The watery fluid that contains electrolytes and mucus to soften and dissolve food particles is called saliva. It plays a vital role in the digestion process by lubricating, moistening, and beginning the breakdown of food in the mouth.
Saliva is produced by the salivary glands in the mouth and plays a crucial role in the process of digestion. It is primarily composed of water, electrolytes (such as sodium, potassium, and chloride), mucus, enzymes (such as amylase), and antibacterial compounds.
Saliva helps to moisten food, making it easier to swallow and facilitating the initial stages of digestion. The mucus in saliva helps to lubricate and protect the lining of the mouth and throat. The electrolytes present in saliva help to maintain the balance of fluids in the body.
Additionally, saliva contains enzymes, such as amylase, which begin the breakdown of carbohydrates into simpler sugars. This enzymatic action starts the process of digestion even before food enters the stomach.
Learn more about saliva
https://brainly.com/question/882651
#SPJ11
Malthus studied limited resources and their impact on human populations. how did these ideas contribute to darwin's ideas?
Malthus' work made Darwin realize the importance of overpopulation and how it was necessary to have variability in different populations.
What was Malthus's idea about the human population?Darwin based his entire theory of natural selection on Malthus' concepts of using competition and the concept of survival in numbers.
The Malthusian growth model, an exponential formula used to forecast population growth, was named after Thomas Malthus, a British philosopher and economist who lived in the 18th century. According to the hypothesis, if the population continues to rise, food supply would be unable to keep up, which will lead to calamities like famine, disease, and war. Simply said, food production cannot keep up with the population growth.
According to Malthus, the inability of the available resources to keep up with the population's constant growth ultimately leads to a continuous battle by the lower economic classes for existence.
To learn more about human population refer to:
https://brainly.com/question/24067944
#SPJ4
Subjects in an experiment are exposed to a stimulus and asked to describe and analyze their experiences. these subjects are engaging in?
The subjects in the experiment you described are engaging in a process called introspection. Introspection involves examining and reflecting upon one's own thoughts, feelings, and experiences.
In this case, the subjects are being exposed to a stimulus and then asked to describe and analyze their experiences as a way to gain insights and understanding. Introspection can be a valuable tool in psychological research and allows researchers to explore the inner workings of the mind and gather subjective data from individuals. I
t is important to note that while introspection provides valuable insights, it is subjective in nature and can vary between individuals. Introspection can be a valuable tool in psychological research and allows researchers to explore the inner workings of the mind the subjects are being exposed to a stimulus and then asked to describe and analyze their experiences as a way to gain insights and understanding.
To know more about experiment visit:
https://brainly.com/question/11256472
#SPJ11
True or False
1. Air pollutants can come from both natural and man-made sources.
2. Light pollution is negatively effecting fireflies and their populations are decreasing because of this.
3. Excessive use of car horns and sirens are both examples of noise pollution.
4. Light pollution allows us to see the stars easier.
5. Forest Fires are an example of natural air pollution.
True. Air pollutants can come from both natural and man-made sources. Natural sources of air pollutants include dust storms, volcanic eruptions, and wildfires.
These events release particles and gases into the atmosphere, which can negatively impact air quality. On the other hand, man-made sources of air pollutants include industrial emissions, vehicle exhaust, and burning fossil fuels for energy production. These human activities release pollutants such as sulfur dioxide, nitrogen oxides, and particulate matter, contributing to air pollution.
2. True. Light pollution does negatively affect fireflies. Fireflies rely on their bioluminescent light signals to communicate and attract mates. However, artificial light sources can interfere with these signals, making it difficult for fireflies to find mates and reproduce. Additionally, light pollution can disrupt fireflies' natural behavior and breeding patterns, leading to a decline in their populations.
3. True. Excessive use of car horns and sirens is considered noise pollution. Noise pollution refers to the presence of excessive, unwanted, or disturbing sounds in the environment. Car horns and sirens emit loud and sudden noises, which can be disruptive and annoying. Noise pollution can have negative impacts on human health, causing stress, sleep disturbances, and impaired concentration.
4. False. Light pollution does not allow us to see the stars easier. In fact, excessive artificial lighting in urban areas can create a glare that obscures the view of stars and celestial objects. The bright lights in cities scatter and reflect off particles in the atmosphere, creating a phenomenon known as skyglow. This light pollution hinders our ability to observe stars, planets, and other astronomical features clearly. To see stars easier, it is necessary to reduce light pollution and seek areas with minimal artificial lighting.
5. False. Forest fires are not considered natural air pollution. While forest fires do release smoke and particles into the air, they are not categorized as air pollution. Forest fires occur naturally in ecosystems and play a role in maintaining ecological balance. However, when humans cause uncontrolled or excessive fires, it can lead to environmental damage and impact air quality. Forest fires caused by human activities can release harmful pollutants and contribute to air pollution.
In conclusion, air pollutants can come from both natural and man-made sources, light pollution negatively affects fireflies, excessive use of car horns and sirens is noise pollution, light pollution hinders our ability to see stars, and forest fires are not considered natural air pollution. By understanding these concepts, we can work towards reducing pollution and preserving our environment.
To know more about Air pollutants visit:
https://brainly.com/question/33719449
#SPJ11
what are nucleic acids made of?
Answer:
Nucleotide
Explanation:
Nucleic acids are long chainlike molecules composed of a series of nearly identical building blocks called nucleotides.
Which of the following characteristics would not have been useful in the evolution of land
plants?
Select one:
O a. vascular tissue
O b. water conservation mechanisms
O c. a dominant sporophyte
O d. a dominant gametophyte
e. stomata for gas exchange
e. stomata for gas exchange would not have been useful in the evolution of land plants.
Stomata are small openings on the surface of leaves and stem that allow for the exchange of gases between the plant and the environment. They are very important in photosynthesis, the process by which plants use light energy to convert carbon dioxide and water into glucose and oxygen. This process helps land plants to survive and thrive on land.
Water conservation mechanisms, vascular tissue, a dominant sporophyte and a dominant gametophyte, on the other hand, were all necessary for the evolution of land plants. Vascular tissue is necessary for transporting water and nutrients throughout the plant. Water conservation mechanisms, such as a waxy cuticle, help to reduce water loss. A dominant sporophyte (the diploid generation of the plant life cycle) is necessary for reproduction on land, and a dominant gametophyte (the haploid generation) is necessary for the production of spores.
In summary, stomata for gas exchange were useful for plants but not necessary for the evolution of land plants as the other options, which were useful for the plants to adapt and survive on land.
Explain why the gases came out of the leaf when it was put into warm water
Explanation:
the leaf is using light to uphold photosynthesis when underwater. oxygenating the leaf is one of the steps in this experiment.
you are investigating the bubbles forming in the water which are caused by oxygen .so plants don't breathe using lungs as we humans do they just take in and evict air.
dichotomous key of a cockroach
Answer:
Identification of cockroaches is limited here to adults. A major source of confusion is the recognition of adults from nymphs.There are subjective differences, as well as morphological differences. Immature cockroaches are known as nymphs. Nymphs closely resemble adults except nymphs are generally smaller and lack wings and genital openings or copulatory appendages at the tip of their abdomen. Many species, however, have wingless adult females. Nymphs of these may be recognized by their shorter, relatively broad cerci and lack of external genitalia. Male cockroaches possess styli in addition to paired cerci. Styli arise from the subgenital plate and are generally conspicuous, but may also be reduced in some species. Styli are absent in adult females and nymphs
Hope it helps
Please mark me as the brainliest
Thank you
The resting membrane potential results when the tendency for attraction to opposite charges iside the cell. To diffuse out of the cell is balanced by their
Answer:
K⁺
Explanation:
The resting membrane potential results when the tendency for K⁺ to diffuse
Resting membrane potential is simply the electrical PD across plasma membrane whenever the cell has entered its Non-excited state.
In 3–5 sentences, compare and contrast the flow of matter and energy for land-based ecosystems and marine ecosystems. How and why are they similar, and how and why are they different?.
Similarity includes Both the Marine and Land based ecosystems depends on one another energy .
Differences are in land ecosystem the animals are divided into primary producers , primary consumers , secondary consumers and tertiary consumers in marine these are not divided into categories.
Marine ecosystems are found in water whereas terrestrial ecosystems are ecosystems that are found only on landforms. The marine ecosystems are biologically more diverse than the terrestrial ecosystems. In Terrestrial and marine ecosystem, the energy flows from sun to primary producers in the lowest trophic levels then moves to higher trophic levels.
To learn more about ecosystems , here
brainly.com/question/13979184
#SPJ4
What is the sensitivity and specificity of Speeds test shoulder?
The sensitivity and specificity of Speed's test vary depending on the population being tested, the clinical context, and the reference standard used.
The Speed's test is a physical examination test commonly used to evaluate possible bicipital tendonitis or SLAP (Superior Labrum Anterior to Posterior) tears in the shoulder. It involves the patient raising their arm with the elbow extended and the forearm supinated while the examiner resists the movement.
However, a systematic review of the literature on physical examination tests for SLAP tears found that the pooled sensitivity and specificity of the Speed test were 0.46 and 0.88, respectively.
This means that Speed's test is better at ruling out SLAP tears (high specificity) than confirming their presence (low sensitivity). Therefore, if the Speed test is negative, it is unlikely that the patient has a SLAP tear. However, if the Speed test is positive, further diagnostic tests may be necessary to confirm the diagnosis. It is important to note that no physical examination test is perfect and that clinical judgment, patient history, and other tests (such as imaging studies) should be considered when diagnosing.
Know more about physical examination here: https://brainly.com/question/28306075
#SPJ4
What are the yellow dots on the pink membrane?
Which of these is most likely to cause some form of mutation?
A. drinking purified water from a big city's water supply
B. smoking cigarettes
C. growing old
D. eating large amounts of high-fat foods
How did the animals conceal the fact that they were running out of food? why did they do this?
The animals in the novel "Animal Farm" concealed the fact that they were running out of food by falsifying their records. This was done in order to maintain the illusion that the farm was successful and to prevent the animals from losing faith in the revolution.
They did this by increasing the food production figures on the records and lying to the animals about how much food was actually available. This allowed them to keep up the appearance that everything was going well on the farm, even though it was not.
The pigs, who were in charge, did this to maintain their power and control over the other animals. They knew that if the animals found out that they were running out of food, they would lose faith in the revolution and potentially revolt against the pigs.
Your question is incomplete, most likely it was:
How did the animals in Animal Farm conceal the fact that they were running out of food? why did they do this?
Learn more about Animal Farm here:
https://brainly.com/question/11752825
#SPJ11
An anterior and posterior nasal packing was performed for the epistaxis. Assign the ICD-10-PCS procedure code. ________
An anterior and posterior nasal packing was performed for the epistaxis. The ICD-10-PCS procedure code is 0JH606Z.
The ICD-10-PCS procedure code for the given scenario is 0JH606Z. This code represents the insertion of packing material into both the anterior and posterior nasal cavities.
The code is structured in such a way that the first character, 0, indicates that it is a medical and surgical section code. The second character, J, represents the body system, which in this case is the respiratory system.
The third character, H, specifies the root operation, which is "drainage" in this case.
The fourth character, 6, indicates the body part, which is the nasal cavity. The fifth character, 0, specifies the approach, which is "open" in this case. The final character, Z, represents the qualifier, which indicates the number of devices used, which is "none" in this case.
To learn more about the respiratory system visit:
https://brainly.com/question/28319009
#SPJ11
In a desert environment that is becoming warmer over time, the average ear length in a jackrabbit population is observed to be longer than in other jackrabbit populations. Which statement best explains how natural selection would have influenced the change in the jackrabbits’ ears?
A.
Jackrabbits with longer ears were better able to find food and water in the warming desert environment.
B.
Jackrabbits in the warming desert environment hybridized with other species of jackrabbits living in the area.
C.
Longer ears are an advantage in the warming desert environment, so jackrabbits with the longest ears were best able to survive and pass on the allele for longer ears.
D.
Longer ears are an acquired trait that occurs when individual jackrabbits can obtain more food energy because the warming desert environment has a longer growing season.
The statement that best explains how natural selection would have influenced the change in the jackrabbits' ears is C: "Longer ears are an advantage in the warming desert environment, so jackrabbits with the longest ears were best able to survive and pass on the allele for longer ears."
In a warming desert environment, longer ears provide jackrabbits with several advantages that increase their chances of survival and reproductive success.
Here's an elaboration on how natural selection would have influenced the change in the jackrabbits' ears:
1)Thermoregulation: Longer ears have a larger surface area and can help dissipate heat more efficiently.
In a warming desert environment, this adaptation allows jackrabbits to maintain a lower body temperature by facilitating heat loss through the ears, reducing the risk of overheating.
2)Sensory perception: Jackrabbits rely on their excellent hearing to detect potential predators or prey.
Longer ears can enhance their auditory capabilities, enabling them to detect faint sounds more effectively.
This advantage helps them in locating food, water sources, and avoiding predation.
3)Cooling through blood vessels: Jackrabbit ears have extensive networks of blood vessels close to the skin's surface, which aids in cooling.
As warm blood flows through the ears, heat is transferred to the surrounding air, promoting efficient cooling and temperature regulation.
4)Natural selection: In the warming desert environment, jackrabbits with longer ears would have had a greater chance of survival and reproduction.
They would be better adapted to cope with the increasing temperatures, find essential resources like food and water, and avoid heat-related stress.
These jackrabbits would pass on the allele for longer ears to their offspring, leading to an increased prevalence of longer-eared individuals in the population over time.
For more questions on desert
https://brainly.com/question/29447698
#SPJ8
our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a change to a g result in a change in gene expression?
No, a change to a G would not result in a change in gene expression as the underlined C is a non-coding nucleotide and does not have any effect on gene expression.
Non-coding DNA corresponds to the portion of an organism's genome that does not code for amino acids, the building blocks of proteins. Some noncoding DNA sequences are known to play functional roles such as regulation of gene expression, whereas other regions of noncoding DNA have no known function. Other regions of non-coding DNA are important for protein assembly. By altering one of these regions, a variant (also known as a mutation) in the noncoding DNA can turn on the gene, causing the protein to be produced in the wrong place or at the wrong time. There are two types of SNPs in the coding region.Synonymous and non-synonymous SNPs. Synonymous SNPs do not affect the protein sequence, whereas non-synonymous SNPs change the amino acid sequence of the protein.
To know more about Non-coding DNA visit:
https://brainly.com/question/28360970?referrer=searchResults
#SPJ4
Describe how secondary electron (SE) and backscattered electron
(BSE) signals are formed in a scanning electron microscope, making
clear in your answer four differences between the two types of
signal
In a scanning electron microscope, the signals from the sample result from the interaction of the electron beam with the sample. These signals include secondary electrons (SEs) and backscattered electrons (BSEs).SEs are formed when the incident beam strikes atoms in the sample and causes the emission of low-energy electrons.
SEs are emitted from a thin layer near the surface of the sample and carry information about the surface topography. They have low energy and are easily scattered by the sample. SE signals provide high-resolution images of the sample surface.
BSEs are formed when the incident beam strikes atoms in the sample and causes the emission of high-energy electrons. BSEs are emitted from a greater depth in the sample than SEs and carry information about the composition of the sample. They have high energy and can penetrate deeper into the sample.
BSE signals provide information about the atomic number of the sample material. The four differences between SE and BSE signals are:
1. Depth of origin: SEs are emitted from a thin layer near the surface of the sample while BSEs are emitted from a greater depth in the sample.
2. Energy: SEs have low energy while BSEs have high energy.
3. Scattering: SEs are easily scattered by the sample while BSEs are less scattered by the sample.
4. Information provided: SE signals provide high-resolution images of the sample surface while BSE signals provide information about the atomic number of the sample material.
To learn about electrons here:
https://brainly.com/question/28992636
#SPJ11
Read each description below and determine to which stage of sleep each pertains. then click and drag each box into the appropriate category below.
Answer:
Explanation:
The descriptions provided in the question can each be placed into its corresponding Stage of Sleep, like so...
Stage 1
- Alpha waves dominate
- Feeling a drifting sensation
Stage 2
- Light sleep
- Sleep spindles occur
- Beginning of decline in respiration and blood pressure
Stage 3
- Typically begins about 20 minutes after stage 1
Stage 4
- Vital signs are at their lowest levels
- Delta waves dominate
TRUE/FALSE. Correlations depict two concepts: direction and strength. Direction is the concept that determines whether the relationship is strong or weak.
True. Correlations measure the relationship between two variables, and they can show the direction of the relationship (positive or negative) as well as the strength of the relationship (strong or weak). The direction of the correlation tells us whether the variables move in the same direction (positive) or opposite directions (negative), while the strength of the correlation tells us how closely the variables are related.
For example, a strong positive correlation between two variables means that as one variable increases, the other variable also increases in a linear fashion.
True/False: Correlations depict two concepts: direction and strength. Direction is the concept that determines whether the relationship is strong or weak.
Answer: False. While it is true that correlations depict two concepts, direction and strength, the statement is incorrect in saying that direction determines the relationship's strength. Direction refers to whether the relationship is positive or negative, meaning that as one variable increases, the other either increases (positive correlation) or decreases (negative correlation). Strength, on the other hand, refers to the extent of the relationship between the two variables and how closely they are associated. It does not rely on direction to determine its value.
To know more about relationship visit-
https://brainly.com/question/31248849
#SPJ11
. which of the following is a function of the urinary system? a. filtration of blood b. management of waste products in blood c. temporary storage of urine d. formation of urine e. regulation of blood pressure and volume f. adjustment of plasma ph
Answer:
The functions of the urinary system are:
All of these, a. filtration of blood b. management of waste products in blood c. temporary storage of urine d. formation of urine e. regulation of blood pressure and volume f. adjustment of plasma pH.
Explanation:
Function of the urinary system
The urinary system begins with the kidneys. The smallest unit of the kidney, the nephron, consists of an arteriole, a glomerulus, Bowman's capsule, and a tubule. Blood in the arterioles will enter the glomerular capillaries and be filtered (Function 1: filtration of blood).
Then, it enters Bowman's capsule and tubules. In the tubules, two things occur: reabsorption and secretion. Reabsorption is to reabsorb the filtered material that is still needed by the body from tubules into the arterioles. Meanwhile, the secretion carries out the material that is not filtered and is no longer needed into the tubules (Function 2: management of waste products in the blood).
In the process of reabsorption and secretion, there is regulation of blood pressure and blood volume by the RAAS (Renin-Angiotensin-Aldosterone System). These three enzymes form the system by receiving signals from blood vessels. If there is hypotension (decreased blood pressure) or hypovolemia (reduced blood volume), blood flow to the kidneys will decrease and baroreceptors (blood pressure receptors) in the body will also detect it. Then RAAS will be activated. Activation in hypotension/hypovolemia will result in increased reabsorption of sodium and water, so that it will increase blood pressure (Function 3: regulation of blood pressure and volume).
In addition, reabsorption and secretion processes also occur for blood pH regulation with ions, namely H+ and HCO3- ions. When the blood pH is too acidic, H+ ions will be secreted and HCO3- ions will be reabsorbed. This will make the blood pH remain alkaline (Function 4: adjustment of plasma pH).
After reabsorption and secretion, the products in the tubules will be excreted into urine (Function 5: urine formation).
The urine formed in the tubules unites and exits the kidney through the ureter and is temporarily stored in the bladder (Function 6: temporary storage of urine).
Learn more about urinary system here: https://brainly.com/question/11859334
#SPJ1
what is the first step in allopatric speciation? group of answer choices genetic divergence of a population due to polyploidy genetic drift physical isolation of two populations increased gene flow between two populations
The first step in allopatric speciation is physical isolation of two populations.
Allopatric speciation occurs when a population is geographically separated or isolated from another population of the same species. This physical separation creates barriers that prevent gene flow between the populations.
Over time, the isolated populations may experience different environmental conditions, natural selection pressures, and genetic drift, leading to genetic divergence and the formation of distinct species. The physical isolation serves as the initial trigger for the divergence and subsequent speciation process in allopatric speciation.
Learn more about Allopatric here
https://brainly.com/question/32062070
#SPJ11
How is information from an odor passed all the way to the brain starting from the odor itself.
Answer:
When we smell anything, our nose detects microscopic fragments of that object (for example, we can perceive the aroma of a flower because tiny fragments of the flower are in the air). These little fragments are known as odour molecules. When our nose senses odour molecules, they travel to the olfactory bulb, a particular area of our brain. This is the location where the scent is initially processed. The signal is then sent to other regions of our brain, such as the olfactory cortex, which helps us distinguish various smells, and the amygdala, which helps us correlate odours with emotions (for example, a certain fragrance may remind you of a good memory). Finally, the signal reaches the hippocampus, which is critical for remembering.
Classify each statement as describing class I MHC proteins or class II MHC proteins. Class I MHC Class II MHC Answer Bank usually found on the surface of antigen-presenting cells found on the surface of all noncancerous nucleated cells displays fragments of proteins synthesized within the cell activates CD4 T cells displays protein fragments from endocytosed materials activates CD8 T cells
The statement "usually found on the surface of antigen-presenting cells" describes Class II MHC proteins. The statement "found on the surface of all noncancerous nucleated cells" describes Class I MHC proteins.
The statement "displays fragments of proteins synthesized within the cell" describes Class I MHC proteins. The statement "displays protein fragments from endocytosed materials" describes Class II MHC proteins. The statement "activates CD4 T cells" describes Class II MHC proteins. The statement "activates CD8 T cells" describes Class I MHC proteins.
Class I MHC proteins:
- Found on the surface of all noncancerous nucleated cells
- Displays fragments of proteins synthesized within the cell
- Activates CD8 T cells
Class II MHC proteins:
- Usually found on the surface of antigen-presenting cells
- Displays protein fragments from endocytosed materials
- Activates CD4 T cells
Learn more about proteins here:
https://brainly.com/question/29776206
#SPJ11
Four differences between the aorta and vena cava ?
Answer:
Aorta and vena cava are two main types of blood vessels attached to the heart. The main difference between aorta and vena cava is that aorta carries oxygenated blood whereas vena cava carries deoxygenated blood. Aorta is the main artery that leaves the heart through the left ventricle. It supplies oxygenated blood throughout the body. Two types of venae cavae supply blood to the right atrium of the heart. They are superior vena cava and inferior vena cava. Superior vena cava drains deoxygenated blood from the head, arms, and other upper parts of the body while inferior vena cava drains that from the lower parts of the body.
3. If a mutation occurs on a segment of DNA that codes
for an enzyme, what is most likely to happen to the
enzyme?
A amino acid that is synthesized changes as a result, which may alter the structure of an enzyme's active site.
What is an easy way to define enzyme?A biological catalyst called an enzyme is usually always a protein. It promotes a certain chemical reaction inside the organism. The enzyme is continuously employed during the process and is not destroyed.
What is an example of an enzyme?Several instances include: Lipases: This class of digestive enzymes aids in the breakdown of lipids in the gastrointestinal tract. Hydrolyzes: Enzymes assists in the transformation of starches to sugars inside the salivary. The salivary enzyme maltose breaks down the sugar malted grains into glucose.
To know more about Enzyme visit:
https://brainly.com/question/14953274
#SPJ1
In insects, a Hox gene called Ubx controls the development of legs in the
abdomen. Which is the most likely result if the Ubx gene was activated either before or after
it is normally activated in the sequence of Hox gene expression?
Answer:
It's D
Explanation:
:)
the products of protein and carbohydrate catabolism are absorbed into the ______, while the products of lipid catabolism are absorbed into the ______.
Answer:
the answer is the small intestine, stomach
Explanation:
the products of protein and carbohydrate catabolism are absorbed into the small intestine, while the products of lipid catabolism are absorbed into the stomach.
The products of protein and carbohydrate catabolism are absorbed into the bloodstream, while the products of lipid catabolism are absorbed into the lymphatic system.
During digestion, proteins and carbohydrates are broken down into their respective building blocks, amino acids, and simple sugars. These molecules are small enough to be absorbed directly into the blood through the lining of the small intestine. The blood then transports these nutrients to cells throughout the body where they are used for various metabolic processes.
On the other hand, lipids (fats) are broken down into fatty acids and glycerol during digestion. However, these molecules are not water-soluble and cannot be directly absorbed into the bloodstream. Instead, they are packaged into small particles called chylomicrons within the intestinal cells. Chylomicrons are then released into the lymphatic system, a network of vessels that transport lymph, a fluid containing immune cells and fats.
The lymphatic system eventually merges with the bloodstream, allowing the products of lipid catabolism to be distributed throughout the body for energy production, storage, or cellular functions. In summary, protein and carbohydrate catabolism products enter the bloodstream directly, while lipid catabolism products are first absorbed into the lymphatic system before reaching the bloodstream.
Learn more about lipid catabolism here: https://brainly.com/question/29351871
#SPJ11
how an atom change if all of its electrons are removed
Answer:
If all the electrons of an atom are removed, it will change to become a positively charged ion called a cation. Additionally, the loss of all of its electrons means there is no negative charge to balance the positive charges of the protons.
Explanation:
Blood type is a type of gene where both alleles can be expressed. Which statement best explains a person with AB blood type.
Answer:There is a codominant relationship between alleles
Explanation:
Which plant structures are common to all angiosperm? A.spores B.flowers C.cones D.endoskeleton
Answer:
b
Explanation:
how do i know because i got it right
Answer: B
Explanation: what he said