Bees and birds visit flowers in search of pollen and nectar. In the process flowers are pollinated. What type of relationship is
represented?
A) mutualism
B)parasitism
C)commensalism
Answer:
This is A) mutualism because both species get something out of it : )
Why is a small population greatly affected during genetic drift?
are rabbits black hair is dominant to brown hair also in Roberts long and straight years are dominant to floppy ears
Type the correct answer in the box.
Write the full form of the abbreviation.
The full form of BUN is what
Answer:
Blood Urea Nitrogen
Explanation:
I hope this helps :)
what is the answer for this please explain too
In the given scenario, the water will move from cell to the outside, resulting in decrease in cell size. The correct option is A.
If a container has a cell with a 10% salt solution and 90% water, and the outside concentration is 30% salt and 70% water, osmosis will occur.
Osmosis is the movement of solvent molecules (in this case, water) across a semi-permeable membrane from an area of lower solute concentration to an area of higher solute concentration.
In this scenario, the cell has a lower salt concentration (10%) compared to the outside environment (30%).
As a result, water molecules will move from the area of lower salt concentration (inside the cell) to the area of higher salt concentration (outside the cell) in an attempt to equalize the solute concentration on both sides of the membrane.
Thus, the correct option is A.
For more details regarding osmosis, visit:
https://brainly.com/question/31028904
#SPJ1
do the usage of synthetic plant hormones for the modification of plant growth have any environmental implications
The usage of synthetic plant hormones for the modification of plant growth can have environmental implications.
Understanding the Effect of Synthetic Plant HormonesFactors to consider
1. Ecotoxicity: Synthetic plant hormones, if not properly regulated or used in excessive amounts, can pose risks to non-target organisms and ecosystems. They may affect the growth and development of other plants, beneficial insects, and microorganisms, potentially disrupting ecological balance.
2. Soil and Water Contamination: Improper application or disposal of synthetic plant hormones can lead to soil and water contamination. Runoff from treated fields or improper disposal of unused hormones may introduce these compounds into water bodies, potentially affecting aquatic organisms and overall water quality.
3. Resistance and Persistence: Repeated and excessive use of synthetic plant hormones can contribute to the development of resistance in target plant species. This can lead to the evolution of herbicide-resistant weed populations, requiring higher doses or different chemicals to achieve the desired effect. Moreover, some synthetic hormones may persist in the environment for extended periods, potentially impacting subsequent crops or natural vegetation.
4. Non-target Effects: Synthetic plant hormones may influence the growth and development of unintended plant species, leading to unintended consequences such as changes in biodiversity, alteration of natural plant communities, or interference with the natural ecological succession.
5. Human Health Concerns: The potential impacts of synthetic plant hormones on human health are an area of ongoing research. While these hormones are generally considered safe for use in agriculture when used according to regulations, there may be concerns related to exposure, residues, or indirect effects on food quality and safety.
Learn more about synthetic plant here:
https://brainly.com/question/27805626
#SPJ1
which organelle converts cellular polymers into monomers? 1)lysosomes 2)golgibody 3)plastids 3)SER
Answer:
1) lysosomes
Explanation:
because, they involve in intracellular digestion
Sometimes patients with Dementia experience the inability to complete tasks.
Simple tasks such as getting dressed, brushing teeth, and eating become
overwhelming. This inability to perform familiar tasks is?
Forgetfulness
Agnosia
Apraxia
Delusions
Apraxia is the inability to carry out routine duties as they are explained in the context.
A neurological illness known as apraxia is characterised by the loss or impairment of the capacity to carry out or execute skilled or deliberate motions, even though the affected person is physically capable of doing so.
Apraxia in dementia patients might show itself as trouble with once-routine and familiar daily tasks like dressing, grooming, or eating. In contrast to other cognitive symptoms of dementia such as forgetfulness, agnosia (loss of sensory perception), and delusions, which are not explicitly connected to the inability to perform tasks, apraxia is separate from these symptoms.
Learn more about Apraxia, here:
https://brainly.com/question/31668736
#SPJ1
Describe the WAYS in which the size of a fish population in an aquarium could be REDUCED by changes in the ABIOTIC factors in its habitat.
2. dependence problems.
narcotic
illegal drug
narcotic are illegal drugs is a true statement.
Option A is correct
What are narcotic?The term narcotic originally referred medically to any psychoactive compound with numbing or paralyzing properties
Chemicals with an intense physiological effect, such as drugs and psychoactive chemicals, modify brain function and momentarily affect perception, mood, and feelings.
Due to their detrimental effects on the body and human health, drugs are outlawed in the majority of nations around the world. Heroin and cocaine, which are deadly narcotics, cause the most severe addiction.
Drug dependence results in both physical and mental dependence.
Learn more about Drug at:
https://brainly.com/question/30392650
#SPJ1
Complete question:
. Narcotics are illegal drugs
A. O True
B. O False
What are the stages of bee development (eggs,larvae,pupae)
The stages of bee development are egg, larva, pupa, and adult. Eggs hatch into larvae, which then transform into pupae. Finally, adult bees emerge and undergo further maturation.
The stages of bee development are:
1. Egg: The bee life cycle begins when the queen bee lays an egg in a honeycomb cell.
2. Larva: The egg hatches into a larva, which is a legless, grub-like creature. The larva is fed a special diet called royal jelly, which stimulates its growth.
3. Pupa: The larva undergoes metamorphosis and transforms into a pupa. Inside the sealed cell, the pupa undergoes various changes, developing into an adult bee.
4. Adult Bee: After completing the pupal stage, the fully developed adult bee emerges from the cell. The bee then undergoes further maturation, such as its exoskeleton hardening, wings expanding, and adult coloration appearing.
It's important to note that there are three castes of bees: queen, worker, and drone. The development process for each caste is similar, but the diet and size of the cells they are raised in differ, leading to their distinct roles within the colony.
For more questions on bee development:
https://brainly.com/question/28696131
#SPJ8
Which are examples of active transport across the cell membrane? a. osmosis and diffusion b. diffusion and facilitated diffusion c. osmosis and chemiosmosis d. endocytosis and exocytosis
Answer:
d. endocytosis and exocytosis
Explanation:
These processes bring specific items in/out of the cell through active transport since the particles being brought in are generally large. Water for example, a much smaller particle, would use passive transport through the process of osmosis. Hope this helps!
Endocytosis and exocytosis are examples of active transport across the cell membrane.
Active transport is the movement of substances in and out of the cell through the membrane using energy and occurs against a concentration gradient.
Endocytosis is called the process by which cells incorporate into them molecules, large or small, that cannot pass through the cell membrane.An example is the endocytosis of the complex that is formed between receptor proteins of polypeptide or protein hormones at the level of the plasma membrane.
Exocytosis is the process by which different types of molecules contained in a cytoplasmic vesicle of a cell are secreted outwards.Insulin secretion is done in small pinocytosic vesicles that have insulin in colloidal dispersion, this secretion is in favor of a gradient, since insulin is more concentrated within the cell than in the extracellular space.
Therefore, we can conclude that endocytosis and exocytosis are examples of active transport across the cell membrane.
Learn more here: https://brainly.com/question/1109181
Deer mice are usually dark brown and live in forests with dark soil. However, the deer mice in the Sand Hills of Nebraska are lighter brown and live in an area with light, sandy soil.
Based on this information, what ,begin emphasis,most,end emphasis, likely caused the change in the Sand Hills deer mice?
Answer options with 4 options
A.
Lighter colored mice were preferred by females.
B.
Lighter colored mice came from snowy habitats in the north.
C.
Lighter colored mice had more dominant genes in their new habitat.
D.
Lighter colored mice were more likely to avoid predators and to reproduce.
Lighter colored mice were more likely to avoid predators and to reproduce. Therefore, option (D) is correct.
The lighter brown coloration of the deer mice in the Sand Hills of Nebraska is likely an adaptation that provides them with a survival advantage in their specific habitat. The light, sandy soil in the area may offer better camouflage for lighter colored mice, making them less visible to predators and increasing their chances of survival.
As a result, these mice would have a higher likelihood of successfully reproducing and passing on their lighter coloration traits to future generations.
Learn more about natural selection, here:
https://brainly.com/question/20152465
#SPJ1
The diagram shows a transform fault. What is a likely result of slippage along
this fault?
Fault
OA. Seismic waves
OB. Tsunami
OC. Lahar
D. Pyroclastic flow
The diagram shows a transform fault and it is a likely result of slippage along this fault? is A. Seismic waves
A likely result of slippage along a transform fault is seismic waves (option A). A transform fault is a type of tectonic plate boundary where two plates slide past each other horizontally. As the plates move, stress builds up along the fault line, and when it exceeds the strength of the rocks, slippage occurs, releasing accumulated energy.
During the slippage, the rocks on either side of the fault quickly move relative to each other. This rapid movement generates seismic waves, which are vibrations that propagate through the Earth's crust. These seismic waves travel outward from the fault in all directions, causing ground shaking and vibrations.
Seismic waves are responsible for earthquakes, and their intensity and magnitude can vary depending on factors such as the amount of slippage, the depth of the fault, and the strength of the rocks involved. The seismic waves can result in ground shaking and can potentially cause damage to buildings, infrastructure, and human lives, depending on their magnitude and proximity to populated areas. Therefore, seismic waves are a likely result of slippage along a transform fault. Therefore, Option A is correct.
Know more about Seismic waves here:
https://brainly.com/question/8553835
#SPJ8
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt
The subject is actually science please answer it’s due soon! i’ll give brainliest
Answer:
weight and texture maybe?
Explanation:
How can color be use in balance?
Answer:
Color balance changes the overall mixture of colors in an image and is used for color correction. Generalized versions of color balance are used to correct colors other than neutrals or to deliberately change them for effect.
Explanation:
How might an iceberg move
once it breaks off from a
glacier?
Answer:
Once an iceberg breaks off from a glacier, it will start to drift away due to the movement of the surrounding water, which is driven by ocean currents, tides, and winds. The speed and direction of the movement depend on the strength and direction of these forces. Additionally, the shape and size of the iceberg, as well as the depth and temperature of the water, can also affect its movement.
Think of a post apocalyptic wasteland. Think States that you’re probably thinking. “That place sounds terrible” what is the “tremendous“ advantage to desolate wastelands? options: A. no competitionB. competition
Let's define what "post-apocalyptic" means:
Post-apocalyptic refers to a massive catastrophe that has occurred. The root "post" means after and apocalyptic would mean some terrible disaster. Recall that in an apocalypse, majority of species have been wiped out.
Let's take this into context of the problem:
If post-apocalyptic means desolate wastelands, that would mean that there aren't many organisms left in the world. Resource piles would be depleted, but there are fewer organisms that require it since the population got wiped out. That means there is less competition for resources.
Therefore, our answer is A.
as a cell's size increases, what happens to the ratio of its surface area to its volume?
A:the ratio stays the same
B:the surface area increases as the volume increases
C:the surface area does not increase as fast as the volume increases
D:the ratio of surface area to volume does not matter
Answer:
Surface Area to Volume Ratios: Notice that as a cell increases in size, its surface area-to-volume ratio decreases. When there is insufficient surface area to support a cell's increasing volume, a cell will either divide or die.
the most important factor contributing to the modern day extinction of hundreds of species on the eartjh
In most medical procedures, hazardous waste is produced. This waste is usually burned, which can release chemicals lie mercury into the air.
How could technology be best used to solve this problem?
A. Incinerate the waste in areas with low populations.
B. Find a way to trap the mercury before it is released.
C. Reduce the number of medical procedures performed.
D. Stored the waste underground instead of burning it.
To solve the problem of hazardous waste generated from medical procedures and the release of chemicals like mercury into the air, a combination of technological approaches can be employed.
B. Find a way to trap the mercury before it is released: Implementing advanced filtration systems and scrubbers in medical waste incinerators can effectively capture and contain mercury and other harmful substances. This prevents their release into the environment and ensures their proper disposal.
D. Store the waste underground instead of burning it: Rather than incinerating medical waste, an alternative method involves safely storing it underground in specially designed containers. This approach minimizes the risk of releasing hazardous chemicals into the air and reduces the potential for environmental contamination.
A. Incinerate the waste in areas with low populations: Locating medical waste incinerators in remote or sparsely populated areas can help minimize the exposure of nearby communities to hazardous emissions. This approach ensures that the impact on public health is minimized while still addressing the waste management problem.
C. Reduce the number of medical procedures performed: Implementing strategies to reduce unnecessary medical procedures, optimizing healthcare practices, and promoting preventive measures can effectively reduce the overall volume of medical waste generated. This approach not only mitigates the waste management issue but also has broader benefits in terms of healthcare efficiency and cost-effectiveness.
know more about hazardous here:
https://brainly.com/question/30156449
#SPJ8
What is one way that calcium and parathyroid hormone maintain homeostasis?
Answer:
The answer is C.
Explanation:
why a pond is considered a community and also ecosystem
Answer:
A pond is an area filled with water, either natural or artificial, that is smaller than a lake. Ponds can be created by a wide variety of natural process (. on floodplains as cut off river channels, by glacial processes, by Pearl and
formation, in coastal dune systems, by beavers) or they can simply be isolated depressions (such as a kettle hole, vernal pool, prairie pothole or
Answer:
The pond contains both. It contains things like water, rocks, mud, sand, available oxygen, temperature, pH, etc. It also contains living items like bacteria, fish, frogs, etc. That's an ecosystem.
Explanation:
during its exponential growth phase, a certain bacteria can grow from 5000 cells to 12000 cells in 10 hours. at this rate, how long will it take to grow 50000 cells
what are other ways that wite blood cells protect the body other than
producing antibodies
White blood cells engage in defence-related functions by consuming foreign objects and cell debris, eliminating pathogens and cancer cells, or by creating antibodies.
The immune system of the body includes white blood cells. They support the body's defences against illness and infection. Granulocytes (neutrophils, eosinophils, and basophils), monocytes, and lymphocytes are different types of white blood cells (T cells and B cells).
You run a higher risk of getting sick if your white blood cell count is low, especially if your neutrophil count is low. Additionally, your body is unable to defend itself if you contract an illness when your white blood cell count is low. In some situations, the infection might be fatal.
Learn more about white blood cells here:
https://brainly.com/question/17890844
#SPJ9
Which of these is not a challenge for respiration in water? question 3 options: the density of water is very high relative to air. water holds approximately 30 times less oxygen when compared to air. water requires an additional energy expenditure to move across epithelial surfaces. water moving across respiratory surfaces removes heat from the animal. water breathing animals have a high risk of desiccation.
Water breathing animals do not face a challenge for respiration in water because they have evolved ways to optimize oxygen uptake from the water they inhabit.
These animals have adapted specialized gills that contain a large surface area which enables them to efficiently absorb oxygen from the water. They also have an increased number of blood vessels in their gills which increases the oxygen uptake from the surrounding water.
Additionally, the blood vessels in their gills contain counter current exchange systems that enable them to extract more oxygen from the water. This adaptation allows these animals to extract more oxygen from the water than would otherwise be available in the surrounding environment.
To learn more about respiration visit:
https://brainly.com/question/28312300
#SPJ4
In 1937, a man employed to lay water pipes was found to be the source of a severe epidemic of typhoid fever. The man, an asymptomatic carrier of Salmonella enterica serotype Typhi, the bacterium that causes typhoid, habitually urinated at his job site. In the process, he contaminated the town’s water supply with bacteria from his bladder. Over 300 cases of typhoid fever developed, and 43 people died before the man was identified as the carrier.
Given that antibiotics were not generally available in 1937, how could health officials end the epidemic, short of removing the man from the job site?
Answer:
They could lay new water pipes.
please help i give 48 points !!!which correctly lists the three layers in which water moves easily
A: ROCK, CLAY ,GRANITE
B: SOIL,ROCK,ORGANIC LAYER
C: CLAY,ORGANIC LAYER, GRANITE
D: GRANITE, ROCK, SOIL
soil, rock, organic layer
Explanation:
Permeability is the ability of a layer of rock to transmit fluid such as oil or water
The factors that affect the permeability of a rock layer includes the sizes of the rock particles, the ratio of the available voids to the solid mass of the rock, the presence of trapped air and the presence of organic matter
Rocks such as gravels, and sparingly cemented sands have high permeability
The most impermeable of the options are granite and clay which for granite has large particle mass and contain no voids while clay has very fine particles packed together with little room for water
Therefore, water moves easily between layers soil, rock, organic layer
Answer:
SOIL, ROCK, ORGANIC LAYER
Explanation:
Edge 2020, hope this helps :)
What is a phenotypic variation?
Answer:
Mendel worked with pea plants showing complete dominance for various characteristics
- E.g. flower color, plants either have purple flowers or white flowers
- A particular genotype produces a recognizable phenotype
Explanation:
Phenotypes can cause by genes, environmental factors, or a combination of both.
Phenotypic variation, then, is the variability in phenotypes that exists in a population. For example, all people come in different shapes and sizes: height, weight, and body shape are phenotypes that vary.