The article by Turner and Alexander (2006) discusses fusion tyrosine kinase mediated signaling pathways and their role in the transformation of haematopoietic cells. The authors highlight the importance of these pathways in the development of certain types of leukemia.
Fusion tyrosine kinases are abnormal proteins that result from gene fusions, where two separate genes are joined together. These fusion proteins have the ability to activate signaling pathways that promote cell growth and survival. This aberrant signaling can lead to the transformation of normal haematopoietic cells into cancerous cells.
The authors emphasize the significance of understanding these signaling pathways as potential targets for therapeutic intervention. By identifying and inhibiting the key components of these pathways, it may be possible to halt the abnormal cell growth and proliferation associated with leukemia.
In summary, the article by Turner and Alexander provides insights into the role of fusion tyrosine kinase mediated signaling pathways in the transformation of haematopoietic cells, particularly in the context of leukemia. This knowledge may contribute to the development of new therapeutic strategies for the treatment of this disease.
To know more about haematopoietic visit :
https://brainly.com/question/32497607
#SPJ11
-END-
SENIOR THREE BIOLOGY CHRISTMAS DOSAGE
1.(a) (i) Explain why small organisms such as this amoeba can obtain sufficient oxygen for respiration without a
specialized gas-exchange system.?
fi)explain why the method of gas exchange in (a)i above is only possible in very small organisms.?
Answer:
In single celled organisms surface area to volume ratio is optimum for diffusion/exchange of substances between the cell and its exterior and this rate of exchange suffices the requirement of a unicellular organism. However, in multicellular organisms the surface area to volume ratio is low, the exchange that takes place with the exterior or the environment occurs only through the body surface with the help of a specific structure/organ, example (Skin),However, this exchange does not compensate for millions of cells in a multicellular organism, which have distinct requirements based on their function
Explanation:
i) Amoeba gets oxygen gas dissolved in surrounding water through its plasma membrane by the process of diffusion.
ii)The oxygen gas diffused inside the body is used up by amoeba. carbon dioxide gas is also liberated in the surrounding water through the same process of diffusion.
When sperm and ovum fuse at conception, they produce a zygote that typically has _____ chromosomes
When sperm and ovum fuse at conception, they produce a zygote that typically has 46 chromosomes.
The sperm cells and egg cells divide by a process referred to as meiosis. The process of meiosis ensures that crossing over occurs in the chromatids in order for variations to occur. It also ensures that the number of chromosomes in the gamete cells is reduced to half.
This reduction of chromosome number to half at the time of meiosis is important for maintaining the stability of chromosomes in offspring. Hence, as humans have 46 chromosomes in total, the egg cells and the sperm cell will have 23 chromosomes each.
When the sperm and ovum fuse at the time of conception, then the number of chromosomes will be maintained at 46 in the zygote being produced.
To learn more about chromosomes, click here:
https://brainly.com/question/2997660
#SPJ4
The malfunction of ribosomes in the body will cause a disease called Ribosomopathies. What is the likely effect of this disease?
A) Ribosomes will perform a less important function and the disease will not affect the body.
B) Proteins will not be properly formed, resulting in significant malfunction of the body.
C) Other subcellular structures will take over the function of the ribosomes, maintaining the health of the body.
D) The body will use molecules other than proteins to carry out the work of the cell, so the body will be minimally affected.
Answer:
Not sure of answer though
Explanation:
But here is what have got
Clinical features of the ribosomopathies can include bone marrow failure, developmental abnormalities, and increased risk of cancer.
Hope it helped
Answer:B, Proteins will not be properly formed, resulting in significant malfunction of the body.
Explanation:
organisms that must obtain nutrients and energy by eating other organisms are
Heterotrophs :) I'm pretty sure
The inferior nasal concha is
The inferior nasal concha, also known as the lower nasal concha, is one of the three bones that make up the lateral wall of the nasal cavity. It is located near the bottom of the nasal cavity and plays a vital role in the respiratory system.
The inferior nasal concha is a thin, curved bone covered in a mucous membrane. It is responsible for increasing the nasal cavity's surface area, which helps warm, filter, and humidifies the air we breathe. It also helps to trap dust, dirt, and other particles that we inhale, which are then removed by the mucus in the nasal cavity.
The inferior nasal concha is also involved in the sense of smell. The olfactory receptors, responsible for detecting odors, are located in the mucous membrane that covers the inferior nasal concha.
The inferior nasal concha is one of the bones that can be affected by sinusitis, an inflammation of the sinuses. When the sinuses become blocked, the mucus cannot drain properly, which leads to the buildup of pressure and inflammation in the nasal cavity. This can cause a stuffy nose, headache, and facial pain.
In conclusion, the inferior nasal concha is a thin, curved bone near the bottom of the nasal cavity that plays an essential role in the respiratory system. It increases the surface area of the nasal cavity, which helps to warm, filter, and humidify the air we breathe, and also helps to trap dust, dirt, and other particles we inhale. It also plays a vital role in the sense of smell and can be affected by sinusitis.
Know about the function of inferior nasal concha :https://brainly.com/question/9278209
#SPJ11
What is the function of the enzyme RNA polymerase during transcription?
aids in packaging amino acids for use at a later time
aids in destroying the mRNA sequence that was read
helps speed up the process of transcription
helps slow down the process of transcription
Answer:
RNA polymerase is an enzyme that is responsible for copying a DNA sequence into an RNA sequence, duyring the process of transcription.
what would happen if the lake level rose 10 meters?
Answer:
If the lake level rose 10 meters, the situation will vary according to the land area and the kind of environment and ecosystem over there. The house which is built near the lake will be flooded and filled with water because of the rising level of water and it is present above 5 to 10 meters of the lake.
the small circular molecules of dna commonly found in bacteria are called _______
The small circular molecules of DNA commonly found in bacteria are called "plasmids."
What are plasmids?
Plasmids are separate from the main bacterial chromosome and can be transferred between bacteria. Restriction enzymes are proteins that can cut DNA at specific sequences, and they are often used in molecular biology to manipulate plasmids for various purposes, such as cloning or gene editing.
Role of plasmids:
The small circular molecules of DNA commonly found in bacteria are called plasmids. These plasmids can be cut by restriction enzymes, which are enzymes that recognize specific DNA sequences and cut the DNA at those sites. This ability to manipulate plasmids with restriction enzymes has made them an important tool in genetic engineering and biotechnology.
To know more about plasmids, visit:
https://brainly.com/question/855090
#SPJ11
Each cytochrome has an iron-containing heme group that accepts electrons and then donates the electrons to a more electronegative substance.
Sure!
Cytochromes are proteins that are involved in electron transport chains. Each cytochrome has an iron-containing heme group that can accept electrons from a donor molecule. The electrons are then passed from cytochrome to cytochrome until they reach a final acceptor molecule, which is often oxygen. During this process, the electrons become more electronegative, which means they have a greater attraction to positively charged molecules. Eventually, the electrons are donated to the final acceptor molecule, where they are used to create energy for the cell. So, to summarize, cytochromes accept electrons from donor molecules and pass them on to more electronegative substances in electron transport chains.
To know more about cytochromes please click:-
https://brainly.com/question/31494181
#SPJ11
[Ch 22*] Experiments on learning in animals sometimes measure how long it takes mice to find their way through a maze. Only half of all mice complete one particular maze in less than 18 seconds. A researcher thinks that a loud noise will cause the mice to complete the maze faster. She measures the proportion of 40 mice that completed the maze in less than 18 seconds with noise as a stimulus. The proportion of mice that completed the maze in less than 18 seconds is:
The hypotheses for the test to answer the researcher's question are:
O H : p = 0.5 (null hypothesis)
H A : p > 0.5 (alternative hypothesis)
According to the null hypothesis, there is no discernible difference in the percentage of mice who finish the maze in under 18 seconds with and without noise. According to the alternative theory, considerably more mice than 50% completed the labyrinth in less than 18 seconds when there was noise.
The alternative hypothesis defines the direction of the difference, hence this is a one-tailed test.
Learn more about one-tailed test
https://brainly.com/question/31270353
#SPJ4
Full Question: Experiments on learning in animals sometimes measure how long it takes mice to find their way through a maze. Only half of all mice complete one particular maze in less than 18 seconds. A researcher thinks that a loud noise will cause the mice to complete the maze faster. She measures the proportion of 40 mice that completed the maze in less than 18 seconds with noise as the stimulus. The proportion of mice that completed the maze in less than 18 seconds is p = 0.7. The hypotheses for a test to answer the researcher's question are
O H : p=0.5, H. :p <0.5
O H: p=0.5, H:p > 0.5.
OH :p0.5, H.:P *0.5.
OH:p> 0.5, H.:P +0.5.
Which structural level is impacted by denaturing a protein containing a single polypeptide?
Denaturing a protein containing a single polypeptide has an effect on the protein's tertiary structure level.
What are polypeptides and its function?Polypeptides. Proteins are created by joining several amino acids together to form polypeptides. The bonding of two or more polypeptides results in the formation of proteins, which are then folded into the appropriate shape.
Hair and nails contain this protein. The other prevalent secondary structure is the sheet with -pleats.
How do proteins develop from polypeptides?Amino acids join together to form polypeptides, which are another name for proteins, through a chain of peptide bonds. The interactions (dashed lines) between the side chains of the polypeptide's amino acids will determine which conformation the polypeptide will fold into next.
To know more about polypeptide visit:
https://brainly.com/question/28270191
#SPJ4
Oxygen diffuses into the _______space blood cells and carbon dioxide diffuses out of the _______
A-blood plasma, red
B-none of these
C-Red, blood plasma
D-White, red blood cell
Answer:
c-red blood plasma
Explanation:
I think helping you
What kingdom would a bacterial organism that survive a harsh environment be place in
Answer:
Archaebacteria
Explanation:
These organisms are classified in the kingdom Archeabacteria. These are found in extreme enviorments such as hot boiling water and thermal vent under conditions with no oxygen or highly acid enviorments
in addition to inherited genetic mutations, what are other risk factors for colon and rectal cancer?
In addition to inherited genetic mutations, several other risk factors contribute to the development of colon and rectal cancer. These factors include:
1. Age
2. Personal or family history
3. Lifestyle factors
4. Diabetes
5. Certain inherited syndromes
6. Race and ethnicity
7. Previous radiation therapy
8. Environmental factors
1. Age: The risk of colon and rectal cancer increases with age, with the majority of cases occurring in individuals over 50 years old.
2. Personal or family history: Individuals with a personal history of colorectal polyps, inflammatory bowel disease (such as Crohn's disease or ulcerative colitis), or a family history of colorectal cancer are at a higher risk.
3. Lifestyle factors: Unhealthy lifestyle choices can increase the risk of colon and rectal cancer. These include a diet high in red and processed meats, low intake of fruits and vegetables, lack of physical activity, obesity, smoking, and excessive alcohol consumption.
4. Diabetes: People with type 2 diabetes have an increased risk of developing colon and rectal cancer, possibly due to factors such as insulin resistance and chronic inflammation.
5. Certain inherited syndromes: In addition to inherited genetic mutations, certain inherited syndromes, such as familial adenomatous polyposis (FAP) and Lynch syndrome (hereditary non-polyposis colorectal cancer), significantly increase the risk of developing colorectal cancer.
6. Race and ethnicity: Individuals of African-American descent have a higher incidence and mortality rate of colon cancer compared to other racial and ethnic groups.
7. Previous radiation therapy: Prior radiation treatment in the abdominal or pelvic area for previous cancers may increase the risk of developing colorectal cancer later in life.
8. Environmental factors: Exposure to certain environmental factors, such as certain chemicals, heavy metals, and radiation, may contribute to the development of colon and rectal cancer.
It's important to note that having one or more risk factors does not necessarily mean an individual will develop colon or rectal cancer. Regular screenings, adopting a healthy lifestyle, and following appropriate medical recommendations can help reduce the risk and detect these cancers at an early stage when treatment is most effective.
for more questions on inherited genetic mutations
https://brainly.com/question/16342711
#SPJ8
during the s phase of interphase, the cell replicates its
During the S (synthesis) phase of interphase, the cell replicates its DNA. This is a critical stage in the cell cycle as it ensures that each daughter cell receives a complete and accurate copy of the genetic material.
The replication process begins with the unwinding of the DNA double helix, which allows the replication machinery to access the individual strands. The replication machinery, composed of enzymes such as helicases and polymerases, then adds new nucleotides to the exposed strands, creating two identical copies of the DNA molecule. This process is called semi-conservative replication, as each new DNA molecule is composed of one original strand and one newly synthesized strand. The S phase ensures the proper distribution of genetic information to the daughter cells, ensuring the continuation of the cell cycle and the preservation of the genetic material.
Learn more about DNA:
brainly.com/question/264225
#SPJ4
Write a scientific explanation on how food from plants provide energy for body processes.
claim
evidence
reasoning
need help asap im begging you guys
So according to the scientific explanation of how food from plants provides energy for body processes.
Through the system of mobile respiration, the electricity in meals is modified into electricity that may be utilized by the frame's cells. Initially, the sugars withinside the meals you consume are digested into the easy sugar glucose, a monosaccharide.
Recall that glucose is the sugar produced through the plant for the duration of photosynthesis. The important feature of easy carbohydrates is to offer the frame electricity.
An example is a goat and plant food chain.
What is food energy?Food energy is chemical electricity that animals (such as humans) derive from their meals to maintain their metabolism, such as their muscular activity. Most animals derive maximum in their electricity from cardio respiration, specifically combining the carbohydrates, fats, and proteins with oxygen from air or dissolved in water.
Thus it is cleared from the above.
To know more about food energy refer to the link :
https://brainly.com/question/2020306
studocu which unknown(s) contained a lipid? which unknown(s) contained starch? draw the chemical structure of a carbohydrate and a lipid of your choice. name the structures you draw. why was water used as a negative control in the experiments in this lab?
1. Arachidonic acid, Oleic acid, Linoleic acid, and Palmitoleic acid are a few of the molecules that contain a lipid.
2. Rice, wheat, and maize are examples of substances that contain starch.
3. Cellulose makes up a carbohydrate.
For the majority of bodily metabolic functions, glucose, a type of carbohydrate, serves as the primary energy source. Lipids are a key source of energy and offer critical fatty acids for brain development. The non-nitrogen energy in parenteral nutrition is provided by lipids and carbohydrates together (PN).
Carbs and lipids vary primarily in that lipids are not water soluble while carbohydrates are. Both lipids and carbohydrates have the capacity to store energy, but only carbohydrates have the ability to form polymers due to their greater water solubility.
Learn more about carbohydrate visit: brainly.com/question/336775
#SPJ4
Aerobic respiration creates more of what molecule than fermentation?
Question 4 options:
Ethanol
Lactic Acid
Glucose
ATP
Answer:
Atp
Explanation:
This is the correct answer
Answer:
goal in 1 year from now
Explanation:
graduate from now collage
the provider receives fetal karyotype results on one of his clients. the karyotype describes an absence of all or part of the x chromosome. which condition does the fetus exhibit?
The provider receives fetal karyotype results on one of his clients. the karyotype describes an absence of all or part of the x chromosome the fetus exhibit Turner syndrome.
A condition that exists from birth is referred to as congenital. Congenital illnesses may be inherited or brought on by outside influences. Their effects on a child's health and development aren't necessarily negative; in fact, they can occasionally be fairly moderate. However, a child with a congenital disease may live a life of impairment or health issues.
It's normal to worry about congenital abnormalities if you're pregnant or planning a pregnancy, especially if the disorder in question runs in your family. There are steps you may do to lessen the likelihood that your child will be born with a congenital condition, and while not all disorders can be detected during pregnancy, some can.
To know more about turner syndrome click here:
https://brainly.com/question/2487843
#SPJ4
What are California's major mineral resources
Answer:
The term mineral resources includes minerals plus various types of rocks and sediment it also includes products made from these materials. California's major mineral resources include sand, gravel, crushed stone, building stone, gold, silver, iron, evaporite minerals, and clay.
Explanation:
The use of a vaccine to stimulate the immune system to act against a specific pathogen is valuable maintaining homeostasis because.
The use of a vaccine to stimulate the immune system to act against a specific pathogen is valuable in maintaining homeostasis because it helps to prevent diseases and infections from spreading throughout the body.
Vaccines introduce weakened or inactivated forms of pathogens or their components into the body, triggering an immune response without causing severe illness. This exposure enables the immune system to recognize the pathogen and produce specific antibodies and immune cells to target and eliminate it.
By stimulating the immune system, vaccines enhance the body's ability to defend against future infections by the same pathogen. This immune memory response allows for a faster and more robust reaction if the individual encounters the actual pathogen later on.
As a result, vaccines help maintain homeostasis by reducing the likelihood of illness and controlling the spread of infectious diseases within a population.
Furthermore, vaccines contribute to overall population health and well-being. By achieving high vaccination rates, herd immunity can be established, protecting individuals who are unable to receive vaccines due to medical conditions or age.
This collective immunity helps maintain a balanced and stable environment, limiting the transmission and impact of infectious diseases on a larger scale.
The use of vaccines in stimulating the immune system is crucial for maintaining homeostasis by preventing and controlling infectious diseases, promoting individual and population health, and establishing herd immunity to safeguard vulnerable individuals.
To know more about Pathogen here: brainly.com/question/1008643
#SPJ11
PLS HELP!! WILL GIVE BRAINLIEST!!
1. Summarize the steps of the scientific method.What is the purpose of the control in an experiment? The variable?
Answer:
You make an observation, ask a question, form a hypothesis, make a prediction about the hypothesis, test the prediction and lastly use the results to make new hypotheses or predictions.
This increases the reliability of the results (A scientific control is an experiment or observation designed to minimize the effects of variables other than the independent variable)
The things that are changing in an experiment are called variables. A variable is any factor, trait, or condition that can exist in differing amounts or types.
Explanation:
Describe the process of photosynthesis, in your own words.
Answer:
Photosynthesis is process by which green plants manufacture their food by making use of carbon dioxide and water in the presence of sunlight
chromosomes line up in the middle and make sure sister chromatids are prepared to split evenly?
The chromosomes first condense and become visible, and then they line up along the center of the cell, known as the metaphase plate.
The process of mitosis, during which chromosomes line up in the middle of the cell and separate into two identical sets of chromosomes, called sister chromatids. This occurs during the process of cell division, which allows the cell to divide into two genetically identical daughter cells.
The spindle fibers, which are made up of microtubules, attach to the centromeres of the chromosomes and help to pull them apart, ensuring that each sister chromatid is separated evenly into one of the two daughter cells.
In this way, mitosis ensures that the genetic information of the parent cell is accurately passed on to the daughter cells, preserving the chromosome number and genetic information for future generations of cells.
To know more about sister chromatids here
https://brainly.com/question/1574880
#SPJ4
What traits of a panda bear do not fit its niche ?
Explanation:
does this come for a story or is just a question?
discuss 5 systems of the body in detail, and how each contributes to allowing the physiological changes to work with the physical changes to maintain homeostasis.
The five systems of the body that contribute to homeostasis are the respiratory, urinary, digestive, nervous, and endocrine systems.
Homeostasis refers to the equilibrium of an organism's internal environment that is essential for the survival of the body. This balance between physical and physiological modifications in the body is maintained by different systems. The respiratory system maintains homeostasis by regulating the exchange of gases like oxygen and carbon dioxide, which is critical for metabolism and energy production.
The urinary system eliminates wastes from the body, which helps to keep the body's pH and ion levels balanced and preserve fluid volume. The digestive system absorbs nutrients from food and removes waste materials, allowing for the creation of chemical energy for the body to use as a fuel source. The nervous system responds to environmental changes through sensory receptors, and through coordination of the endocrine system, controls homeostasis.
The endocrine system produces hormones that regulate physiological changes in the body by transmitting messages between cells and organs. The five systems of the body that contribute to homeostasis are the respiratory, urinary, digestive, nervous, and endocrine systems. They all work together to create a stable internal environment.
Learn more about homeostasis here:
https://brainly.com/question/31789146
#SPJ11
☺️☺️☺️ a biological community of interacting organisms and their physical environment.
"the marine ecosystem of the northern Gulf had suffered irreparable damage"
(in general use) a complex network or interconnected system.
"Silicon Valley's entrepreneurial ecosystem"
Answer: hmmmmmm no clue
Explanation: yeeeeeeeeeeeeeeeeeeeeeet
Science: Cigarette smoking a increases the risk of lung cancer
Answer:
Smoking can cause lung disease by damaging your airways and the small air sacs (alveoli) found in your lungs. Lung diseases caused by smoking include COPD, which includes emphysema and chronic bronchitis. Cigarette smoking causes most cases of lung cancer.
There are two alleles at the J locus: J 1
and J 2
⋅J 2
is the less desirable allele-in homozygous form it is lethal-and its frequency in the current generation is .2. What will be the frequency of J 2
in the next generation if: a. with respect to fitness, J 1
is completely dominant to J 2
? b. J 2
is partially dominant such that J 1
J 2
individuals produce 70% fewer offspring than J 1
J 1
types? c. Compare your results for (a) and (b) above and explain why they differ.
Answer:
Explanation:
DONT KNOW SORRY
CATCGATACCATTCGGCGCATACTTCG
Translate the dna. Sequence
Answer: The DNA sequence CATCGATACCATTCGGCGCATACTTCG translates to the mRNA sequence GUAGCUAUCCUAAGCCGCGUAUGAAGC
Explanation: To translate a DNA sequence into amino acids, we need to first transcribe it to mRNA. This is done by changing T (thymine) to U (uracil). So in this case, the DNA sequence
CATCGATACCATTCGGCGCATACTTCG
transcribes to the mRNA sequence
GUAGCUAUCCUAAGCCGCGUAUGAAGC.
The next step is to divide the mRNA sequence into codons. A codon is a sequence of three nucleotides that codes for one amino acid. In this case, the codons are:
GUU (Val) GCU (Ala) UAU (Tyr) CCU (Pro) AAU (Asn) GCG (Ala) UAU (Tyr) GAA (Glu)
The sequence ends with a stop codon, which does not code for an amino acid.
Using the genetic code, we can convert each codon to its corresponding amino acid. The resulting polypeptide sequence is:
Val-Ser-Ile-Leu-Ser-Ala-Val-Stop.
Therefore, the DNA sequence CATCGATACCATTCGGCGCATACTTCG translates to the polypeptide sequence Val-Ser-Ile-Leu-Ser-Ala-Val-Stop.
Hope this helps, and have a great day!