Answer:
The correct answer is - Frequent feeding of complex carbohydrates throughout the day
Explanation:
In type I glycogen disease person is able to store the glycogen in the liver however, the person lacks enzyme glucose -6-phosphatase for breaking the glycogen into glucose which leads to a decrease in the sugar level.
So. the treatment must prevent this hypoglycemia condition by taking such carbohydrates that can easily be digested and broken down to glucose like a complex carbohydrate.
Thus, the correct answer is - Frequent feeding of complex carbohydrates throughout the day
Easy! Please Help! A man is walking through the woods with his dog. Suddenly, a tree limb falls in his path and he leaps out of the way to avoid it. Then the man's dog gets loose, and he ends up chasing it through the woods for a minute or two before he manages to catch it.
a) Describe the function of the respiratory system in this situation.
b) Describe the function of the endocrine system in this situation.
c) Describe the function of the nervous system in this situation.
d) Describe two ways that any of the man's body systems worked together in this situation.
The answers include the following:
The respiratory system gave the cells more oxygen via breathing to perform various activities.The endocrine system released hormones such as adrenaline to activate chemical changes and stay alert.The nervous system carried electrical impulses necessary for the contraction and relaxation of muscles.The bones and muscles worked together to ensure adequate movement.What is Musculoskeletal system?This is the system which comprises of bones, ligaments etc and ensure that the body system has a rigid structure.
It also ensures organisms are able to move from one place to another in search of food and for their survival.
Read more about Musculoskeletal system here https://brainly.com/question/4300043
#SPJ1
How many Okazaki fragments, 1000 nucleotides in length, are synthesized in the course of replicating blue-green algae DNA (genome size = 3.57x10^6 bp). Number of Okazaki fragments = _____ fragments
Approximately 3570 Okazaki fragments are synthesized in the course of replicating blue-green algae DNA, assuming each Okazaki fragment is 1000 nucleotides in length.
To determine the number of Okazaki fragments synthesized in the course of replicating blue-green algae DNA, we need to know the length of each Okazaki fragment. Typically, Okazaki fragments range in size from 100-2000 nucleotides in length, with an average size of around 1000 nucleotides. Given that each Okazaki fragment is 1000 nucleotides in length, we can calculate the number of fragments as follows:
3.57 x 10^6 base pairs (bp) in the blue-green algae genome correspond to 3.57 x 10^6 nucleotides since each base pair consists of two nucleotides.
Since each Okazaki fragment is 1000 nucleotides in length, we can divide the total number of nucleotides in the genome by 1000 to find the number of Okazaki fragments:
Number of Okazaki fragments = 3.57 x 10^6 nucleotides ÷ 1000 nucleotides/fragment
Number of Okazaki fragments = 3570 fragments
Therefore, approximately 3570 Okazaki fragments are synthesized in the course of replicating blue-green algae DNA, assuming each Okazaki fragment is 1000 nucleotides in length.
For more information on nucleotides visit:
brainly.com/question/16308848
#SPJ11
you have the following sequencing reads. using these reads, create a sequence contig by dragging and dropping the boxes into the correct order. make sure to show the overlap.
CGAACTTTTGGCCGTGATGGGCAGTTCC CGTGATGGGCAGTTCCGGTG CTATCCGGGCGAACTTTTGGCCG TTGGCCGTGATGGGCAGTT TTCCGGTGCCGGAAAGA TGGCCGTGATGGGCAGTTCCGGTG
The correct order of the sequencing reads to create a sequence contig is as follows: TGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA. To create a sequence coding, we need to arrange the sequencing reads in the correct order based on their overlapping regions.
By analyzing the given reads, we can identify the overlapping regions and piece them together.
The first read, "CGAACTTTTGGCCGTGATGGGCAGTTCC," overlaps with the second read, "CTATCCGGGCGAACTTTTGGCCG," at the sequence "CGAACTTTTGGCCG." By aligning these reads, we can see that the correct order is the first read followed by the second read.
The second read, "CTATCCGGGCGAACTTTTGGCCG," overlaps with the third read, "TTGGCCGTGATGGGCAGTT," at the sequence "TTGGCCG." Similarly, by aligning these reads, we find that the correct order is the second read followed by the third read.
The third read, "TTGGCCGTGATGGGCAGTT," overlaps with the fourth read, "TTCCGGTGCCGGAAAGA," at the sequence "TTGGC." Thus, the correct order is the third read followed by the fourth read.
Finally, the fourth read, "TTCCGGTGCCGGAAAGA," overlaps with the fifth read, "TGGCCGTGATGGGCAGTTCCGGTG," at the sequence "TTCCGGTG." Therefore, the correct order is the fourth read followed by the fifth read.
Putting all the reads together in the correct order, we get the sequence coding: TGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA.
Learn more about sequence coding here :
https://brainly.com/question/15201367
#SPJ11
By arranging the sequencing reads based on their overlaps, the sequence contig can be constructed as follows:
CTATCCGGGCGAACTTTTGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA
The contig represents the most likely contiguous sequence based on the provided reads and their overlapping regions.
To create a sequence contig using the provided sequencing reads, we need to align the reads based on their overlapping regions. By carefully examining the sequences, we can arrange them in the correct order to form a contiguous sequence.
Let's analyze the provided sequencing reads:
1. CTATCCGGGCGAACTTTTGGCCG
2. TTGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA
3. CGAACTTTTGGCCGTGATGGGCAGTTCCGGTG
4. TTCCGGTGCCGGAAAGA
5. TGGCCGTGATGGGCAGTTCCGGTG
Looking at the sequences, we can observe overlaps between certain reads. By aligning these overlaps, we can determine the correct order.
First, we notice that sequence 3 (CGAACTTTTGGCCGTGATGGGCAGTTCCGGTG) overlaps with sequence 1 (CTATCCGGGCGAACTTTTGGCCG) at the beginning. Therefore, sequence 3 should come before sequence 1.
Next, we observe that sequence 2 (TTGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA) overlaps with the end of sequence 3. Hence, sequence 2 follows sequence 3.
After that, sequence 4 (TTCCGGTGCCGGAAAGA) aligns with the end of sequence 2. Therefore, sequence 4 comes next.
Finally, we see that sequence 5 (TGGCCGTGATGGGCAGTTCCGGTG) aligns with the end of sequence 4, completing the contig.
Learn more about contiguous sequence here :-
https://brainly.com/question/29870896
#SPJ11
Read
#2
Which is an example of
something where cells
are working together to
perform a function?
A. Energy from the Sun heats the
Earth
B. Tissue in the stomach
C. A large pane of glass for
protection
D. The top of a table holds plates
Kesler Science.com
Answer:
B. (◕ᴗ◕✿)(◕ᴗ◕✿)▼・ᴥ・▼◖⚆ᴥ⚆◗
Explain Newton's Laws of Motion and how it applies to football, roller skating, soccer, or choose your own examples. Must be three examples.
Answer:
1. If you kick a soccer ball and don't consider friction or air resistance, it would continue non stop until an opposite force acts on it.
2. Pushing a chair has the force of the chair acting on you which you feel as resistance and your force which moves the chair.
3. When air rushes out of a ballon, the air rushes downward and the opposite reaction is that the ballon flies up.
Why is North Carolina the most ecologically unique state in the southeast?
Answer: North Carolina is the most ecologically unique state in the southeast because its borders contain sub-tropical, temperate, and boreal habitats.
Explanation: Although the state is at temperate latitudes, the
Appalachian mountains and the Gulf Stream influence climate and, hence, the vegetation (flora) and
animals (fauna).
compared to an unmutated version of the gene, will the gene with this silent mutation have a different dna sequence? compared to an unmutated version of the gene, will the gene with this silent mutation have a different dna sequence? yes no
No. A silent mutation in a gene will not result in a different DNA sequence compared to an unmutated version of the gene.
Silent mutations are a type of point mutation that occur in the DNA sequence of a gene but do not alter the resulting amino acid sequence of the encoded protein. These mutations typically involve changes in the third nucleotide position of a codon, where multiple codons can encode the same amino acid. Due to the redundancy of the genetic code, a change in the third position of the codon may not affect the final protein product.
As a result, the DNA sequence of the gene with a silent mutation will be the same as the unmutated version, with no observable change in the protein sequence. Therefore, the correct answer is: No.
learn more about DNA here
https://brainly.com/question/32072734
#SPJ11
Select all the parameters that can be determined by analyzing a protein sample with tandem mass spectrometry.amino acid sequencegenetic sequenceisoelectric pointprecursor ion mass
Amino acid sequence and precursor ion mass can be determined by analyzing a protein sample with tandem mass spectrometry.
Amino acid, any of a class of organic compounds made composed of an acidic carboxyl group (COOH), a basic amino group (\(NH_2\)), and a specific organic R group (or side chain) for each amino acid. Alpha-amino [alpha-amino carboxylic acid is referred to as an amino acid informally. An amino and a carboxyl group are both joined to the core carbon (C) atom, known as the -carbon, in every molecule. A hydrogen (H) atom and the R group typically fulfill the remaining two bonds of the -carbon atom.Except for glycine, all amino acids are chiral compounds. In other words, they can be found in two optically active asymmetric forms that are mirror reflections of one another. (This characteristic conceptually resembles how the left and right hands are situated in space.) The D and L enantiomers have different designations. It's vital to remember that proteins usually never include any amino acids other than those with the L-configuration.
Learn more about Amino acid
brainly.com/question/28409615
#SPJ4
What global circulation cell most strongly affects the weather
and climate and Vancouver, British Columbia?
Select one:
a. Ferrel cell
b. Polar cell
c. Trade winds
d. Polar high
e. Hadley cell
Which restriction endonucleases would cleave a dna molecule at the given sequences? the complementary dna substrate strand is omitted for clarity.
The types of restriction endonucleases that would cleave a DNA molecule at the given sequences are type I and type II restriction endonucleases.
What do you mean by Restriction endonucleases?Restriction endonucleases may be defined as a protein constructed by bacteria that cleaves DNA at specific sites along the molecule.
Among the type I and type II restriction endonucleases, type II restriction endonuclease cuts the DNA molecules more efficiently and is widely used for the same procedure as compared to type I restriction endonucleases.
Some of the examples of type II restriction endonucleases include EcoRI, HindIII, BamHI, etc.
To learn more about restriction endonucleases, refer to the link:
https://brainly.com/question/9885851
#SPJ1
Scientists have said for years cod was so seriously overfished in European Union waters that there was a risk of extinction due to stock collapse. Why would cod be on the risk of extinction
Cod be on the risk of extinction because overfishing will lead to a decrease in the species.
What is Extinction?This is the process in which certain species die out in the ecosystem due to overexploitation etc.
When the cod fishes are overfished, it will decrease the number of species available for reproduction in order to produce more offsprings which increases its risk of extinction.
Read more about Extinction here https://brainly.com/question/1048615
#SPJ1
!!!PLEASE HELP 80 POINTS!!!
There are 10 answers to this one question.
When typing your answers for this question, please put a number in front of your written response to show which question you are answering.
Example: question #1 and #2.
1. RR
2. Rr
Fill in the Punnett Square using the following information:
Mom has the recessive gene for attached earlobes (e).
Dad has the dominant gene (E) for unattached earlobes. Dad is a heterozygous. (Ee).
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Answer:
1.e 2.e 3.E 4.e 5.Ee 6.Ee 7.ee 8.ee 9.Ee 10.ee
Explanation:
i did this in school
Answer:
1. e
2. e
3. E
4. e
5. Ee
6. Ee
7. ee
8. ee
9. 1:1
10. 1 unattached earlobe : 1 attached earlobe
Explanation:
Genotype is the alleles, Phenotype is the physical representation
Alleles and Genes
1. Visualizing the Vocab: For the following picture, determine where
you could label the following terms: allele, gene locus, and
chromosome. Be sure to draw arrows (Insert → choose arrow
shape) to specify where you are labeling!
Glycolysis that starts with glycogen instead of glucose can be considered to have a higher energy yield because:
A. Phosphorolysis reactions cleave bonds with phosphate instead of water.
B. Phosphorylase is a better enzyme than hexokinase
C. Phosphorylase produces a glucose phosphate without spending an ATP to do it
D. All of these
Answer:
A
Explanation:
The answer is a Because Phosphorolysis reactions cleave bonds with phosphate instead of water (: just trust me
Glycolysis that starts with glycogen instead of glucose can be considered to have a higher energy yield because phosphorolysis reactions cleave bonds with phosphate instead of water. The correct option is A.
What is glycolysis?Through a sequence of processes known as glycolysis, glucose is divided into two pyruvate molecules, each of which has three carbons.
The metabolic process that changes glucose into pyruvate is known as glycolysis.
The high-energy molecules adenosine triphosphate and reduced nicotinamide adenine dinucleotide are created using the free energy released during this process. A series of ten enzyme-catalyzed processes make up glycolysis.
In contrast to phosphorolysis reactions, which cleave bonds with phosphate rather than water, glycolysis can be thought of as having a larger energy yield because it begins with glycogen rather than glucose.
Not producing adenosine 5′-triphosphate is not the primary goal of glycolysis; rather, it is to produce pyruvate for the trichloroacetic acid (TCA) cycle.
By boosting the ratio of NADH to NAD+, the glycolytic synthesis of pyruvate lowers the cytosol.
Thus, the correct option is A.
For more details regarding glycolysis, visit:
https://brainly.com/question/29604117
#SPJ5
please help i am giving away brainiliest
1. Which body system is primarily responsible for protecting you against pathogens?
A. Digestive system
B. Nervous system
C. Endocrine system
D. Immune system
No dam links
during muscle contraction a single myosin head consumes atp at a rate of about
During muscle contraction, a single myosin head consumes ATP at a rate of about 5 ATP molecules per second.
ATP, or adenosine triphosphate, is used as the primary source of energy for muscle contraction. When a muscle fiber is stimulated, calcium ions are released from the sarcoplasmic reticulum, which initiates the contraction process.
ATP is necessary for the myosin head to attach to the actin binding sites, then pull the actin filament towards the center of the sarcomere, shortening the length of the muscle fiber. This process is repeated many times, with each myosin head consuming about 5 ATP molecules per second, until the muscle fiber has fully contracted.
to know more about myosin visit :
https://brainly.com/question/15071887
#SPJ11
What is the process by which early autotrophic prokaryotes produced oxygen.
They created stromatolites, which added oxygen to the atmosphere.
Autotropic prokaryotes :Prokaryotes that can reproduce independently produce organic compounds from carbon dioxide. Heterotrophic prokaryotes, in contrast, get their carbon from organic substances. The terminologies that describe how prokaryotes receive carbon and energy can be combined to further complicate the picture.
Phototrophs, which are autotrophic organisms that transform solar energy into chemical energy, first appeared within a billion years after the birth of the Earth.
Autotrophic eukaryote :Since plants can produce their own sustenance, they are referred to as autotrophs. Through the process of photosynthesis, plants create glucose using water, carbon dioxide, and solar energy. Some protist species also use photosynthesis to produce energy.
To know more about organisms :
https://brainly.com/question/16296324
#SPJ9
after the axon of a standard multipolar neuron is cut, the cell body sometimes degenerates. this is called degeneration.
The process of moving viruses up the axon in the anterograde direction is known as anterograde transport, and it makes use of the protein kinesin.
How do antegrade viruses operate?By using a tracer that travels from the soma to the synapses, anterograde tracing is accomplished. The process of moving viruses up the axon in the anterograde direction is known as anterograde transport, and it makes use of the protein kinesin.When tracing neurons, anterograde tracing goes from the cell bodies of the neurons to the terminals of their axons, whereas retrograde tracing goes from the terminals of the neurons to the cell bodies. The neurons' built-in transport channels are used for anterograde and retrograde tracing.The complete question is,
Occasionally, the cell body of a typical multipolar neuron degenerates after the axon is severed. Degeneration is the term used for this.
To learn more about Anterograde refer to:
https://brainly.com/question/15013243
#SPJ4
Please help me with this !
Answer:
1. E
2. C
3. A
4. D
5. F
Laboratory Thermometer hermometer, is used for measuring temperatures other than the human body temperature. Could use as tool for experimentation or any other scientific field activities.
Clinical Thermometer is meant for clinical purposes. It is developed for measuring the human body temperature.
Acid is a kind of chemical compound that when dissolved in water gives a solution with H+ ion activity more than purified water. An acid is a proton donor.
Base is an aqueous substance that donates electrons, accept protons or release hydroxide (OH-) ions. A base is a proton acceptor.
Which division of time on the geologic time scale is the longest?
OA. A period
OB. An eon
C. An epoch
OD. An era
SUBMIT
The division of time on the geologic time scale that is the longest is an eon, which is in option B, as an eon can span billions of years and is divided into eras, which are then divided into periods and epochs.
What is geological time?The geologic time scale is a system used by geologists and other scientists to divide the history of Earth into specific intervals of time based on major events and changes in the planet's geology, climate, and life forms. The geologic time scale is divided into four main categories: eons, eras, periods, and epochs. An eon is the largest and longest division of time on the geologic time scale, spanning billions of years.
Hence, the division of time on the geologic time scale that is the longest is an eon, which is in option B.
Learn more about geological time here.
https://brainly.com/question/12862093
#SPJ5
How does synthesis help maintain homeostasis?
Answer:
to make food loll
Explanation:
What biomolecule is a cell with a lot of ribosomes attached to its rough endoplasmic reticulum probably specialized to manufacture?
Answer:Ribosomes are the cellular structures responsible for protein synthesis. When viewed through an electron microscope, ribosomes appear either as clusters (polyribosomes) or single, tiny dots that float freely in the cytoplasm. They may be attached to the cytoplasmic side of the plasma membrane or the cytoplasmic side of the endoplasmic reticulum and the outer membrane of the nuclear envelope. Electron microscopy has shown us that ribosomes, which are large complexes of protein and RNA, consist of two subunits, aptly called large and small (Figure 1). Ribosomes receive their “orders” for protein synthesis from the nucleus where the DNA is transcribed into messenger RNA (mRNA). The mRNA travels to the ribosomes, which translate the code provided by the sequence of the nitrogenous bases in the mRNA into a specific order of amino acids in a protein. Amino acids are the building blocks of proteins.
Because proteins synthesis is an essential function of all cells, ribosomes are found in practically every cell. Ribosomes are particularly abundant in cells that synthesize large amounts of protein. For example, the pancreas is responsible for creating several digestive enzymes and the cells that produce these enzymes contain many ribosomes. Thus, we see another example of form following function.
Mitochondria
Mitochondria (singular = mitochondrion) are often called the “powerhouses” or “energy factories” of a cell because they are responsible for making adenosine triphosphate (ATP), the cell’s main energy-carrying molecule. ATP represents the short-term stored energy of the cell. Cellular respiration is the process of making ATP using the chemical energy found in glucose and other nutrients. In mitochondria, this process uses oxygen and produces carbon dioxide as a waste product. In fact, the carbon dioxide that you exhale with every breath comes from the cellular reactions that produce carbon dioxide as a byproduct.
In keeping with our theme of form following function, it is important to point out that muscle cells have a very high concentration of mitochondria that produce ATP. Your muscle cells need a lot of energy to keep your body moving. When your cells don’t get enough oxygen, they do not make a lot of ATP. Instead, the small amount of ATP they make in the absence of oxygen is accompanied by the production of lactic acid.
This transmission electron micrograph of a mitochondrion shows an oval outer membrane and an inner membrane with many folds called cristae. Inside the inner membrane is a space called the mitochondrial matrix.
Figure 2. This electron micrograph shows a mitochondrion as viewed with a transmission electron microscope. This organelle has an outer membrane and an inner membrane. The inner membrane contains folds, called cristae, which increase its surface area. The space between the two membranes is called the intermembrane space, and the space inside the inner membrane is called the mitochondrial matrix. ATP synthesis takes place on the inner membrane. (credit: modification of work by Matthew Britton; scale-bar data from Matt Russell)
Mitochondria are oval-shaped, double membrane organelles (Figure 2) that have their own DNA and ribosomes (we’ll talk about these later!). Each membrane is a phospholipid bilayer embedded with proteins. The inner layer has folds called cristae. The area surrounded by the folds is called the mitochondrial matrix. The cristae and the matrix have different roles in cellular respiration.
Peroxisomes
Peroxisomes are small, round organelles enclosed by single membranes. They carry out oxidation reactions that break down fatty acids and amino acids. They also detoxify many poisons that may enter the body. Many of these oxidation reactions release hydrogen peroxide, H2O2, which would be damaging to cells; however, when these reactions are confined to peroxisomes, enzymes safely break down the H2O2 into oxygen and water. For example, alcohol is detoxified by peroxisomes in liver cells. Glyoxysomes, which are specialized peroxisomes in plants, are responsible for converting stored fats into sugars.
Explanation:
Which statements are true of all organisms, including the zebra, giraffe, and plants in the picture? Check all that apply
Answer:
The statements which are true in the case of zebra, giraffe, and plants are that energy is needed to power all cell processes and energy allows organisms to grow and reproduce.
Explanation:
Energy is considered to be an important element for the growth and survival of all living organisms including plants and animals. Energy is a must to generate power which is needed for the efficient functioning of all the cell processes. In addition, energy plays an important role in the reproduction of living organisms. For example, Plants go through the process of photosynthesis where they convert the carbon dioxide mixed with water into carbohydrates which provide energy for the growth and reproduction of plants.
Thus the statements that are true are energy is needed to power all cellular processes and that energy allows organisms to grow and reproduce.
Learn more about energy here
https://brainly.com/question/10629072
The biochemical functions of vitamin A include all of the following except
a. controlling vision in dim and bright light
b. development and maintenance of mucus-forming cells
c. cell differentiation
d. coenzyme synthesis
The body uses coenzymes, which are tiny molecules that help enzymes catalyze biological reactions, but vitamin A is neither a precursor nor a constituent of any recognized coenzymes. The right response is coenzyme synthesis (d).
The body needs vitamin A for a number of metabolic processes. It is a crucial part of the visual pigment rhodopsin in the retina, which regulates vision in both dim and strong light (option a).
Also, it contributes to the growth and upkeep of mucus-producing cells, which are crucial for lubricating and defending numerous tissues and organs (option b).
In addition, vitamin A is important for cell differentiation, the process through which cells specialize and take on certain roles during tissue maintenance and development (option c). Nevertheless, the production of coenzymes does not directly include vitamin A.
To know more about coenzyme synthesis:
https://brainly.com/question/31957816
#SPJ4
explain how heavy poaching shifted the population to be more tuskless
Decades of poaching and overhunting of large-tusked elephants could result in generations of elephants with small tusks or no tusks at all.
According to Poole, in heavily poached populations, the proportion of tusked animals in the population increases as poaching continues.
“The baseline tusk loss in a population can be as high as 4%, but over time the rate could increase to 60% in older animals as more tusked elephants are killed. there is potential,” she explains.
Tiny tusks aren't the only genetic impact African (and Asian) elephant populations face from heavy poaching. Over the decades, researchers have documented an increasing proportion of tuskless males and females in many elephant populations.
“Most populations will always have tuskless elephants because elephants have a sex-associated tuskless gene,” Poole says. “The males need tusks to fight, so tuskless males are chosen, and there are very few tuskless males. They don't pass on genes as often."
To learn more about poaching, visit
https://brainly.com/question/9331868
#SPJ10
Select the type of Cell Transport shown in the picture.
Choose
Answer:
Osmosis
Explanation:
Osmosis: The movement of water from an area of high concentration to a low concentration through a partially permeable membrane.
In eukaryotic organisms, interaction between which organelles is most important for cell shape, tensile strength, and communication between cells?
cytoskeleton and cell membrane
The correct option is C : cytoskeleton and cell membrane , In addition to determining the structure of the cell, the cytoskeleton and its associated proteins at the plasma membrane.
Microtubules, actin filaments, and intermediate filaments make up the cytoskeleton of a cell. These elements aid in the organization of the cell's components and give the cell its form. They serve as a foundation for cell division and movement as well.
Eukaryotic cells have a cytoskeleton consisting of filamentous proteins that supports the cell and its cytoplasmic components mechanically. Three main kinds of components, which vary in size and protein composition, make up the cytoskeleton in all cells.
Learn more about to cytoskeleton visit here;.
https://brainly.com/question/15200286
#SPJ4
Full Question
In eukaryotic organisms, the interaction between which organelles is MOST important for cell shape, tensile strength, and communication between cells?
A. cytoplasm and Golgi apparatus
B. ribosome and central vacuole
C. cytoskeleton and cell membrane
D. nucleus and endoplasmic reticulum
Apuk’we, the common cattail is a versatile native edible plant for the Ojibwe people of Minnesota. They are important to the ecosystem for many reasons. They help stabilize marshy borders of lakes and ponds, help protect shorelines from wave erosion, providing spawning areas for northern pike, provide cover and nesting sites for waterfowl and marsh birds such as the red-winged blackbird, are a food source for muskrats and beavers, and humans, too. However, where native cattails once stood, now there is a vast lawn of nonnative narrow-leaved cattails or their hybrid offspring. These new cattails are taking over wetlands once populated by the native cattails, decreasing the biodiversity in these areas.
What kind of ecological relationship exists between the native and nonnative species of cattails in the Minnesota wetlands?
A) commensalism
B) competition
C) mutualism
D) predation
Answer:
B) Competition
Explanation:
The native and non-native cattails are competing for the area.
Answer:
Predation
Explanation:
The way the question is worded, gives me the effect that the nonnative species of cattails predated the native species and ultimately, lowered their numbers.
I was torn between competition or predation, but it cannot be competition due to the effect it's having on the native species. In competition, there's obvious tension between the two, though in this scenario, the species is just lowered completely. There's a chance it could be competition though, I'm not really understanding the wording of the scenario given; that's just me though.
So, ultimately, it's predation.
Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.
Answer:
Two eagles fight over a salmon carcass- DIRECT
All the gray foxes in a habitat prey primarily on penguins- INDIRECT
Two colonies of black ants clash over a wasp- DIRECT
Gray squirrels in an area rely on nuts for food- INDIRECT
Explanation:
Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.
However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.
On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.
if your parents are heterozygous for a gene, what is the chance that you will have at least one copy of it?
If your parents are Heterozygous for a gene,then you have 75% chance that you will have at least one copy of it.
A diploid organism carries two complete sets of chromosomes and thus has two copies of each gene. However, the two copies may not be identical. Different versions of the same gene are called alleles. A homozygous individual carries two copies of the same allele, while a heterozygous individual carries two different alleles for a gene.
To know more about Heterozygous visit:https://brainly.com/question/15614150
#SPJ4