3. Why do you think using a
pyramid shape is a good model
to show how energy moves
through an ecosystem?
TOUR
I
Answer: An energy pyramid shows the flow of energy at each trophic level in an ecosystem. A pyramid shape is used because energy is lost at each trophic level when organisms use it up
Explanation:
What is the evolution of humans
Answer:
Human evolution is the lengthy process of change by which people originated from apelike ancestors. Scientific evidence shows that the physical and behavioral traits shared by all people originated from apelike ancestors and evolved over a period of approximately six million years
Explanation:
Answer:
Human evolution is the lengthy process of change by which people originated from apelike ancestors.
Explanation:
*The Hydrologic Cycle Q3: Do you think the reservoir gains or loses w: Q4: How much?
The hydrologic cycle is a process by which water circulates through the Earth's atmosphere, oceans, and land, linking them in a continuous cycle.
During this cycle, water moves between the oceans, land, and atmosphere through evaporation, precipitation, transpiration, runoff, infiltration, and storage. The hydrologic cycle is an essential process for the Earth's ecosystems, as it distributes freshwater and supports life on the planet.
Q3: Do you think the reservoir gains or loses water?
A reservoir can gain or lose water depending on the balance between the amount of water entering and leaving the reservoir. If the inflow is greater than the outflow, the reservoir will gain water, and if the outflow is greater than the inflow, the reservoir will lose water.
Q4: How much?
The amount of water gained or lost by a reservoir will depend on various factors such as the size of the reservoir, the amount of precipitation, evaporation, and human use. Therefore, it is not possible to provide a specific value for the amount of water gained or lost by a reservoir without considering these factors.
Learn more about hydrologic cycle here:
https://brainly.com/question/13189254
#SPJ11
Because it includes the body's external barriers and cellular and chemical mechanisms that add general protection against pathogens, _____ immunity is also referred to as nonspecific immunity.
Because it includes the body's external barriers and cellular and chemical mechanisms that add general protection against pathogens, innate immunity is also referred to as nonspecific immunity.
Nonspecific immunity, or innate immunity, is the first line of defense in the body's immune system. It includes various components that provide general protection against pathogens without targeting specific antigens. Nonspecific immunity acts as a rapid and immediate response to invading pathogens.
The term "nonspecific" refers to the fact that innate immunity does not differentiate between different types of pathogens. It is a broad defense mechanism that offers protection against a wide range of pathogens, regardless of their specific characteristics. Examples of nonspecific immune responses include physical barriers like the skin and mucous membranes, as well as cellular mechanisms like phagocytosis, inflammation, and the release of antimicrobial proteins.
Unlike specific immunity, which involves the production of antibodies and targeted immune response against specific pathogens, nonspecific immunity provides a general level of protection that is always present and ready to respond to any potential threat. This type of immunity is considered the body's first line of defense and plays a crucial role in preventing the entry and spread of pathogens throughout the body.
Learn more about innate immunity here:
https://brainly.com/question/3520843
#SPJ11
what is the poly name of carbohydrates
Answer:
Polysaccharides
Explanation:
Polysaccharides are the most abundant Carbohydrate found in food. They are long chain polymeric carbohydrates composed of monosaccharide units bound together by glycosidic linkages.
Which statement describes a possible negative impact of scientific research
regarding genetically modified mosquitos?
A. Research regarding genetically modified mosquitos might
encourage research regarding other genetically modified
organisms.
B. Reducing the population of mosquitos might reduce the
transmission of mosquito-borne diseases.
C. Creating genetically modified mosquitos might result in a
reduction in the use of pesticides.
D. Permanently changing the genetic makeup of mosquitos might
cause unexpected harm to the environment.
Which single-stranded nucleic acid could form a hairpin structure? Select one:
a. 5’ TTTGCGATACTCATCGCATT 3’
b. 5’ TTTGCGATACTCACACTATT 3’
c. 5’ TTTGCGATACTCTGCGATTT 3’
d. All of the sequences above could form a hairpin loop.
e. None of these sequences could form a hairpin loop.
The sequence that could form a hairpin loop is 5’ TTTGCGATACTCACACTATT 3’
So the correct option is (b)
The hairpin loop structure is formed by the self-complementary base pairing within the same strand of a single-stranded nucleic acid. In this sequence, the complementary bases are present at the 3’ and 5’ ends, allowing the formation of a hairpin loop structure.
The hairpin loop structure is essential for many biological processes such as gene expression, RNA interference, and regulation of protein synthesis. Therefore, the sequence b. could form a hairpin loop structure.
The other two sequences do not contain a palindromic sequence and thus cannot form a hairpin structure.
Learn more about nucleic acid Here:
https://brainly.com/question/11309892#
#SPJ11
the binding of a growth factor to an rtk activates the pi 3-kinase–akt signaling pathway, which promotes both cell survival and cell growth. how does akt stimulate cell growth?
Akt, a serine or threonine kinase also known as PKB, is essential for controlling a variety of cellular processes, including as EC migration and survival, gene transcription, and protein synthesis important for angiogenesis.
Akt activates mTOR, which in turn regulates protein synthesis and cell growth. p70-S6 kinase-1 and 4E-binding protein 1 are phosphorylated by mTOR, which controls the synthesis of proteins important for angiogenesis. The activation of the highly conserved PI3K-PKB/Akt pathway is carefully regulated by a multistep process. Class 1A PI3Ks bound via their regulatory subunits or adaptor molecules, such as the insulin receptor substrate (IRS) proteins, are directly stimulated by activated receptors. Phosphatidylinositol (3,4)-bisphosphate (PIP2) lipids are converted to phosphatidylinositol (3,4,5)-trisphosphate by the catalytic domain of PI3K as a result of this (PIP3).
When PKB/Akt binds to PIP3 at the plasma membrane, PDK1 can enter the "activation loop" and phosphorylate T308 to partially activate PKB/Akt. By directly phosphorylating and inactivating tuberous sclerosis protein 2 (TSP2) and proline-rich Akt substrate of 40 kDa (PRAS40), this PKB/Akt alteration is sufficient to activate mTORC1 (TSC2). By influencing a variety of downstream components involved in regulating the G1/S and G2/M transitions, growth-factor-activated Akt signaling supports progression through regular, undisturbed cell cycles.
To learn more about protein kinase AKT. Click, https://brainly.com/question/28148355
#SPJ4
Approximately _______ percent of men are color blind (and thus improper use of color can impair their ability to read information)
Answer: 8%
Explanation: Color blindness affects 1 in 12 men which is 8%.
Using the Karvonen Method, what is the target heart rate range for an 18-year-old with a resting heart rate of 60 who wants to work between 60 and 80 percent of her maximum heart rate? (6 Points) Heart Rat Max (HRmax) Target Heart Rate - 60 % ( THR 60%) Heart Rate Reserve (HRR) Target Heart Rate - 80% (THR 80%)
The target heart rate range for an 18-year-old with a resting heart rate of 60 who wants to work between 60 and 80 percent of her maximum heart rate is 141.2 bpm to 170.6 bpm.
Using the Karvonen Method:
The maximum heart rate (HRmax) :
HRmax = 220 - age.
For an 18-year-old, the maximum heart rate (HRmax) will be:
HRmax = 220 - 18
HRmax = 202 bpm
Therefore, the maximum heart rate (HRmax) for an 18-year-old is 202 bpm.
Heart rate reserve (HRR) :
HRR = HRmax - RHR (Resting Heart Rate).
RHR is the resting heart rate of the individual. For an 18-year-old with a resting heart rate of 60 :
HRR = HRmax - RHR
HRR = 202 - 60HRR = 142 bpm
Therefore, the heart rate reserve (HRR) for an 18-year-old is 142 bpm.
The target heart rate - 60% (THR 60%) :
THR 60% = (HRR x 0.6) + RHR
THR 60% = (HRR x 0.6) + RHR
THR 60% = (142 x 0.6) + 60
THR 60% = 141.2 bpm
Therefore, the target heart rate - 60% (THR 60%) for an 18-year-old is 141.2 bpm.
The target heart rate - 80% (THR 80%) :
THR 80% = (HRR x 0.8) + RHR
THR 80% = (HRR x 0.8) + RHR
THR 80% = (142 x 0.8) + 60
THR 80% = 170.6 bpm
Therefore, the target heart rate - 80% (THR 80%) for an 18-year-old is 170.6 bpm.
To know more about Heart rate visit:
https://brainly.com/question/1155838
#SPJ11
Mark places some cells from an onion skin on a microscope slide. He uses a freshwater solution to make the wet-mount slide. When he observes the cells under the microscope for an extended period of
time, what is he most likely to see?
A) The cells have dissolved, destroying the cell walls
B) The cells have shrunk within the cell walls
C) The cells have not been affected by the solution
D)The cells have swollen, expanding the cell walls
Answer:
D
Explanation:
Answer:
D
Explanation: All the way
Which type of chromosome mutation increases the amount of genetic sequence in a single chromosome
A. duplication
B. translocation
C. deletion
D. inversion
The type of chromosome mutation that increases the amount of genetic sequence in a single chromosome is A. duplication.
A chromosome mutation is a change in the structure or number of chromosomes in an organism's genome. Duplication is a type of chromosome mutation in which a segment of a chromosome is copied and inserted into the same chromosome. This results in an increase in the amount of genetic sequence in that chromosome.
Translocation, deletion, and inversion are also types of chromosome mutations, but they do not increase the amount of genetic sequence in a single chromosome.
Translocation occurs when a segment of a chromosome is moved to a different chromosome. Deletion occurs when a segment of a chromosome is removed. Inversion occurs when a segment of a chromosome is flipped in the opposite direction.
To know more about chromosome mutation, refer here:
https://brainly.com/question/23941970#
#SPJ11
Bacteria living in communities of microbes change the genes they are expressing in response to
A) decreasing oxygen.
B) changes in local temperature.
C) quorum-sensing molecules.
D) changes in hydrostatic pressure. E) changes in pH.
Bacteria living in communities of microbes change the genes they are expressing in response to C) quorum-sensing molecules.
Quorum sensing is a process of cell-to-cell communication used by bacteria to coordinate gene expression in response to changes in population density. Bacteria produce and release small signaling molecules called autoinducers, which accumulate in the environment as the cell density increases. Once a critical concentration of autoinducers is reached, the bacteria can detect it and respond by activating or repressing specific genes that are involved in various cellular processes, such as virulence, biofilm formation, and antibiotic resistance.
The ability to communicate and coordinate gene expression in this way allows bacteria to function as a group and adapt to changing environmental conditions more effectively.
For more such questions on Bacteria
https://brainly.com/question/29647761
#SPJ11
Would this make sense? A dogs eye color was brown which his allele coded for
Answer:
It makes sense to me, but you could also say "The dog's allele codes for brown eyes"
The human skeleton is comprised of 206 different bones that provide a framework for the body. The long bones in the arms and legs are made primarily of cancellous and compact bone. Compact bone is the hard outer layer, and cancellous bone is the spongy inner layer. Which of the following corresponds to the level of compact and cancellous bone in the structural hierarchy used to describe human beings? A cell B organ C organ system D tissue
Answer:
A Cell
Explanation:
the bones are made of millions of cels
Tissue corresponds to the level of compact and cancellous bone in the structural hierarchy used to describe human beings. Therefore, option (D) is correct.
What are bones?Compact and cancellous bone are both types of specialized connective tissue that make up the bones in the human skeleton. In the structural hierarchy used to describe the human body, tissue is the level above cells and below organs.
A tissue is a group of cells that work together to perform a specific function. In the case of bone tissue, compact and cancellous bone work together to provide strength and support for the body. Therefore, compact and cancellous bone correspond to the tissue level in the structural hierarchy used to describe human beings
Learn more about bones, here:
https://brainly.com/question/5482443
#SPJ3
state what would happen to the ion pumping activity and atp hydrolyzing activity of the na /k pump if the plasma membrane of animal cells was made entirely permeable to na . what would happen to the na distribution?
The distribution of Na will cause the cells to ne hypertonic and thus Failure of the Na⁺-K⁺ pump can cause cells to swell.
The osmotic pressure of a cell is the sum of the concentrations of various ionic species and many proteins and other organic compounds inside the cell. If this is higher than the osmotic pressure outside the cell, water will flow into the cell by osmosis. Thus, inhibition of this pump causes cell depolarization.
This is due not only to changes in the Na+ and K+ concentration gradients, but also to the loss of the potential component of the resting membrane potential. Partial inhibition of the electrogenic Na+/K+ pump results in cell swelling and an increase in the number of functional Na+/K+ ATPase molecules within the membrane. This compensates for the effects caused by pump suppression.
Read more about calcium;
https://brainly.com/question/26636816
#SPJ4
a family in which both parents have offspring from earlier relationships is called a(n) family. polygamous single-parent blended extended\
A family in which both parents have offspring from earlier relationships is called a blended family.
Blended families are also sometimes referred to as stepfamilies, because the parents are often stepparents to some or all of the children. In a blended family, the children may live with one or both of their biological parents, as well as with stepsiblings and stepparents. Blended families can present unique challenges for family dynamics and relationships, as family members may have different expectations and relationships with one another. However, with open communication and a willingness to work together, blended families can also create strong and supportive family bonds.
To know more about blended family click here:
brainly.com/question/9743198
#SPJ4
give me 3 reasons of the importance of vegetative plant propagation.
Answer:
Plant propagation is the process of increasing the number of plants of a particular species or cultivar. Propagation can be via sexual or asexual means. Over the years, horticulturalists have developed asexual propagation methods that use vegetative plant parts. This allows plants to be created in ways that nature cannot duplicate.
Explanation:
what does a large base (many 0-9 year olds) mean for a countries future?
Which of the following types of microscopy are known for their ability to support the creation of three-dimensional images? Select all that apply. Light microscopy Standard fluorescence microscopy Confocal microscopy Scanning electron microscopy
The following types of microscopy are known for their ability to support the creation of three-dimensional images are C. Confocal microscopy and D. Scanning electron microscopy
The reason why these types of microscopy are known for their ability to support the creation of three-dimensional images is because of the way they capture images. Confocal microscopy is a light-based microscopy technique that provides three-dimensional images of thick specimens by eliminating out-of-focus light from the specimen. Confocal microscopy is capable of achieving high spatial resolution and has been used in a variety of scientific and medical research applications, including studies of cell biology, neuroscience, and tissue engineering.
Scanning electron microscopy is an imaging technique that uses a focused beam of electrons to produce images of the surface of a sample. In scanning electron microscopy, the electron beam is scanned across the surface of the sample, and the electrons that are scattered from the surface are detected and used to create an image. Scanning electron microscopy is capable of providing high-resolution images of the surface of a sample and is commonly used in materials science, biology, and other fields of research. So therefore the correct answer is C. Confocal microscopy and D. Scanning electron microscopy are the types of microscopy known for their ability to support the creation of three-dimensional images.
Learn more about electron microscopy at
https://brainly.com/question/16710784
#SPJ11
In this lab, you will simulate birds with three different beaks. After watching the birds feed, you will remove fruit to simulate a change in the environment. What question are you answering by doing this observation? Write it by filling in the blanks below.
What is the effect of…
…on…
Answer:
Lesson Question: What is the effect of the type of food available on the frequency of different types of bird beaks?
Explanation:
EDGE
1. Many LDC countries are rapidly industrializing, greatly increasing resource use and pollution output. What should MDC's (us) do to mitigate the environmental and social cost of LDC's industrializing. Be specific in your recommendations. (3 marks) 2. Democracies depend on informed voters. Suggest several reasons why people do not listen/follow the news. Describe a solution to the problem of uninformed people (be realistic). (3. If a population of squirrels is 245, has a BR of 34/year, DR of 28/year, IR of 82/year and ER of 2/year, what would be the GR? What would be the population at the end of one year? Show your work.
1. To mitigate the environmental and social cost of LDCs industrializing, the MDCs could do the following actions: Collaborate and fund LDCs in building sustainable infrastructures with low carbon emissions.
Collaborate and fund LDCs in developing renewable energy infrastructures and technology. Share technology and knowledge on sustainability with LDCs.
2. There are many reasons why people do not listen to or follow the news. Some people feel overwhelmed by the amount of information, others do not trust the media, and some may not have access to reliable news sources. A possible solution to the problem of uninformed people could be to encourage media literacy and critical thinking in schools and universities. This would empower individuals to analyze and evaluate news sources and information. Providing free or low-cost access to reliable news sources and investing in investigative journalism could also help to combat misinformation. 3. Here are the steps to find the GR and the population at the end of one year.
GR = (BR + IR) - (DR + ER)= (34 + 82) - (28 + 2)= 86 - 30= 56 The population at the end of one year will be: P1 = P0 + B - D + I - E= 245 + (245 × 56/100) - (245 × 28/100) + (245 × 82/100) - (245 × 2/100)= 245 + 137.2 - 68.6 + 200.9 - 4.9= 509.6 ≈ 510Therefore, the population at the end of one year would be 510.
Learn more about industrializing here.
https://brainly.com/question/32029094
#SPJ11
Yoghurt contains living bacteria. Bacteria are also capable of anaerobic respiration. If a sealed carton of yoghurt is left for a long time, the lid bulges upwards. Why does this happen?
the energy stored in atp comes from which of the following? the energy stored in atp comes from which of the following? adenosine triphosphate kinetic energy food molecules heat
The energy stored in the ATP comes from food molecules (option C).
What is ATP?ATP, which is an acronym for Adenosine triphosphate, is a biological molecule that carries and stores energy for use by living cells.
It is regarded as the energy currency of the cell. The ATP molecule stores energy in the phosphate bonds and is release when the bond is broken.
However, this energy emanates from the food molecules we ingest. Digestion, which breaks down food molecules into simplest absorbable unit, follows ingestion.
Therefore, the energy stored in the ATP comes from food molecules.
Learn more about ATP at: https://brainly.com/question/14637256
#SPJ1
the foramen magnum is located in which bone of the skull?
Answer:
occipital bone
Explanation:
The sagittal diameter is greater in the male, as is the transverse diameter. The foramen magnum is the largest foramen of the skull. It is located in the most inferior portion of the cranial fossa as a part of the occipital bone
1. Explain what a "derived character" is in your own words.
Answer:
It is a trait or characteristics of yours most recent ancestor or a lineage of organisms that has evolved after separating from another lineages.
Write on meiosis and mitosis; relevances and the processes.
Answer:
Mitosis is the process of cell division usually dedicated to cell growth or asexual reproduction. There are five phases of mitosis, which include prophase, prometaphase, metaphase, anaphase, and telophase. These phases are followed by cytokinesis. The end product of mitosis is two diploid daughter cells that are genetically identical to the mother cell.
Meiosis is the process of cell division that is dedicated to sexual reproduction. Meiosis occurs in two parts, which the same phases of mitosis that are essentially repeated twice. Meiosis increases genetic diversity due to crossing over and independent assortment that occurs during meiosis 1. The end product of meiosis are four haploid cells that originated from one mother cell.
Explanation:
List the composition of the unaltered hard parts for each organism or part of an organism (for example, calcite, aragonite, phosphate, silica or organic). Organism Composition of Hard Parts a. Shark tooth b. Clam c. Brachiopod d. Crinoid e. Scallop f. Whale bone g. Wood h. Snail i. Fish j. Sponge k. Diatom I. Foraminifera m. Coral n. Radiolarian 1047 7/20
calcium and phosphate and carbonate are present in the composition of unaltered hard parts for each organism or part of an organism.
Organism Composition of Hard Parts Shark tooth Calcium phosphate Clam Calcium carbonate Brachiopod Calcium phosphate and calcium carbonate Crinoid Calcium carbonate Scallop Calcium carbonate Whale bone Calcium phosphate and collagen Wood Cellulose Snail Calcium carbonate Fish Calcium phosphate Sponge Calcium carbonate Diatom Silica Foraminifera Calcium carbonate Coral Calcium carbonate Radiolarian Silica.
To know more about organism click here
brainly.com/question/842527
#SPJ11
How are the results and findings of scientific study communicated?
Answer:
Typically, scientists communicate their work within the scientific community by writing and publishing research articles and presenting posters and oral communication of scientific conferences.
Answer:
Scientists often communicate their research results in three general ways. One is to publish their results in peer-reviewed journals that can be ready by other scientists. Two is to present their results at national and international conferences where other scientists can listen to presentations.
Hurry HELP ME WITH THIS PLEASE!!!!!
The values for the speed of the scientists and the distance time graph are found as follows;
6. Please find attached the required distance time graph for each scientist
7. Newton's speed is about 1.\(\overline{1}\) m/s
Madam Curie's speed is 2.5 m/s
Tyson's speed is 1.\(\overline{428571}\) m/s
8. Madam Curie won the race, Tyson was second and Newton was third
9. The slope of the lines on the graphs are
The slope on Newton's graph = 1.\(\overline{1}\)
Slope on Madam Curie's graph = 2.5
Slope on Tyson's graph = 1.\(\overline{428571}\)
What is the slope of a linear graph?The slope of a graph is the ratio of the rise to the run of the line on the graph.
The specified information in the question are as follows;
The time it takes Newton to complete the 10 meters walk = 9 seconds
The time it takes Madame Curie to complete the distance of 10 meters = 4 seconds
The time it takes Tyson to complete the 10 meter distance while balancing the apple on his head = 7 seconds
The formula for the speed is; Speed = Distance/time
\(Speed = \dfrac{Distance}{Time}\)
Distance = Time × Speed
Therefore, distance is directly proportional to the time of travel at a specified speed
The graph of the distance to time is therefore a straight line passing through the origin.
The coordinate of the origin (0, 0) is a point on the graph of each person.
The other point are specified by the value, y = 10 meters, and t as follows;
The points on the graph of Newton are (9, 10), (0, 0)
Newton's speed = 10 m/(9 s)= 1.\(\overline{1}\) m/s
The point on the graph of Madam Curie are (4, 10), (0, 0)
Madam Curie's speed = 10 m/(4 s) = 2.5 m/s
Points on the graph for Tyson are (7, 10), (0, 0)
Tyson's speed = 10 m/(7 s) = 1.\(\overline{428571}\) m/s
Please find the distance vs. time graph for each scientist created with MS Excel
7. The formula for the speed of each scientist is presented as follows;
\(Speed = \dfrac{Distance }{Time}\)
Newton's speed = 10 m/(9 s) = 1.\(\overline{1}\) m/s
Madam Curie's speed = 10 m/(4 s) = 2.5 m/s
Tyson's speed = 10 m/(7 s) = 1.\(\overline{428571}\) m/s
8. The winner of the race is the scientist with the highest speed, who completes the 10 meter distance in the shortest time, which is Madam Curie
The scientist that was second is the scientist with the second fastest time, which is Tyson
The scientist that was third is Newton
9. The slope of the line is equivalent to the speed of each scientist, therefore;
The slope for Newton's distance time graph is 1.\(\overline{1}\) m/s
Slope for the graph for Madam Curie is 2.5
Slope for the distance to time graph for Tyson is 1.\(\overline{428571}\)
Learn more on the distance time graph here: https://brainly.com/question/17330529
#SPJ1