Answer:
c. Prokaryotic cells
Explanation:
Searched it up.
What would happen if cytokinesis did not occur?
Answer:
Cytokinesis takes place in both meiosis and mitosis and performs the separation of he cell in half and form one nucleus into each daughter cell.
If cytokinesis did not happen, it will from multinucleated cells which means that their will be multiple nuclei in single cell and cell will not get separate in half, and no new daughter cells will form.
Who is known as the father of taxonomy?
Answer:
Carolus Linnaeus, the Swedish botanical taxonomist who was the first person to formulate and adhere to a uniform system for defining and naming the world's plants and animals.
Explanation:
Answer:
Carolus Linnaeus
Explanation: Carolus Linnaeus, the Swedish botanical taxonomist who was the first person to formulate and adhere to a uniform system for defining and naming the world's plants and animals.
Is there any plastid in mango seed?
Consider a locus in which the fitness of aa and aa genotypes are greater than the fitness of aa genotype. In addition, this locus experiences forward mutation from the a allele to a allele. At this locus, the a allele will:.
In addition, this locus experiences forward mutation from the a allele to a allele, at this locus, the a allele Will never go to fixation.
The abrupt, heritable alteration in an organism's genetic sequence is known as a mutation. The organisms' unique sickness could be brought on by the mutation.
A mutation in biology is an adjustment to the nucleic acid sequence of an organism's, virus's, or extrachromosomal DNA. DNA or RNA can be found in the viral genome.
Increased gene frequency in following generations is caused by improved gene fitness. When selection and mutation are absent, the gene will stabilize in the population. Due to the fact that mutation is occurring, as indicated by the facts provided in the question, the A allele will never become fixed in the population.
To know more about mutation click here:
https://brainly.com/question/17914937
#SPJ4
Consider a locus in which the fitness of AA and Aa genotypes are greater than the fitness of aa genotype. In addition, this locus experiences forward mutation from the A allele to a allele. At this locus, the A allele:
a. will always go to fixation.
b. will always be lost.
c. will never go to fixation.
d. will never change.
e. None of the above.
___are the basic units of structure and function in all living things.
Answer: Cells
Explanation: Cells are the basic units of structure and function in all living things.
Answer:
Cells
Explanation:
cells is the answer.
I need help with this practice problem solving In your words, give a short summary to my pic
Answer: The English settlers brought it over from England when they brought supplies to start a new life over
Explanation:
A ____ is where scientists share their findings and other scientists review their work to make sure they followed the scientific method.
Answer:
Peer review
Explanation:
a phrase that you will encounter in other contexts is that the genes for these shared biochemical and developmental pathways are conserved. how does this indicate descent from a common ancestor?
When the genes for shared biochemical and developmental pathways are conserved, it indicates that the organisms that share those genes are likely to have descended from a common ancestor.
Because genetic material is passed down from generation to generation, two organisms with similar genetic material are likely to have a common ancestor. The genetic material of an organism is passed down from generation to generation.
As a result, two organisms with similar genetic material are likely to have a common ancestor. When genes for shared biochemical and developmental pathways are conserved across species, it indicates that the organisms that share those genes likely evolved from a common ancestor.
know more about biochemical here
https://brainly.com/question/11582799#
#SPJ11
a strain of e. coli is unable to use the uv repair pathway because of an apparent absence of dna helicase activity. which uv repair gene is likely mutated in this strain?
If a strain of E. coli is unable to use the UV repair pathway due to a deficiency in DNA helicase activity. The UV repair gene likely mutated in this strain is the uvrD gene.
The uvrD gene encodes the DNA helicase II protein, which plays a crucial role in the nucleotide excision repair (NER) pathway. This pathway is responsible for identifying and repairing DNA damage caused by ultraviolet (UV) radiation.
DNA helicase II, encoded by the uvrD gene, unwinds the DNA strands, allowing other repair proteins, such as UvrA, UvrB, and UvrC, to access and excise the damaged region. Once the damaged section is removed, DNA polymerase fills in the gap, and DNA ligase seals the new strand.
A mutation in the uvrD gene would lead to the absence of DNA helicase activity, preventing the unwinding of the DNA strands and thus inhibiting the NER pathway. As a result, the E. coli strain would be unable to repair UV-induced DNA damage, leaving it vulnerable to the detrimental effects of UV radiation.
For more such questions on DNA helicase, click on:
https://brainly.com/question/16660009
#SPJ11
Two isotopes of the same element must have the same
A. O atomic symbol and number of neutrons.
B
atomic mass and number of neutrons.
C.
atomic symbol and number of protons.
D
atomic
and number of protons.
Answer:
C. atomic symbol and number of protons.
Explanation:
number of protons in the nucleus, but differ in the number of neutrons. The nucleon number is equal to the total number of protons and neutrons in the nucleus. ... The atomic mass number A is equal to the total number of protons and neutrons.
Two isotopes of the same element must have the same atomic symbol and number of protons.
ISOTOPES:
Isotopes are atoms of the same element with the same atomic number and chemical identity but different atomic masses. The forms in which atoms of a particular element exists is referred to as its isotope.The sole difference between isotopes of the same element is the number of neutrons each contain, which is responsible for the difference in masses. This means that isotopes of the same element must have the same atomic symbol and number of protons. For example, Carbon has two isotopes namely: C- 14 and C- 12 with both possessing atomic number 6 and symbol C.Learn more: https://brainly.com/question/21536220?referrer=searchResults
Mark Twains The Adventures of Huckleberry Finn draws from certain biblical themes , such as a storm symbolizing destruction. Which details best shows this symbolism?
Answer:
In The Adventures of Huckleberry Finn, the storm symbolizes destruction as shown by the chaos and damage caused by the tornado in the town where Huck and Jim were residing.
Explanation: The storm in the novel is a representation of the destruction and chaos that occurs as a result of the characters' actions. The tornado that hits the town where Huck and Jim were residing is a perfect example of this symbolism. The tornado is described as "ripping and tearing through everything" and causing "the most outrageous damage." The destruction caused by the storm is a direct result of the characters' immoral behavior, particularly their decision to steal and hide the money.
The role of which bodily system is to protect the body from diseases?
A. excretory
B. nervous
C. lymphatic
D. endocrine
Answer:
lymphatic
Explanation:
It contains your immune system that helps you fight off diseases
What is the role of cellular respiration in waste-water treatment?
don't use g o o o g l e
please
What happen if the dna is not divided evenly between cell?
Answer: Since the cell is dividing it needs two copies of its DNA - one is kept by the parent cell and the other is passed to the daughter cell. If cells don't replicate their DNA or don't do it completely, the daughter cell will end up with no DNA or only part of the DNA. This cell will likely die
:p
Answer:
Since the cell is dividing it needs two copies of its DNA - one is kept by the parent cell and the other is passed to the daughter cell. If cells don't replicate their DNA or don't do it completely, the daughter cell will end up with no DNA or only part of the DNA. This cell will likely die.
Explanation:
10 points for each answer! I will report absurd answers. I know the answer but just need different input. Thanks.
How does the loss of arctic ice affect the human population?
Answer:
The loss of Arctic ice will most likely lead to further climate change. Climate change affects plants, animals, the weather, commerce, etc. All of these things affect our food supplies.
It will also contribute to sea-level rise, both as it melts into the oceans and as the warming water expands.
I am no expert but I hope this helps!
Explanation:
A tornado is a violent ____ with a ____ column of air
A.active
B.cool air
C.300 mph
D.alley
E.ground
F.warm air
G.canada
H.rotating
i. storm
J.thunderstorms
will give brainliest
Answer:
storm; rotating
Explanation:
The kidneys, ureters, urethra, and bladder are organs found in which system
Answer:
Urinary System
Explanation:
The organs of the Urinary System include the
kidneys, renal pelvis , ureters, bladder and
Ureethra.
Humans & other animals regulate cell growth & cell division. In humans, which of these types of cells generally do not divide after they have developed?
a. skin cells
b. cells of the lining of the digestive tract
c. cells in the bone marrow that generate blood cells
d. muscle cells & nerve cells.
Answer:
d.
Explanation:
muscle cells & nerve cells do NOT divide anymore after they are fully developed
Please Help Mehhhhh!!!!!!!!!!!!!!!!!!!!!!!
PLEASE HELP IMSTUCK
All cells share common traits that help scientists draw conclusions about the basic needs and functions of living organisms. What is the meaning of cell theory?
A) explains that cells are the basic unit of all living and nonliving things
b)states that all cells are exactly alike
c) lists the main ideas that explain the importance of cells for all life
d) proves that all cells have all the same structural part
Scientists can make inferences about the fundamental requirements and operations of living creatures thanks to the shared characteristics of all cells. The meaning of cell theory lists the main ideas that explain the importance of cells for all life. The correct option is c).
What is cell theory?The cell theory says three things about cells. The cell is the basic and smallest unit of life. The theory contains three statements about cells. The principles are :
The cell is the basic unit of life.All organisms are made up of cells.Cells are made from pre-existing cells.The principles of cell theory say that the main ideas about the value of cells in life.
Thus, the correct option is c) to list the main ideas that explain the importance of cells for all life.
To learn more about cell theory, refer to the link:
https://brainly.com/question/1468725
#SPJ2
How did the research presented in the article affect scientists’ understanding of the evolution of eukaryotes?
Hello. You forgot to mention that the article you are in and the research refer to the relationship between eukaryotes and archeas.
Answer:
Research has shown that not only archaea was related to the creation of eukaryotic cells, but bacteria were also involved.
Explanation:
For many years it was believed that archaea and eukaryotic cells were genetically related due to an evolutionary process that involved the generation of eukaryotic cells through the evolution of archaea. At the same time, scientists believed that archaea were more closely linked to eukaryotic cells than bacteria.
However, the research shown in the article to which the question refers showed that this thought was incorrect. This is because the research says that bacteria are also closely related to eukaryotic cells, which means that together with archaea, bacteria were part of the evolutionary process that formed these cells.
Isabella liked to sunbathe. However, after she learned that ultraviolet rays are a cause of environmental mutations, she decided to stop sunbathing.
Another kind of mutation is genetic, and it is caused by small changes in an organism’s DNA. A change in a base pair is a mutation. This can cause the wrong protein to be made during protein synthesis. Which of the following are causes of mutations? Choose three that apply.
A. DNA sequence
B. deletion
C. addition
D. sex-linked
E. substitution
F. expression
Deletion, addition, and sex-linked are causes of mutation, introducing one or more nucleotides to the gene, an insertion modifies the DNA sequence.
What are the different types of mutations?The protein produced from the gene might not work effectively, by eliminating at least one nucleotide from a gene, a deletion modifies the DNA sequence.
One of the sex chromosomes, which are the X and Y chromosomes, is how sex-related disorders are inherited.
When one parent's faulty gene can cause an illness while the other parent's identical gene is normal, this is known as dominant inheritance.
Therefore, B, C, and D are correct.
Learn more about mutations, here:
https://brainly.com/question/22545261
#SPJ1
1. Original DNA: CATATACGCATCTGATTACGTGATTCT CTATA GTATATGCGTAGACTAATGCACTAAGAGATAT
Show the DNA after it has been separated by helicase.
Top Strand:
Bottom Strand:
Explanation:
gtatatgcgtagactaatgcactaagagatatcatatacgcatctgattacgtgattctctata
How do people get natural dye.?
I am thinking that are from trees but I am not sure pls help me
Answer:
people can get first from anything really
Explanation:
plants like lavander can give a slight purple color and etc
Indigo plants ;And woad is to make violet and blue dyes
A scientist performs a series of mutation screens to look for mutations that reduce ATP production. One of the mutants, compared to a wild-type cell, has reduced levels of ATP and NADH and increased levels of FAD and pyruvate. Which hypothesis best fits these observations?
The hypothesis that best fits the observation that one of the mutants has reduced levels of ATP and NADH and increased levels of FAD and pyruvate is that the mutation is disrupting the citric acid cycle (Option 3).
What is the citric acid cycle?The citric acid cycle, also known as the Krebs cycle, is the second step of cellular respiration which is required to generate ATP through the oxidation of pyruvate.
The reduced form of Nicotinamide adenine dinucleotide (NADH) produced during the citric acid cycle is then used in oxidative phosphorylation (the third step of cellular respiration) in order to generate more ATP.
Therefore, with this data, we can see that the citric acid cycle generates the reduced form of Nicotinamide adenine dinucleotide (NADH) and thus increases the production of ATP, thereby a mutation in an enzyme that works in this pathway may also hamper the proportion of ATP.
Complete question:
A scientist performs a series of mutation screens to look for mutations that reduce ATP production. One of the mutants, compared to a wild-type cell, has reduced levels of ATP and NADH and increased levels of FAD and pyruvate. Which hypothesis best fits these observations?
The mutation is disrupting glycolysis.
The mutation is disrupting fermentation.
The mutation is disrupting the citric acid cycle.
The mutation is disrupting the electron transport chain.
Learn more about the citric acid cycle here:
https://brainly.com/question/14900762
#SPJ1
Answer:
For the people to lazy to read that. The answer is c.
Explanation:
Whale primary functions
The primary functions of whales include feeding, reproduction, communication, and migration.
Whales are primarily filter feeders or predators, depending on the species.
Filter-feeding whales, such as baleen whales, have baleen plates in their mouths that allow them to filter out small prey, such as krill or small fish, from large volumes of water.
Predatory whales, such as toothed whales, hunt and feed on various marine organisms, including fish, squid, and marine mammals.
Reproduction is another important function for whales. Most whale species have a gestation period of several months, with females giving birth to a single calf.
The calves are nursed with milk from their mothers and rely on their care for a period of time until they become independent.
Communication is vital for whales, as they rely on vocalizations to communicate with other members of their pod.
Whales produce a variety of sounds, including songs, clicks, and whistles, which serve purposes such as mating, social interactions, and navigation.
Migration is a common behavior observed in many whale species. Whales undertake long-distance migrations, often covering thousands of kilometers, to reach feeding grounds in nutrient-rich waters or to reproduce in specific breeding areas.
These migrations are driven by seasonal changes in food availability and environmental conditions.
In summary, the primary functions of whales encompass feeding, reproduction, communication, and migration, all of which are essential for their survival and successful adaptation to their marine environments.
For more such answers on whales
https://brainly.com/question/28623065
#SPJ8
how do you fix hair when you just got back from the beach? i washed my hair and it still hasn’t gone back to normal yet.
Answer:
perhaps your hair is a bit dry right now? have you tried deep conditioning it?
10. Which of the following provide most of the energy in ecosystems?
a. keystone species
b. carnivores
c. generalists
d. producers
Answer:
c.
Explanation:
Which term describes a single female arctic The group of polar bears that live along the eastern coast of Russia makes upfox?
The term that describes a single female arctic fox is a vixen.
A vixen is a female fox, including the arctic fox, that is not pregnant or nursing young. It belongs to the Canidae family and is found in the tundra and other Arctic regions of the Northern Hemisphere.The Arctic fox is a small, compact, and sturdy mammal that can survive in some of the world's harshest environments.
The population of Arctic foxes that lives along the eastern coast of Russia is not referred to as a group of polar bears. It is known as a population, a community, or a family.A population is a group of animals of the same species that live in the same area and interact with one another.
A family of arctic foxes is made up of a male and female adult and their offspring. They live together in underground dens that are used for shelter and protection.Arctic foxes are considered a keystone species in the Arctic region because they play a crucial role in the ecosystem. They feed on small animals like lemmings and voles, which helps to regulate their populations. In addition, they are a food source for larger predators like wolves and polar bears, which helps to maintain balance in the food web.
For more such questions on arctic fox, visit:
https://brainly.com/question/27754416
#SPJ8