What are the two pairs of horizontal ligaments inside the larynx that enable sounds to be made as air passes between them?

Answers

Answer 1

The two pairs of horizontal ligaments inside the larynx that enable sounds to be made as air passes between them are the vestibular ligaments (also known as false vocal cords) and the vocal ligaments (also known as true vocal cords).

The two pairs of horizontal ligaments inside the larynx that enable sounds to be made as air passes between them are:

Vocal cords (also known as vocal folds or vocal bands): These are located in the larynx and are composed of mucous membrane and muscle tissue. The vocal cords can vibrate as air passes over them, producing sound waves that can be shaped into speech or other vocal sounds.False vocal cords (also known as ventricular folds or vestibular folds): These are located above the true vocal cords and are also composed of mucous membrane and muscle tissue. While they do not directly contribute to vocalization, they can assist in protecting the true vocal cords and help regulate airflow during breathing and phonation.

Together, the vocal cords and false vocal cords play a crucial role in producing sound as air passes between them during vocalization. They can open and close, stretch, and vibrate in response to airflow and muscle tension, allowing for the production of a wide range of vocal sounds including speech, singing, and other forms of communication.

To know more about vocal cords,

https://brainly.com/question/4553891

#SPJ11


Related Questions

Which of the following samples is most often examined by a dissecting microscope instead of a compound light microscope?

Plant cells
Spore
Blood
Bacteria

Answers

plant cells is most often examined by a dissecting microscope instead of a compound light microscope.

What is a dissecting microscope used for?

A dissecting microscope serves the purpose of observing larger entities characterized by considerable depth, such as plant cells, offering enhanced visualization capabilities.

Conversely, a compound light microscope caters to the examination of smaller, flatter specimens like bacteria, providing a greater level of detail.

Additionally, compound light microscopes are frequently employed for the scrutiny of spores and blood samples, facilitating intricate analysis and investigation.

Learn about plant cells here https://brainly.com/question/913732

#SPJ1

what is the immediate source of energy for reforming atp from adp

Answers

The immediate source of energy for reforming ATP from ADP is the hydrolysis of another high-energy molecule, such as phosphocreatine or glucose-6-phosphate, through enzymatic reactions that release energy.

This energy is then used by the enzyme ATP synthase to power the formation of ATP from ADP and inorganic phosphate (Pi). In cells, the hydrolysis of phosphocreatine is a common way to generate energy for ATP synthesis, particularly in tissues with high energy demands, such as muscle cells.

Additionally, the breakdown of glucose and other nutrients during cellular respiration also provides energy that can be used to form ATP from ADP.

To know more about  atp here

https://brainly.com/question/252380

#SPJ4

If an organism has four pairs of chromosomes, after meiosis, the daughter cells will contain how many chromosomes

Answers

The given statement, "If an organism has four pairs of chromosomes, after meiosis, the daughter cells will contain how many chromosomes" indicates the number of chromosomes present in daughter cells after meiosis has taken place in an organism having four pairs of chromosomes. A pair of chromosomes is referred to as homologous chromosomes. Homologous chromosomes are those chromosomes that are present in pairs and contain similar genetic information.

Meiosis is the process of cell division that results in the formation of daughter cells with half the number of chromosomes present in the parent cell. It includes two rounds of cell division known as meiosis I and meiosis II. Meiosis I involves the separation of homologous chromosomes from each other, while meiosis II results in the division of sister chromatids. Both these divisions together help in the formation of haploid cells with half the number of chromosomes than the parent cell. During meiosis, the chromosomes go through different stages like prophase I, metaphase I, anaphase I, telophase I, and cytokinesis I, followed by prophase II, metaphase II, anaphase II, telophase II, and cytokinesis II.

A pair of chromosomes contains two sets of chromosomes that pair up during meiosis. Since there are four pairs of chromosomes present in the given organism, during meiosis I, these pairs would separate into different daughter cells. This means that each daughter cell would have two chromosomes, each from different pairs of chromosomes. After meiosis II, each daughter cell would have only one set of chromosomes, with one chromosome from each of the four pairs. Therefore, the daughter cells after meiosis in an organism with four pairs of chromosomes will contain 8 chromosomes.

To know more about cytokinesis I visit

https://brainly.com/question/32359786

#SPJ11

Which of the following is used by plants
to attract pollinators?
A. ovary size
B. stamen length
C. sweet-tasting fruit
D. cellulose

Answers

Answer:

C. sweet-tasting fruit

Explanation:

What do you use for heartbeats per minute

Answers

Answer:

It is largely used to gather heart rate data while performing various types of physical exercise. Measuring electrical heart information is referred to as Electrocardiography (ECG or EKG). Medical heart rate monitoring used in hospitals is usually wired and usually multiple sensors are used.

Explanation:

What happens to characteristics found in one generation of a species as it reproduces and has offspring

Answers

Answer:

When organisms undertake sexual reproduction, new recombination of characteristics also appear in the progeny. Sometimes an organism may develop mutation in germ cells. In such cases, new characteristic may appear in progeny due to the mutation it has inherited

Explanation:

What do viruses need to reproduce ?

Answers

Answer:

Explanation:

Viruses cannot replicate on their own, but rather depend on their host cell's protein synthesis pathways to reproduce. This typically occurs by the virus inserting its genetic material in host cells, co-opting the proteins to create viral replicates, until the cell bursts from the high volume of new viral particles.

Answer:

Viruses cannot multiply on their own and must rely on the protein synthesis pathways of their host cell to do so. This is normally accomplished by the virus injecting its genetic material into host cells, co-opting the proteins to generate viral replicates, and causing the cell to burst due to the high amount of new viral particles.

Explanation: Brainiest pls

1. Which of the following best describes why splicing is important for the detection of a nonsense mutation?
A. A mRNA that is not spliced cannot be exported from the nucleus.
B. An mRNA that is not spliced will not have exon junction complex proteins associated with it.
C. An mRNA that is not spliced cannot be bound by the ribosome.

Answers

The best description for why splicing is important for the detection of a nonsense mutation is option B: An mRNA that is not spliced will not have exon junction complex proteins associated with it.

Splicing is a crucial process in which introns are removed from pre-mRNA, and exons are joined together to form mature mRNA. It plays a significant role in generating functional mRNA molecules that can be translated into proteins. In the context of detecting a nonsense mutation, the presence or absence of splicing can have important implications.

Option A suggests that a mRNA that is not spliced cannot be exported from the nucleus. While splicing is necessary for mRNA export, it is not directly related to the detection of a nonsense mutation.

Option C suggests that an mRNA that is not spliced cannot be bound by the ribosome. Although splicing is important for proper translation, it is not directly relevant to the detection of a nonsense mutation.

Option B correctly describes the importance of splicing for detecting a nonsense mutation. Exon junction complex (EJC) proteins are deposited upstream of exon-exon junctions during splicing. They play a crucial role in mRNA surveillance mechanisms, including nonsense-mediated decay (NMD). NMD is a cellular process that degrades mRNA molecules containing premature stop codons to prevent the synthesis of truncated and potentially harmful proteins.

Learn more about splicing here:

https://brainly.com/question/32695744

#SPJ11

Age is an example of a ____________ measure. Age is an example
of a ____________ measure. nominal biological discrete
continuous

Answers

Age is an example of a nominal and discrete measure. It classifies individuals into distinct categories based on the number of years they have lived, but it does not have any inherent numerical meaning or allow for intermediate values.

Age is an example of a nominal measure. A nominal measure is a type of measurement scale that classifies data into distinct categories or groups. In the case of age, individuals are categorized into specific age groups, such as 0-18, 19-30, 31-45, and so on. These categories do not have any inherent numerical or quantitative meaning. Instead, they serve as labels to differentiate different age ranges.

Unlike a biological measure, which refers to physical characteristics of living organisms, age is not directly related to an individual's biology. It is a social construct that is used to determine the number of years a person has lived since birth. Age can be measured using a variety of units, such as years, months, or days.

Age is also a discrete measure because it takes on specific, separate values. For example, someone can be 15 years old, 25 years old, or 40 years old. There is no intermediate value between these discrete age categories.

On the other hand, age is not a continuous measure. A continuous measure is one that can take on any value within a certain range. For example, height or weight can have any value within a specific range. In the case of age, there are distinct categories and no intermediate values. You are either in one age group or another.


Learn more about discrete measure here:-

https://brainly.com/question/32265630

#SPJ11

Astronomy

Why is exercise an important part of living aboard the International Space Station? Is exercise more important for health on the ISS than on Earth? Explain.

Answers

↓Answer↓

Is exercise more important for health on the ISS than on Earth?

Crew members must exercise every day to prevent bone and muscle loss. Exercise is an important part of the daily routine for astronauts aboard the station to prevent bone and muscle loss. On average, astronauts exercise two hours per day. The equipment they use is different than what we use on Earth.

But when you're in orbit, exercise is absolutely vital! Physical activity is the most effective way to counteract the adverse effects of weightlessness on the human body. Exercise is therefore a crucial part of the daily routine on board the International Space Station ( ISS ).

Why is it so important for astronauts to exercise while they're in space?

If astronauts don't exercise, their bodies start losing bone and muscle. Bone and muscle loss mean decreased size and strength, and can reduce an astronaut's ability to do work because it makes them weak.

#carryonlearning

before the red bone marrow takes over completely, two other fetal organs contribute to RBC production; these are the

Answers

The production of red blood Cells (RBCs) begins in the yolk sac of the developing fetus. Initially, this organ is the main site of RBC production during the early part of pregnancy.

The liver and spleen take over the role of RBC production during the middle of the pregnancy. The liver produces numerous small immature RBCs, while the spleen produces fewer, larger RBCs. At around week 18 of gestation, the fetal red bone marrow begins to take over the role of producing RBCs, becoming the primary source for the remainder of the pregnancy and into adult life.

During this transition period, both the yolk sac, liver, and spleen continue to contribute to the production of RBCs. This allows for an increase in the red blood cell production needed to support the rapid growth and demands of the fetus.

RBCs produced by each of the organs differ slightly in size, shape, and lifespan. The different components of the RBC production system ensure that the fetus is able to meet its rapidly increasing demands during pregnancy.

Know more about yolk sac here

https://brainly.com/question/30345944#

#SPJ11

Helpppoo please no filessss

Helpppoo please no filessss

Answers

Answer:

i can’t see the answer choices

Explanation:

some organisms in a population are more likely to survive and
reproduce. Which statement gives the best explanation for this fact?

some organisms in a population are more likely to survive andreproduce. Which statement gives the best

Answers

Answer:

I belive your answer would be D. I am not 100% sure about this but It makes the most sense.

Explanation: Hope this helps and have an awesome day :)

pain is to ________ as cold is to ________. baroreceptors; thermoreceptors baroreceptors; chemoreceptors baroreceptors; nociceptors nociceptors; thermoreceptors chemoreceptors; nociceptors

Answers

Pain is to nociceptors as cold is to thermoreceptors.  The correct analogy for pain and cold would be nociceptors for pain and thermoreceptors for cold.

Pain and cold are both sensory experiences that are detected by specific receptors in our body. Pain is detected by specialized receptors called nociceptors, while cold is detected by receptors known as thermoreceptors. Therefore, the correct analogy would be nociceptors for pain and thermoreceptors for cold.

Nociceptors are sensory receptors that respond to potentially damaging stimuli, such as heat, pressure, or chemicals released during tissue damage. When activated, nociceptors send signals to the brain, resulting in the perception of pain.

On the other hand, thermoreceptors are sensory receptors that detect changes in temperature. They are particularly sensitive to cooler temperatures and help us perceive the sensation of coldness.

To summarize, the correct analogy for pain and cold would be nociceptors for pain and thermoreceptors for cold. Nociceptors detect potentially damaging stimuli and are responsible for the perception of pain, while thermoreceptors detect changes in temperature and allow us to perceive the sensation of coldness.

To know more about  nociceptors ,visit:

https://brainly.com/question/31358451

#SPJ11

1. The average household in the United States spends $1,500 a year on
a. repairs to the home.
b. windows and doors.
c. insulation.
d. energy bills.

Answers

Answer: D. energy bills

Explanation: Good luck! :D

D. Energy Bills , hope this helps!

what is a scientific report

Answers

Answer:

A scientific report is a document that describes the process, progress, and or results of technical or scientific research or the state of a technical or scientific research problem. It might also include recommendations and conclusion of the research.

Invasive species have what affect on native populations when they exist in the same niche?

Answers

Answer: their population was affected

Explanation:

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA? I'll give u 15 point pls answer

Answers

I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC

what would be the major significance of a sim tube that was observed to be completely turbid following inoculation and incubation?

Answers

The complete turbidity of the sim tube indicates substantial microbial growth, highlighting the successful proliferation of microorganisms in the provided conditions.

The observation of a completely turbid sim tube following inoculation and incubation would indicate a significant growth of microorganisms in the medium. Turbidity refers to the cloudiness or opacity of a liquid, and in this case, it suggests that the microorganisms present in the tube have multiplied extensively, resulting in a dense suspension of cells.

This finding suggests that the microorganisms in the inoculum were able to utilize the nutrients in the medium and proliferate, indicating their ability to grow and survive under the provided conditions. It could indicate the presence of a potentially infectious agent or the successful growth of a desired microorganism for research or industrial purposes. Further investigations, such as microscopic examination or biochemical tests, would be required to identify the specific microorganisms and determine the significance of their growth in the tube.

Learn more about sim tube from the given link

https://brainly.com/question/9432084

#SPJ11

What three different genotypes are possible for an individual in this population

Answers

Answer:

With alleles 'A' and 'a' there are three possible genotypes AA, Aa and aa

Explanation:

Pls mark as brainliest answer

Mention any three things that you want to do to change your society​

Answers

Answer:

Sue the humans for taking our honey, marry Renee Zellweger, learn some jazz.

3. What tool do we use to write conclusions? Briefly
summarize it.

Answers

Answer: You use a restatement of the speech's thesis; a review of the main points discussed within the speech; and a concluding device that helps create a lasting image in audiences' minds.

Explanation:

In animal cells, the primary organelle that generates molecules of ATP is theA.golgi body B.lysosome C.No answer is correct D.ribosome E.mitochondrion

Answers

In animal cells, the primary organelle that generates molecules of ATP is the mitochondrion, (option D) it is where cell respiration takes place.

The ribosomes are the responsible of protein synthesis.

Lysosomes's main function is to degrade waste thanks to enzymes inside them.

The golgi body or apparatus helps to process proteins and lipids, for example by sending them to the organelle where they make their function.

gary and diane are preparing a garden. As part of their work, they must prepare the soil and plant 100 flowers. it would take diane 10 hours to prepare the soul and 12 hours for planting.
1. how much time would it take the two to complete the garden if they divide the soil prepration equally and the planting equally?
2. how much time would it take the two to complete the garden if they use compararive advantage and specialize in soil preparation or planting?

Answers

1. Time taken by Gary and Diane to complete the garden if they divide the soil preparation equally and the planting equally is 32 hours.

2. Time taken by the two to complete the garden if they use comparative advantage and specialize in soil preparation or planting is 34 hours.

1. To calculate the time taken by Gary and Diane to complete the garden, let's write the time taken by Gary to prepare the soil to be x hours. So, the time taken by Diane to prepare the soil will also be x hours. As given, Diane can plant 100 flowers in 12 hours. Thus, Diane can plant 25 flowers in 3 hours. Therefore, the time is taken by Diane to plant 100 flowers

= (100/25) × 3 = 12 hours.

Now, the time taken by Gary to plant 100 flowers will also be 12 hours. Therefore,

total time taken by both Gary and Diane to complete the garden = Time taken for soil preparation + Time taken for planting

= 2x + 12 hours = (2 × 10) + 12

= 32 hours

2.  To calculate the time taken by the two to complete the garden if they use comparative advantage and specialize in soil preparation or planting, we know that Diane can prepare the soil in 10 hours while Gary can prepare the soil in 20 hours. Therefore, Diane should prepare the soil. Now, the time is taken by Diane to prepare the soil = 10 hours. Diane can plant 100 flowers in 12 hours while Gary can plant 100 flowers in 24 hours. Therefore, Gary should plant the flowers.

Now, the time is taken Gary to plant the flowers = 24 hours. Therefore,

total time taken by both Gary and Diane to complete the garden = Time taken for soil preparation + Time taken for planting

= 10 + 24

= 34 hours

Learn more about comparative advantage: https://brainly.com/question/7780461

#SPJ11

During translation, what does the tRNA deliver to the ribosomes?

Answers

Answer: amino acids

Explanation:

distinguish between prenatal and postnatal care​

Answers

Pregnancy care consists of prenatal (before birth) and postpartum (after birth) healthcare for expectant mothers. It involves treatments and trainings to ensure a healthy prepregnancy, pregnancy, and labor and delivery for mom and baby.

How are brain and nerve cells function related to their structure?

Answers

Specialized projections called axons allow neurons to transmit electrical and chemical signals to other cells.

my favorite part of I like to go see my friend... what you like to do? A. Go to the Movies B. have fun with friends C. have a spa night D. Christmas and thanksgiving break

Answers

Answer:

D. Christmas and Thanksgiving break

Why it is important that the plant is kept at room temperature and given plenty of light , water and minerals during the experiment?

Answers

Answer:

To make it germinate well

Explanation:

A planted seed need the requirements to be able to grow well

Because without the listed above the plant will never grow

In anthrax, Bacillus anthracis gains access to the bloodstream where it multiplies in large numbers resulting in death from an overwhelming _________.

Answers

Answer:

septicemia.

Explanation:

In anthrax, Bacillus anthracis gains access to the bloodstream where it multiplies in large numbers resulting in death from an overwhelming septicemia.

Hope this helps!

In anthrax, Bacillus anthracis gains access to the bloodstream through inhalation, ingestion, or contact with broken skin.

Once in the bloodstream, the bacteria rapidly multiply in large numbers and produce toxins that cause tissue damage and immune system dysfunction. The overwhelming result of anthrax is septicemia, which is a severe infection of the blood that can lead to organ failure and death. The toxins produced by Bacillus anthracis can also cause respiratory distress and meningitis, which further contribute to the lethality of the disease. Treatment for anthrax typically involves antibiotics to kill the bacteria and supportive care to manage symptoms and prevent complications. In severe cases, antitoxins may also be administered to neutralize the effects of the toxins. Prevention of anthrax involves avoiding exposure to the bacteria through vaccination, proper handling of animal products, and proper decontamination of potentially contaminated areas.

learn more about anthrax

https://brainly.com/question/874039

#SPJ11

Other Questions
compare the centralized power of the soviet union with the contemporary russian federation, in terms of the control of territory. which of the following statements does the information in the map best support? which was not an effect of the new deal programs on American lifeunemployment dropped significantly government power grewpublic works project had a national impact the economy rebounded to 1928 levels Find the domain of the vector-valued function. (Enter your answer using interval notation.) r(t) = (16 t^2i) + t^2j 6tk What is the equation of the directrix? Which process of alimentary canal that remove undigested food from body? *3 pointsA. EgestionB. IngestionC. Assimilation Part BHow does the use of the correct structure from Part A support one of the author's purposes in the passage? 1. It echoes the predictability of the summerexperiences the author describes. 2. It emphasizes the idea that the pleasures the author writes about seem endless. 3. It suggests that the author has the experience to write credibly about her subject. 4.It reinforces that the author has varied recollections and a range of reactions to them. What is identified as the key issue to consider when deciding on policy ownership in the event of a claim? Select one: Othe tax liability on the policy proceeds is kept to nil Osufficient insurance is bought for the risk involved Othe policy proceeds are made payable to the relevant and appropriate person or party Oeach policy should be purchased by the life insured to make the process of a claim less complex What does the body do when the outsidetemperature is too cold for the testicles?A. Retract the scrotum to bring the testicles close to thebodyB. Distend the scrotum and testicles away from the bodyC. Fill the scrotum with seminal fluidD. Constrict the scrotum around the testicles Alyssa noted that the homemade ice cream was iquid when she poured it in the ice cream maker, Ice was added around the outside of the container. After it quit turning, she opened it to find the ice creamwas solid. What changed? (point)The ice added heat to be ice cream mix causing it to be solid.The ice removed heat from the ice cream mix causing it to melt.The Ice added heat to the ice cream mix causing it to be liquid.The ice removed heat from the ice cream mix causing it to freeze. What do you think about the role of technology in teaching language skills? Give the correct form of the verb indicated inparenthesesLes spectateurs ____ (applaudir).J' ______ (remplir) les verres.Vous______(agir) sans rflchir.Nous _____(russir) faire lexercice .ll _____(rougir) facilemrnt.On _____(dfinir) le contrat Les fruits______(mrir) sur les Arbres. Vous_____(garantir) la russite Marwa & Co. purchased a parcel of land six years ago for $651932. At that time, the firm invested $209664 in grading the sites that be at that time, it decided to lease the land for $53,500 a year. The company is now considering building a warehouse on the site an What value should be included in the initial cost of the warehouse project for the use of this land? The PPF slopes downward because Group of answer choices because the opportunity cost of production is constant we are using all our resources only if technology is not improving resources are scarce and therefore we must make trade-offs because we can produce more of one good without giving up production of the other good. 2) what is the domain of f(x) = x + 6x + 5 what is the value ofwhat is the value of 3 to the second power / 3 to the 4th power Joseph wants to dig a trench in his back yard to bury a cable. He mapped out his back yard so that it is a coordinate plane so that each unit represents 1 foot, He needs to dig from (-4,1) to (8,6). If he digs a straight line, how long should his trench be, in feet? what does the anthropological approach to world art attempt to do? State, and explain why, three (3) mechanical and/or physical properties that you would consider important in selecting material for each of the following jet engine components a) Compressor blades (in front of the combustion chamber) (6 marks) b) Turbine blades (immediately following the combustion chamber) ( 6marks ) Note that different parts of the turbine engine are exposed to DIFFERENT temperatures (0-1500) and stresses (0- 40 atm) as per the diagrams below. Part of the proceeds from a garage sale was 535$ worth of 5$ and 20$ bills. If there were 2 more 5$ bills than 20$ bills, find the number of each denomination Calculate the mass of butane needed to produce 50.0 g of carbon dioxide.