Answer:
Common sedimentary rocks include sandstone, limestone, and shale
Explanation:
Answer:
Sandstone, Shale, siltstone, chert,
Explanation:
Those are common sedimentary rocks
Identify the choice that best completes the statement or answers the question.
Tamar is talking about evolution with a friend. The friend says, "It's just a theory,
so I don't believe it. When they prove it and it becomes the law of evolution, then
maybe I'll change my mind."
Which of these possible replies best describes scientific principles or the work of
scientists?
Scientific theories do not become scientific laws; they are explanations for natural
phenomena based on evidence.
Scientists take each other at their word regarding experimental results, and the public
should, too.
O He should be wary of science because it is based on research and evidence, not bias and
opinion.
Science always finds the right answer; the answers that scientists and researchers
discover never change.
Answer:
The answer is: Scientific theories do not become scientific laws; they are explanations for natural phenomena based on evidence.
Explanation:
The other answers talk about how 1) Science should be bias or opinion based 2) Scientists only take each other's word and 3) Science never changes. All of these are false. Science does sometimes change, it should not be bias or opinion-based, and scientists do not always take each other's words.
Answer:
Scientific theories do not become scientific laws; they are explanations for natural phenomena based on evidence.
Explanation:
in the bromination of (e)-stilbene, what is the nucleophile in the final step of the mechanism?
In the bromination of (E)-stilbene, the reaction mechanism involves the generation of a bromonium ion intermediate.
This occurs when Br2 reacts with the pi electrons of the alkene (E)-stilbene, forming a bridged, three-membered ring intermediate. The bromonium ion is then attacked by a nucleophile, which can be a variety of species such as water, bromide ion (Br-), or other nucleophiles.
In this specific reaction, the bromide ion is the nucleophile that attacks the bromonium ion intermediate, resulting in the formation of trans-dibromo (E)-stilbene. The bromide ion acts as a nucleophile by donating a pair of electrons to the bromonium ion, breaking the ring and forming the new carbon-bromine bond. This results in the formation of a stable, neutral molecule with two bromine atoms attached to the alkene.
Learn more about bromination:
https://brainly.com/question/24202507
#SPJ11
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
which factor most likey results in the loss of genetic variation from small populations?
A migration
B mutation
C genetic drift
D genetic recommendation
Answer:
C genetic drift
Explanation:
variation in the relative frequency of different genotypes in a small population, owing to the chance disappearance of particular genes as individuals die or do not reproduce.
The five substages of M phase are designed to accomplish two main goals: equal partitioning between the two cells of chromosomal material and of cytoplasmic contents. What are these two processes called
The two processes called in the five substages of the M phase are the equal partitioning of chromosomal material and cytoplasmic contents between the two cells. The M phase is a significant stage of the cell cycle that is also referred to as the Mitotic phase. It consists of five substages, all of which are designed to accomplish two main goals: equal partitioning between the two cells of chromosomal material and of cytoplasmic contents. These two processes are called cytokinesis and mitosis. Mitosis is the process of nuclear division that separates the replicated genetic material that is in the nucleus into two identical daughter nuclei.
Cytokinesis is the second stage of the M-phase, and it's the division of the cytoplasmic contents of the cell into two cells. Therefore, Mitosis and Cytokinesis are the two processes called in the five substages of the M phase that are designed to accomplish two main goals: equal partitioning between the two cells of chromosomal material and of cytoplasmic contents.
The two main goals of the M phase are achieved through these two processes. Cytokinesis and Mitosis help in separating the genetic material in the nucleus and the cytoplasmic contents of the cell to make sure each new cell receives an equal number of chromosomes and the necessary organelles to function.
Learn more about Cytokinesis: https://brainly.com/question/29765124
#SPJ11
which type of soda has more sugar?
Adversarially trained neural representations may already be as robust as corresponding biological neural representations
Primates' visual systems are the benchmark for strong perception. The widespread consensus is that strong artificial vision systems can be produced by imitating the neuronal representations that underlie such systems. Here, we create a technique for launching adversarial visual attacks directly on the brain activity of primates. We then use this technique to show that the aforementioned assumption might not be supported. In particular, we reveal that the susceptibility to adversarial perturbations displayed by the biological neurons that comprise primates' visual systems is comparable in scale to that of current (robustly trained) artificial neural networks.
What is an artificial vision system?
The camera that records an image for analysis and the processing engine itself that generates and transmits the output are just two parts of an artificial vision system.
Why is neuronal activity important?
According to research, neuronal activity influences developmental processes such as neurogenesis, migration, programmed cell death, cellular differentiation, formation of local and long-distance axonal connections, synaptic plasticity, or myelination, and is crucial for the proper formation of neuronal circuits.
Learn more about neuronal circuits: https://brainly.com/question/13648826
#SPJ4
how would the expansion and operation of human communities influence the fish population?
Accelerated destruction of natural habitat, due to increased housing and feeding has influenced the fish population.
What is natural Habitat?Natural habitat is range of resources, physical and biotic factors that are present in an area to support reproduction and survival of particular species.
Habitat include physical factors such as soil, temperature, light, and moisture. The biological factors include food availability and presence or absence of predators.
Habitat can be defined as different species living in the same area. for example, forest, grassland, desert, rivers, lakes, ponds and marine habitat.
But, expansion and operation of human communities influence the fish population.
Learn more about natural Habitat, here:
https://brainly.com/question/18321187
#SPJ1
what is chlamydomonas?
Answer:
a common single-celled green alga which typically has two flagella for swimming, living in water and moist soil.
Can 2 objects made from exactly same substance but different shape or size have the same density? Make a graph
Yes, 2 objects made from exactly same substance but different shape or size have the same density.
How is it possible for items to have varying sizes but the same density?A substance's density is typically independent of its size, both large and small, and independent of its shape. Despite having distinct masses and volumes, a gold brick and a statue both have the same density. A substance's density is generally understood to be its mass per unit volume.
Therefore, object with the highest density will be the smaller of two things if they both have the same mass but differ in size. So one can say that two things have comparable densities if they have the same mass.
Learn more about density from
https://brainly.com/question/1591709
#SPJ1
the tuberculin skin test, or ppd test, is based on which of the following?group of answer choicesa delayed hypersensitivity and cell-mediated immunity to certain antigenic components of the organism.a subsequent mild cutaneous infection with mycobacterium tuberculosisan antigen/antibody reactions occurring at the injection site.
The tuberculin skin test, or PPD test, is based on a delayed hypersensitivity and cell-mediated immune response to certain antigenic components of the Mycobacterium tuberculosis bacteria. Option 1 is correct.
A small amount of purified protein derivative (PPD) from the bacteria is injected into the skin and, if the person has been previously infected or vaccinated against tuberculosis, their immune system will recognize the PPD as foreign and initiate a localized immune response. This response causes a small bump or swelling at the injection site, which is measured after a certain amount of time. This test is used to screen for tuberculosis infection and is an important. Option 1 is correct.
To know more about Mycobacterium, here
brainly.com/question/13187853
#SPJ4
--The complete Question is , The tuberculin skin test, or ppd test, is based on which of the following?
group of answer choices
1. a delayed hypersensitivity and cell-mediated
2. immunity to certain antigenic components of the organism.
3. a subsequent mild cutaneous infection with mycobacterium
4. tuberculosisan antigen/antibody reactions occurring at the injection site. --
A microorganism measures 5 μm in length. Its length in mm would be.........a. 0.05 mm.b. 0.5 mm.c. 500 mm.d. 0.005 mm.e. 50 mm.
0.005 mm. Micrometers, or one millionth of a meter, are typically used to describe a microbe's size. There are many other characteristics of microbes that can be measured, such as genome size and growth rates.
There are trillions of microorganisms, or "microbiomes," living on and inside of us, in our homes and the air we breathe, as well as in the soil and plants. The majority of microbiomes support vital processes like plant growth and digestion in both our bodies and environments. We are successfully coexisting with them for the most part. We could use these complex microbial communities for applications in agriculture and food safety, water treatment, manufacturing, renewable energy, and biological threat detection with a better understanding of these communities. Microbial genomic sequencing data are increasingly being used in high stakes decisions affecting public health and safety.
Learn more about ' Micrometer ' visit here;
https://brainly.com/question/13499096
#SPJ4
which substance has a natural pH?
a. distilled water
b. milk
c. groundwater
d. Rainwater
Answer: (A) Distilled Water
explain how single-nucleotide polymorphisms and restiction fragment length polymorphisms were demonstrated in analyzing sickle-cell alleles
Single nucleotide polymorphisms (SNPs) are locations where one DNA molecule varies from another by a single nucleotide. Restriction fragment length polymorphisms (RFLPs) are DNA molecules that differ in length due to small changes.
In analyzing sickle-cell alleles, both single-nucleotide polymorphisms (SNPs) and restriction fragment length polymorphisms (RFLPs) were utilized. Sickle-cell anemia is an inherited disorder that affects the hemoglobin protein in red blood cells, which transport oxygen throughout the body. This disease affects both the genetic and protein levels of the body.A mutation in the beta-globin gene, which is located on chromosome 11, causes sickle-cell anemia. This mutation causes the substitution of a single nucleotide in the gene's DNA, changing the amino acid valine for glutamic acid in the beta-globin protein. A restriction enzyme called Mst II can be used to detect the mutation that causes sickle-cell anemia. The Mst II restriction enzyme cuts the DNA at specific locations, but it cannot do so if the substitution occurs. As a result, the DNA of people with sickle-cell anemia would have a longer restriction fragment length polymorphism than that of people who do not have the condition.
To know more about polymorphisms visit:
https://brainly.com/question/29887426
#SPJ11
Which of the following statements is true about all microbes?
A. All microbes contain a nucleus.
B. All microbes contain a genome.
C. All microbes are single cells.
D. All microbes cause disease.
The statement "All microbes are single cells." is true about all microbes.
Microbes, also known as microorganisms, are tiny living organisms that can be found virtually everywhere on Earth. They are extremely diverse, ranging in size from the smallest viruses to the largest fungi.
One of the defining characteristics of all microbes is that they are single cells. This means that they are composed of a single cell that functions as a complete organism, performing all of the functions necessary for life within that cell. This simple structure allows microbes to adapt to a wide range of environments, from the human gut to the depths of the ocean.
While not all microbes contain a nucleus, they do all contain a genome, which is the complete set of genetic information that defines the organism. However, not all microbes cause disease; in fact, the majority of microbes are harmless, and many even have important roles in maintaining the balance of ecosystems and supporting human health.
Therefore, the statement "All microbes are single cells." is true about all microbes.
To learn more about microbes visit here:
https://brainly.com/question/14571536
#SPJ11
what is an insect's antennae most similar too?
Insect's antennae is most similar to the nose
They are used for the sense of smell.
The natural extinction of a predator can negatively affect the
environment by leading to
unrestricted prey species growth.
major climate change
harmful human pollution.
increased sediment deposits.
Answer: A
Explanation:
With a decrease in predators there is no challenge for the prey and population growth can become uncontrollable
Hope this helps
William found out that bacteria live in oil. Which tatement bet decribe the function of bacteria and their impact on oil
The function of bacteria and their impact on oil can be best described by: (4) Bacteria help increase fertility by decomposing organic matter in the soil.
Bacteria are the prokaryotic organisms that are present everywhere on the Earth. These are single-celled organisms that can be useful as well s harmful for the other living beings. The examples of bacteria are: Salmonella, Bacillus, E. coli, etc.
Organic matter is the large macromolecular carbon based compound that is found in all the living organisms. In fact the feces and waste produced by the living organism is also an organic matter. The bacteria solubilize these organic matter into smaller soluble forms.
The given question is incomplete, the complete question is:
William found out that bacteria live in soil. Which statement best describe the function of bacteria and their impact on soil ?
Bacteria help increase fertility by decomposing organic matter in the soil.Bacteria help increase fertility by loosening soil for root growth.Bacteria reduce fertility by breaking down minerals in the soil.Bacteria reduce fertility by stripping the soil of nutrients.To know more about organic matter, here
brainly.com/question/11165274
#SPJ4
when making the baseline of your tlc plate, why do you use a pencil to trace the baseline straight across the plate at least 1-2 cm from the bottom of the plate?
A pencil is commonly used to draw the baseline straight across the TLC plate at least 1-2 cm from the bottom of the plate because pencil markings are stable.
When performing Thin Layer Chromatography (TLC), the baseline is an important reference point used to measure the migration distance of the analyte spots. A pencil is commonly used to draw the baseline straight across the TLC plate at least 1-2 cm from the bottom of the plate for several reasons:
1. Pencil markings are non-reactive: Pencil marks are made using graphite, which is non-reactive and does not interfere with the separation or analysis of the analyte. Other writing instruments, such as pens or markers, may contain chemicals that could contaminate the sample or interfere with the chromatographic process.
2. Pencil markings are stable: Pencil marks are relatively stable and do not easily dissolve or smudge when the plate is exposed to solvents during the chromatographic process. This ensures that the baseline remains visible and intact throughout the separation.
3. Pencil marks are easily visible: Pencil marks are typically dark and contrasting against the TLC plate's surface, making it easier to identify and measure the migration distances accurately. The baseline should be clearly visible to ensure precise measurements of spot migration.
4. Adequate distance from the bottom of the plate: By drawing the baseline at least 1-2 cm from the bottom of the plate, you provide sufficient space for the solvent to migrate and carry the analyte spots without interfering with the baseline. This distance allows for a clear separation between the baseline and the spots, making it easier to measure their migration distances accurately.
Overall, using a pencil to trace the baseline straight across the TLC plate at an appropriate distance from the bottom ensures visibility, stability, and non-interference with the chromatographic process, allowing for accurate measurements and analysis.
To know more about Thin Layer Chromatography (TLC) follow the link:
https://brainly.com/question/10296715
#SPJ4
Beta1 receptor stimulation includes all of the following effects EXCEPT: a) Increase in contractility b) Bronchodilation c) Tachycardia d) Increase in conduction velocity in the atrioventricular node
Beta1 receptor stimulation includes all of the following effects except Bronchodilation (Option B).
What are Beta1 receptors?Beta1 receptors are a type of adrenergic receptor that is located primarily in the heart. These receptors are activated by the hormones epinephrine and norepinephrine, which are released by the sympathetic nervous system during times of stress or physical activity.
When beta1 receptors are stimulated, they produce several effects, including:
An increase in heart rate (tachycardia)An increase in the force of contraction of the heart muscle (positive inotropy)An increase in the speed of conduction of electrical impulses through the heart (positive chronotropy)Bronchodilation is the widening of the airways in the lungs. This is accomplished by relaxing the smooth muscle that surrounds the airways. Bronchodilation is important because it allows air to flow more freely into and out of the lungs, making it easier to breathe.
Bronchodilation is primarily controlled by beta2 receptors, which are found in the smooth muscle cells that surround the airways. When beta2 receptors are stimulated, they cause the smooth muscle cells to relax, which widens the airways and allows air to flow more freely.
Learn more about beta1 receptors: https://brainly.com/question/30589024
#SPJ11
Beta1 receptor stimulation includes all of the following effects EXCEPT Bronchodilation.
Option b is correct.
Beta1 receptors are a type of adrenergic receptor that can be found in the heart, kidneys, and other organs. Stimulation of these receptors by norepinephrine or epinephrine can result in various physiological effects.
The effects of beta1 receptor stimulation include:
a) Increase in contractility: When beta1 receptors are stimulated, the heart's contractility increases, resulting in a more forceful contraction and a higher cardiac output.
b) Tachycardia: Stimulation of beta1 receptors in the heart causes an increase in heart rate.
c) Increase in conduction velocity in the atrioventricular node: The atrioventricular node is responsible for conducting electrical signals between the atria and ventricles. Beta1 receptor stimulation can cause an increase in the speed of these signals, resulting in a faster heart rate.
However, Beta1 receptor stimulation does NOT result in Bronchodilation. This is because beta1 receptors are not present in the lungs; instead, beta2 receptors are responsible for bronchodilation. Stimulation of beta2 receptors causes the smooth muscles of the airways to relax, resulting in increased airflow to the lungs.
To know more about Bronchodilation visit:-
https://brainly.com/question/31569609
#SPJ11
what would be the most likely effect of a wildfire that burned a large area of a forest? responses more sugars and starches would be available for animals in the area. more sugars and starches would be available for animals in the area. the availability of fossil fuels for use by industries in the area would be reduced. the availability of fossil fuels for use by industries in the area would be reduced. less carbon dioxide would be removed from the atmosphere in the area by plants. less carbon dioxide would be removed from the atmosphere in the area by plants. an increase in animal respiration would increase the release of carbon dioxide in the area.
The most likely effect of a wildfire that burned a large area of a forest would be that less carbon dioxide would be removed from the atmosphere in the area by plants.
This is because wildfires can destroy large areas of forest and vegetation, which are important for absorbing carbon dioxide through photosynthesis. With less vegetation, there would be fewer plants to remove carbon dioxide from the atmosphere, leading to an increase in the concentration of carbon dioxide in the area.
While wildfires may also release more sugars and starches that could be available for animals in the area, this effect would likely be temporary and localized. The availability of fossil fuels for industries in the area would not be directly affected by a wildfire unless it specifically burned an area with fossil fuel reserves. Finally, while an increase in animal respiration due to the presence of more animals in the area could increase the release of carbon dioxide, this effect would likely be minor compared to the loss of vegetation caused by the wildfire.
Learn more about atmosphere
https://brainly.com/question/26767532
#SPJ4
what organalls contains its own dna
Small, prolific mussels called zebra mussels were first introduced into the Great Lakes by a foreign cargo ship. They became a serious problem because they attached themselves to smooth, hard surfaces, and often clogged water intake pipes. Congress determined that zebra mussels posed a great threat to the economic welfare of the Great Lakes region and passed a statute requiring all Great Lakes water intakes to be coated with a special chemical compound that repels zebra mussels. Studies by biologists at a major state university showed that while the special chemical compound that the federal government has required was effective, it also was toxic to other aquatic life. The biologists recommended that Great Lakes intake pipes be coated with a less toxic and less expensive copper-based paint. On the basis of those studies and the recommendation, three Great Lakes states adopted laws permitting municipal water districts to coat their intake pipes with copper paint.
Can municipalities using copper-based paint on their intake pipes successfully be prosecuted for violating the federal law?
A. No, because the Tenth Amendment prevents Congress from interfering with integral government functions.
B. No, because the municipalities are taking effective steps to combat zebra mussels in compliance with the spirit and purpose of the federal law.
C. Yes, because Congress is in a better position to regulate the entire Great Lakes region than the individual states.
D. Yes, because Congress may adopt laws regulating navigable waters.
Answer: Yes, because Congress may adopt laws regulating navigable waters.
Explanation:
It should be noted that municipalities using copper-based paint on their intake pipes can successfully be prosecuted for violating the federal law because Congress may adopt laws regulating navigable waters.
Under the Supremacy Clause, when the action of either the state government or the local government conflicts with the federal laws which are deemed valid, then such cities can be prosecuted.
Ethnographers' awareness that they should engage in critical self-examination regarding the role they play in the research process is known as:
The correct answer to the statement "Ethnographers' awareness that they should engage in critical self-examination regarding the role they play in the research process is known as Reflexivity.
"Reflexivity is a methodological practice by which researchers reflect on how their positionality and social location impact their research. It is an integral aspect of ethnographic research and is used to address the problems of objectivity and positionality in research.
Reflectivity in ethnography is vital because it encourages researchers to be aware of the cultural, social, and political contexts of their research and how these factors impact the research process. The researcher's reflexivity, which encompasses the practice of reflecting on the researcher's subjective experiences, biases, and assumptions, is used to generate more comprehensive and accurate research results.
To learn more about Ethnographers here
https://brainly.com/question/4306555
#SPJ11
QUESTION 1 Exercise 11.10. Butterflies. Alice, Bob, and Charlotte are looking for butterflies. They look in three separate parts of a field, so that their probabilities of success do not affect each other. • Alice finds 1 butterfly with probability 17%, and otherwise does not find one • Bob finds 1 butterfly with probability 25%, and otherwise does not find one • Charlotte finds 1 butterfly with probability 45%, and otherwise does not find one Let X be the number of butterflies that they find altogether. Write X as the sum of three indicator random variables, X1, X2, X3 that indicate whether Alice, Bob, Charlotte (respectively) found a butterfly. Then X= X1+X2 +X3. Find the expected value of X by finding the expected value of the sum of the indicator random variables. Your answer will have two decimal places. **This is a straight forward expected value of a sum of random variables, nothing fancy here! QUESTION 2 Exercise 11.16. Flipping coins. Flip a coin until the second head comes up. Let X be the number of flips needed to get the second head. What is the E(X). The first step is to find the expected value of getting the first head. Is this like Example 11.10, sampling without replacement, OR like Example 11.11, sampling with replacement? O A. Example 11.10, sampling without replacement O B. Example 11.11, sampling with replacement QUESTION 3 Exercise 11.16. Flipping coins. Flip a coin until the second head comes up. Let X be the number of flips needed to get the second head. What is the E(X). The first step is to find the expected value of getting the first head. What is the expected value of getting the first head? This will be an integer answer. QUESTION 4 Exercise 11.16. Flipping coins. Flip a coin until the second head comes up. Let X be the number of flips needed to get the second head. What is the E(X). The next step is to find the expected value of getting the second head. Because this is identical to finding the expected number of rolls for the first head (independent events), we just multiply the first head's expected value by 2. This will be an integer answer. QUESTION 5 Exercise 11.17 (a). Waiting for favorite song. Michael puts his iTunes on shuffle mode where songs are not allowed to be replayed. He has 2,781 songs saved on iTunes, and exactly one of these is his favorite. How many songs is he expected to have to listen to until his very favorite song comes up? Is this like Example 11.10, sampling without replacement, OR like Example 11.11, sampling with replacement? A. Example 11.11, sampling with replacement B. Example 11.10, sampling without replacement
In Exercise 11.10, the expected value of the number of butterflies found by Alice, Bob, and Charlotte is obtained by finding the expected value of the sum of three indicator random variables.
In Exercise 11.16, the expected value of the number of flips needed to get the second head in a coin flipping experiment is determined. These exercises involve different scenarios of sampling with and without replacement.
In Exercise 11.10, the expected value of X, the total number of butterflies found, is found by calculating the expected value of each indicator random variable (X1, X2, X3) representing whether Alice, Bob, and Charlotte found a butterfly, respectively.
The expected value of each indicator variable can be obtained by multiplying the probability of success (finding a butterfly) by 1 and the probability of failure (not finding a butterfly) by 0. Then, the expected value of X is calculated as the sum of the expected values of the indicator variables.
In Exercise 11.16, the expected value of X, the number of flips needed to get the second head, is determined. To find this value, we first need to find the expected value of getting the first head. This scenario is similar to Example 11.11, which involves sampling with replacement.
Each coin flip is an independent event, and the probability of getting a head is constant at 0.5.
Therefore, the expected value of getting the first head is 1/p, where p is the probability of success (0.5 in this case).
In Exercise 11.17 (a), the scenario of waiting for a favorite song in Michael's iTunes playlist involves sampling without replacement. Each song played is not replayed, and there is only one favorite song among the total number of songs.
Therefore, this scenario is similar to Example 11.10, sampling without replacement.
To find the expected number of songs Michael needs to listen to until his favorite song comes up, the formula for sampling without replacement is used, which is the reciprocal of the probability of selecting the favorite song at each step.
To learn more about expected value visit:
brainly.com/question/28197299
#SPJ11
The two forces are always balanced.Two of the aboveTrue or FalseWrite true if the statement is true or false if the statement is false._____ 6. The force of gravity acting on an object is measured by weight._____ 7. Examples of forces include friction, gravity, and velocity._____ 8. Equal but opposite forces pushing on the same object produce a net force of zero on the object._____ 9. The length of a force arrow represents the direction of the force._____ 10. Force can cause a moving object to stop movi
Answer:
6. True
7. False
8. True
9. False
10. True
Explanation:
The force of gravity acting on an object is measured by weight because weight is also refers to the force having gravity instead of acceleration. In the examples i. e. friction and gravity are types of force but velocity is not a force, it refers to speed of an object. If both forces having same magnitude but opposite in direction then both forces cancel their effect and the object remain stationary. No, length of a force arrow does not represent the direction of the force, it represents magnitude of a force. Yes, force can stop or tend to stop a moving object and move or tend to move a stationary object.
25. Which characteristics do viruses have in common with animal cells?O presence of a genetic code in a nucleic acidability to form proteins at the ribosomesexistence of lipids in cell membranesO production of energy by a mitochondrion
presence of a genetic code in a nucleic acid
Drag each tile to the correct box.
The specific heat of three substances in the image are given in the table.
stamped concrete - 0.75
grass-covered soil - 1.01
Water - 4.18
Place the areas in order based on how fast they’ll heat up on a sunny afternoon. Start with the fastest and end with the slowest.
PLEASE ANSWER QUICKLY I WILL GIVE BRAINLIEST!!
Answer:
Correct answer is A-C-B
Explanation:
Just took the test
The concrete has the lowest specific heat, so it requires very little heat to heat up, making it the fastest substance to heat up; the second is grass, and the third is water, which requires a high temperature to heat up, so A-C-B is the correct order.
What is the significance of the specific heat of the substances?Specific heat is explained as the amount of heat that is needed to raise the temperature by 1 degree, and here the water needs the highest temperature to raise the temperature by 1 degree as a result, even if the water gets a little bit more temperature, it will not be too hot right away.
Hence, the concrete has the lowest specific heat, so it requires very little heat to heat up, making it the fastest substance to heat up; the second is grass, and the third is water, which requires a high temperature to heat up, so A-C-B is the correct order.
Learn more about the specific heat of the substances here.
https://brainly.com/question/28400079
#SPJ2
inheritance refers to any trait that is controlled by more than one gene
Answer:
Inheritance traits are gained through the DNA molecules present in the chromosomes. It may involve more than one gene.
Can somebody help me?
Answer:
a
Explanation: