vg

Step-by-step explanation:

The graph of f(x)=4x^3-13x+9x+2 is shown below.
How many roots of f(x) are rational numbers?
A. 0
B. 1
C. 2
D. 3

The graph of f(x)=4x^3-13x+9x+2 is shown below. How many roots of f(x) are rational numbers? A. 0B. 1C.

Answers

Answer: 3

Step-by-step explanation:

Answer Fast To add 3/10+1/4+4/5, you must rewrite each fraction as an equivalent fraction with a denominator of 20. What are the equivalent fractions? Enter your answers in the boxes. 3/10= ?/20 1/4=?/20

Answers

Answer:

Equivalent fractions

3/10 = 6/20

1/4 = 5/20

4/5 = 16/20

Step-by-step explanation:

For

3/10

We Multiply numerator and Denominator by 2

= 3×2/10 × 2

= 6/20

For 1/4

We Multiply numerator and Denominator by 5

= 1×5/4× 5

= 5/20

For 4/5

We Multiply numerator and Denominator by 4

= 4×4/5× 4

4/5 = 16/20

I am really confused ...might anyone know ?

I am really confused ...might anyone know ?

Answers

Hey there,

formula: (a + b)(c + d) = ac + ad + bc + bd

Determine if the following functions are equivalent.

f(x) = (x + 8)(x - 3)

f(x) = x*x + x*(-3) + 8*x + 8*(-3)

f(x) = x² -3x + 8x - 24

f(x) = x² + 5x - 24

g(x) = x² + 5x - 24

>> f(x) and g(x) are equivalent

Have a nice day ;)

We are given with two functions f(x) & g(x) respectively , with 3 options and have to choose correct option

Now , here g(x) is already in simplified form , so let's simplify f(x) ;

\({:\implies \quad \sf f(x)=(x+8)(x-3)}\)

We Knows that ;

\({\boxed{\bf{(a+b)(c+d)=a(c+d)+b(c+d) \:\: \forall \:\:a,b,c,d\in \mathbb{R}}}}\)

Using this ;

\({:\implies \quad \sf f(x)=x(x-3)+8(x-3)}\)

\({:\implies \quad \sf f(x)=x^{2}-3x+8x-24}\)

\({:\implies \quad \sf f(x)=x^{2}+5x-24}\)

\({:\implies \quad \bf \therefore \quad \underline{\underline{f(x)=g(x)}}}\)

As f(x) = g(x) . So f(x) & g(x) are equivalent.

Hence , Option 3) f(x) and g(x) are equivalent is correct :D

Please help with this geometry question ASAP. Also please show work

Please help with this geometry question ASAP. Also please show work

Answers

Answer:

The height of the square pyramid is 24 unit.

Step-by-step explanation:

Given that:

Edge of the square pyramid = 14 unit Slant height of the square pyramid = 25 unit

To Find:

The height of the square pyramid.

We know that:

In pythagoras theorem.

H² = P² + B²

Where,

H = Hypotenuse = 25 unitP = Height = Let xB = Base = 14/2 = 7 unit

Finding the height of the square pyramid:

⇒ H² = P² + B²

⇒ (25)² = x² + (7)²

⇒ 625 = x² + 49

⇒ x² = 625 - 49

⇒ x² = 576

⇒ x = √576

⇒ x = 24

Hence,

The height of the square pyramid = 24 unit

A town has a population of 3000 and grows at 2.5% every year. To the nearest tenth of a year, how long will it be until the population will reach 4600?

Answers

It will take the town 21 years 4 months to reach 4600 in population

What is rate?

a rate is a ratio that compares two different quantities which have different units. For example, if we say John types 50 words in a minute, then his rate of typing is 50 words per minute. The word "per" gives a clue that we are dealing with a rate.

initial population = 3000

population increase every year = 2.5% of 3000

which is 2.5/100 x 3000 = 75

let the time taken to reach 4600 be d

increment for d number of years = 75d

Total population after d years is 75d + 3000

so 75d + 3000 = 4600

75d = 4600  - 3000

75d = 1600

d = 1600/75

d = 21.33 years which is 21 years 4 months

In conclusion 21 years 4 months is the time taken for the ton tto get tto 4600

Learn more about rate: https://brainly.com/question/24304697

#SPJ1

A diver begins at 140 feet below sea level. She descends at a steady rate of 7 feet per minute for 4.5 minutes. Then, she ascends 112.2 feet. What is her current depth?
Negative 549.3 feet
Negative 59.3 feet
59.3 feet
549.3 feet

Answers

Answer:

Step-by-step explanation:

starting point: 140 feet below sea level.=-140

she then decends= 7(4.5)=31.5

-140-31.5=-171.5

finally she ascends 112.2 feet

-171.5+112.2=-59.3 feet or 59.3 feet below sea level

Answer:

It's B

Step-by-step explanation:

Answer quickly please

Answer quickly please

Answers

Answer:

x=6

Step-by-step explanation:

......................

Answer:

x=6

Step-by-step explanation:

7x+2y = 48

Let y = 3

7x +2(3) = 48

7x+6 = 48

Subtract 6 from each side

7x+6-6 = 48-6

7x = 42

Divide each side by 7

7x/7 = 42/7

x = 6

Complete the table to simplify the
expression

Complete the table to simplify theexpression

Answers

1/5^4
5*5*5*5
1/625
These are the answers

Find the remaining side of 45-45-90 degrees triangle if the shorter sides are each 4/5

Answers

In a 45-45-90 degrees triangle, the two shorter sides are congruent, and the hypotenuse is √2 times the length of either shorter side.

If the shorter sides are each 4/5, then the hypotenuse would be:

hypotenuse = √2 * (4/5) = (4√2)/5

So, the remaining side of the triangle is (4√2)/5, which is the same length as the hypotenuse.

Computing equipment is bought from a supplier. The cost of 5 Computers and 4 Printers is £6,600, the cost of 4 Computers and 5 Printers is £6,000. Form two simultaneous equations and solve them to find the costs of a Computer and a Printer. A used Car salesperson can be paid using two methods of commission. METHOD X uses straight commission 3.5% of the selling price of all vehicles sold. METHOD Y uses a fixed amount of £250 per week plus commission of 1.5% of the selling price of all vehicles sold. If the total selling price of the Cars sold in each week is on average £20,000, calculate which of the two methods of commission the salesperson would prefer.

Answers

The cost of one computer is £600 and the cost of one printer is £800.

Computing equipment is bought from a supplier. The cost of 5 Computers and 4 Printers is £6,600, and the cost of 4 Computers and 5 Printers is £6,000. Form two simultaneous equations and solve them to find the costs of a Computer and a Printer.

Let the cost of a computer be x and the cost of a printer be y.

Then, the two simultaneous equations are:5x + 4y = 6600 ---------------------- (1)

4x + 5y = 6000 ---------------------- (2)

Solving equations (1) and (2) simultaneously:x = 600y = 800

Therefore, the cost of a computer is £600 and the cost of a printer is £800..

:Therefore, the cost of one computer is £600 and the cost of one printer is £800.

To know more about Computing equipment visit:

brainly.com/question/33122788

#SPJ11

Regular annual deposits are made into a savings account at the end of each year for fifteen years. The value of the first deposit is R9000 and thereafter the deposits are increased each year from the second deposit onwards at a rate of 5% p.a. If the interest rate earned on the savings account is 6,6% p.a. compounded monthly, then the future value of this growing annuity, to the nearest cent, is equal to R type your answer...

Answers

The future value of the growing annuity, to the nearest cent, is R 223,640.78.

In this scenario, regular annual deposits are made into a savings account for fifteen years. The first deposit is R9000, and starting from the second deposit, the amounts are increased by 5% each year. The interest rate earned on the savings account is 6.6% per annum, compounded monthly. We need to calculate the future value of this growing annuity.

To solve this problem, we can use the formula for the future value of an ordinary annuity:

FV = P * [(1 + r)^n - 1] / r

Where:

FV = Future value of the annuity

P = Regular payment (deposit amount)

r = Interest rate per compounding period

n = Number of compounding periods

In this case, the regular payment (deposit amount) for each year is as follows:

Year 1: R9000

Year 2: R9000 * (1 + 0.05) = R9450

Year 3: R9450 * (1 + 0.05) = R9922.50

We can see that the deposit amount increases by 5% each year.

Now, let's calculate the future value of the annuity using the formula mentioned above.

P = R9000 (first deposit)

r = 0.066 / 12 (monthly interest rate)

n = 15 (number of years * 12, as the interest is compounded monthly)

FV = R9000 * [(1 + 0.066 / 12)^(15*12) - 1] / (0.066 / 12)

Calculating this expression will give us the future value of the growing annuity. Rounding it to the nearest cent, we find that the future value is approximately R 223,640.78.

In summary, the future value of the growing annuity, with regular annual deposits increasing by 5% each year and an interest rate of 6.6% per annum compounded monthly, is R 223,640.78.

To learn more about annuity, click here: brainly.com/question/28425813

#SPJ11

If £1 = US$1.11316 and A$1 = US$0.8558, how many British pounds will you get for one Australian dollar?



Round to two decimal places

Answers

The correct answer is  you will get approximately £1.30 for one Australian dollar.

To find out how many British pounds you will get for one Australian dollar, we need to determine the exchange rate between the British pound and the Australian dollar.

Given that £1 = US$1.11316 and A$1 = US$0.8558, we can calculate the exchange rate between the British pound and the Australian dollar as follows:

£1 / (US$1.11316) = A$1 / (US$0.8558)

To find the value of £1 in Australian dollars, we can rearrange the equation:

£1 = (A$1 / (US$0.8558)) * (US$1.11316)

Calculating this expression, we get:

£1 ≈ (1 / 0.8558) * 1.11316 ≈ 1.2992

Therefore, you will get approximately £1.30 for one Australian dollar.

Learn more about statistics here:

https://brainly.com/question/30915447

#SPJ11

5 1. limit 4 Determine if the sequence {an} converges, and if it does, find its limit when 3 n5 – 5 n3 + 2 2 n4 + 4n2+1 an = 2. limit Neo 3 2 3. the sequence diverges 4. limit = 0 5. limit = 2

Answers

Answer are:
1. The sequence converges.
2. The limit is 0.
3. N/A, since the sequence converges.
4. N/A, since the limit is not 0.
5. N/A, since the limit is not 2

To determine if the sequence {an} converges, we need to find its limit. Let's first look at the expression for an:

an = (3n^5 – 5n^3 + 2) / (2n^4 + 4n^2 + 1)

We can simplify this expression by dividing each term by n^4:

an = (3/n^1 – 5/n^3 + 2/n^5) / (2 + 4/n^2 + 1/n^4)

As n approaches infinity, all the terms with powers of n in the denominator approach 0, so we can simplify the expression further:

an ≈ 3/(2n^4) = 3/2n^4

This means that the sequence {an} converges to 0, since the terms get smaller and smaller as n gets larger.

So the answers are:

1. The sequence converges.
2. The limit is 0.
3. N/A, since the sequence converges.
4. N/A, since the limit is not 0.
5. N/A, since the limit is not 2.

Learn more about sequence here:

https://brainly.com/question/30262438

#SPJ11

Write 1.625 x 1.625 using an exponent.

Answers

Answer:

1.625²

Step-by-step explanation!

1.625 x 1.625 is just 1.625 two times. So you add a 2 on the top which represents the number. You can write 1.625² instead of putting 1.625 x 1.625.  

1.625 x 1.625 can be written in exponential form as \(1.625^2\)

Given :

The given expression is 1.625 x 1.625 . we need to write it in exponential form

The exponent is in the form of \(b^x\), where 'b' is the base and 'x' is the exponent

base is the number and x is the exponent that is repeating number of times

For example , \(2 \cdot 2 \cdot 2 = 2^3\)

where 2 is the base and 2 is occurring three times

so exponent is 3

1.625 x 1.625 can be written in exponential form as \(1.625^2\)

Learn more :  brainly.com/question/18795432

Eliminate the y in the following system of equations. What is the result when you add the two equations?
x+y=2
3x-4y=27

Answers

Answer:

thus: x = 5, y = -3

Step-by-step explanation:

Solve the following system:

{y + x = 2 | (equation 1)

-4 y + 3 x = 27 | (equation 2)

Swap equation 1 with equation 2:

{3 x - 4 y = 27 | (equation 1)

x + y = 2 | (equation 2)

Subtract 1/3 × (equation 1) from equation 2:

{3 x - 4 y = 27 | (equation 1)

0 x + (7 y)/3 = -7 | (equation 2)

Multiply equation 2 by 3/7:

{3 x - 4 y = 27 | (equation 1)

0 x + y = -3 | (equation 2)

Add 4 × (equation 2) to equation 1:

{3 x + 0 y = 15 | (equation 1)

0 x + y = -3 | (equation 2)

Divide equation 1 by 3:

{x + 0 y = 5 | (equation 1)

0 x + y = -3 | (equation 2)

Collect results:

Answer: {x = 5, y = -3


For a field trip, 25 students rode in cars and the rest filled eight buses. How many students
were in each bus if 321 students were on the trip?

Answers

37 students were in each bus!

321-25=296
296/8=37

Hope this helps and please mark brainliest!!

someone please help!! i will
make you a brainliest...i don’t want to fail. i’ve posted this 3 times now:((

someone please help!! i willmake you a brainliest...i dont want to fail. ive posted this 3 times now:((

Answers

Answer:fisrt one is y=1/2x

second one is y=x+11

third one is y= x^3

fourth on is y= ^3 check mark x

Step-by-step explanation:

Suppose you sample 2 students from every classroom where a class is being held at CCNY at around 12 PM and gather data on their current GPAS. Research from CCNY says that the average GPA is 2.9 with a standard deviation of 0.3. Suppose this is true. What is the probability that a random sample of 50 students will have a sample mean of 3.0 or less? a. None of these O 6.5096 OC 6396 O d. 9996 Oe Cannot be solved since the sampling distribution cannot be established.

Answers

The probability that a random sample of 50 students will have a sample mean of 3.0 or less is approximately 0.9996 or 99.96%. The correct option is (d).

To calculate the probability, we can use the Central Limit Theorem, which states that for a large sample size, the sampling distribution of the sample mean follows a normal distribution, regardless of the shape of the population distribution.

In this case, we have a sample size of 50, which is considered large. We can calculate the z-score using the formula:

z = (x - μ) / (σ / sqrt(n))

where x is the sample mean, μ is the population mean, σ is the population standard deviation, and n is the sample size.

Plugging in the values, we have:

z = (3.0 - 2.9) / (0.3 / sqrt(50))

Using a standard normal distribution table or a calculator, we can find the probability associated with the z-score.

The correct answer among the options provided is "O 0.9996", which represents a probability of 0.9996 or 99.96% that a random sample of 50 students will have a sample mean of 3.0 or less.

To know more about probability refer here:

https://brainly.com/question/32331896#

#SPJ11

Other Questions
When trying to quit smoking using individual strategies, you should __________. A. Reward yourself with a few cigarettes every other day B. Celebrate every success C. Keep your feelings to yourself D. Visit places where you used to smoke Please select the best answer from the choices provided. A B C D. Please help will mark brainliest Young Goodman Browns companion is most likely his father governors assistant the devil a man from the king What is meiosis in simple terms? 1. Suppose a pepperoni pizza should bake 7 minutes longer than a plain pizza. a. If a small plain pizza should bake for 12 minutes, how long should you bake a small pepperoni pizza? b. If a large plain pizza should bake for m minutes, how long should you bake a large pepperoni pizza? How did the Age of Reason writers influence the people of the 18th century to think differently about themselves and the world around them?Write a Claim to answer the guiding question. Find a piece of Evidence to support your claim. Think about what you need to explain to your reader in the Commentary. Write a paragraph that has a claim, supporting evidence and commentary which religon was founded first Daina gives 2/3 of his money to Carol. Carol gives 6/7 of this money to Zak.What fraction of Daina's money does Zak get? on the body's motor homunculus, which of the following has the largest spatial representation in the brain? get a brainliest so pls help thanks Pls help me worth 37 pointsIn this activity, you will rewrite a passage to incorporate transitions, using one subordinating conjunction, one coordinating conjunction, and one introductory phrase.Rewrite the following passage so that it uses at least one subordinating conjunction, one coordinating conjunction, and one introductory phrase to transition between ideas.PassageThe American Dream is simply just a dream. Many people's earning potential has been stunted. It's harder and harder to find a job as unemployment rates soar. The jobs that are available pay less. if u guys can do this it will be awsome tool city rental shop will rent a pressure washer for $35 for the first 3 hours, and $8 for each additional hour, up to a total of 10 hours. after this, you will pay the full-day price of $87. you may also choose to buy an optional $5 insurance policy to cover any damage that occurs to the tool. note: you cannot pay for a partial hour, so if you keep the washer for 7 hours and 1 minute, you will be charged for 8 full hours. if you rented the washer at 9:40 am and returned it at 3:00 pm on the same day, and you bought the optional insurance, how much would you owe for the rental? What is the domain of f/x )= x? 258.53 in expanded form please help As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined region of the DNA by PCR. Provide the 10 nucleotide sequence of the primers that you would design and indicate the 5 and 3' ends of each primer. (1) ATTGTATCCGCATTTGATGCTACCGTGGTTGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGAGTTGA CTAAGAGCCGTTAGATGCCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTAGCAGCAT TATCGGAGGTTCTCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAAACCAGTT GGTGTTAAGCGATCCCCTGTCCAGGACGCCACACGTAGTGAAACAT What is the Tm and annealing temperature? (1) One of the reasons that companies might merge is to diversify theirproduct lines.TrueFalse Other than the rock itself, the most important chemical substance needed for the majority of weathering processes is-carbon dioxide.-nitrogen.-oxygen.-water. the ________ method sorts the array scores of the double[] type. Which statement best explains why the Tenth Amendment reserves some rights and powers to the states?The framers believed in the principle of federalism.The framers wanted the states to be very powerful.The framers wanted to limit citizens rights.The framers wanted to control civil liberties. Which of the following sets of ordered pairs lies on the y-axis of a coordinate grid?